zika virus experimental investigation

• Open access
• Published: 04 March 2020

A review on Zika virus outbreak, epidemiology, transmission and infection dynamics

• Syeda Sidra Kazmi 1 ,
• Waqar Ali 1 ,
• Nousheen Bibi 1 &
• Faisal Nouroz 1 , 2  

Journal of Biological Research-Thessaloniki volume  27 , Article number:  5 ( 2020 ) Cite this article

16k Accesses

49 Citations

6 Altmetric

Metrics details

Zika virus (ZIKV) is a newly emergent relative of the Flaviviridae family and linked to dengue (DENV) and Chikungunya (CHIVKV). ZIKV is one of the rising pathogens promptly surpassing geographical borders. ZIKV infection was characterized by mild disease with fever, headache, rash, arthralgia and conjunctivitis, with exceptional reports of an association with Guillain–Barre syndrome (GBS) and microcephaly. However, since the end of 2015, an increase in the number of GBS associated cases and an astonishing number of microcephaly in fetus and new-borns in Brazil have been related to ZIKV infection, raising serious worldwide public health concerns. ZIKV is transmitted by the bite of infected female mosquitoes of Aedes species. Clarifying such worrisome relationships is, thus, a current unavoidable goal. Here, we extensively described the current understanding of the effects of ZIKV on heath, clinical manifestation, diagnosis and treatment options based on modern, alternative and complementary medicines regarding the disease.

Introduction

Among the family of viruses, Zika virus (ZIKV) is an emerging evolving virus on the western hemisphere, though it was initially reported from Uganda in 1940s [ 1 , 2 ]. Transmission of ZIKV is related to the two other imperative arbo-viruses including dengue virus (DENV) and chikungunya virus (CHIVKV) [ 3 ]. In a quest to solve the dilemma of yellow fever, a study conducted in 1947 isolated the first novel virus from the blood of a sentinel rhesus macaque placed in the Zika Forest of Uganda [ 4 , 5 ]. ZIKV stayed relatively silent for almost 70 years and all of a sudden emerged all over the America after Pacific Islands to Brazil [ 6 ]. Recently it was identified that the ZIKV strain found in the Americas had escalated to Angola and was linked with a cluster of microcephaly [ 7 , 8 , 9 ]. Hill et al. also reported similar results based on full virus genome analysis [ 9 ]. All the above mentioned studies endorse overview of mosquito-borne transmission of the ZIKV strain from the Americas into continental Africa. World Health Organization (WHO) declared it as emergency of public health with international concern as a result of global alarm created by ZIKV by becoming first foremost infectious disease coupled with defects of human birth revealed in more than a half of century [ 10 ].

History and epidemiology of ZIKV

ZIKV is a member of family Flaviviridae and spread through Aedes genus. Other members of this family include arboviruses, dengue virus and Japanese encephalitis viruses [ 11 ]. ZIKV antibodies were also detected in animal species, especially non-human primates [ 12 ]. ZIKV was also isolated from several mosquito species in Africa and Asia including arboreal mosquitoes as Aedes africanus or mosquitoes with a large tropical and subtropical distribution as Aedes aegypti [ 13 ] and Aedes albopictus , respectively [ 14 ]. Studies reported that ZIKV has three main lineages, two from Africa and one from Asia [ 15 , 16 ]. The African lineage split in East and West African clusters [ 17 , 18 ]. Asian lineage presents expanded geographical distribution [ 18 ], since it emerged in the Pacific Ocean [ 19 ] and South America [ 20 , 21 ]. The 2015–16 epidemic occurred in the America was due to strain of the Asian lineage generally known as the American strain [ 22 , 23 ]. However, some consider the American outbreak strain as its own lineage. Epidemiology studies revealed distribution of ZIKV in half of the north African continent, Vietnam, Malaysia, Indonesia, Philippines, India, Thailand and Pakistan (Fig.  1 ) [ 11 , 24 ]. The first human case was detected in Uganda in 1952 during a study indicating the presence of neutralizing antibodies to ZIKV in sera [ 25 ]. Only few cases of infection in human were reported before 2007 when outbreak of ZIKV infection in humans occurred in Yap, Federated States of Micronesia, in the Pacific region [ 26 ]. In French Polynesia the largest epidemic of ZIKV occurred during 2013 to 2014 and extended to New Caledonia, Cook Islands, Vanuatu, Easter Island, Solomon Islands and other Pacific Islands [ 5 ]. ZIKV transmission is known in 55 countries and territories. However, only in 2015 to 2016, indigenous transmission have been reported for 41 of them, with indirect confirmation regarding circulation of virus in six countries, terminated outbreaks reported in five countries while three countries were affected with local infection [ 27 ].

Chronological time-line of ZIKV epidemic from 1947–2016

Molecular biology and virology

Flaviviridae family contains clinically important arboviruses with four genera including Hepacivirus (one species that is hepatitis C virus), Pestivirus (four species), Pegivirus (two species) and Flavivirus (53 species). Other than hepatitis C virus, most of the clinically relevant pathogens belong to the genus Flavivirus [ 28 ]. The most significant clinical manifestations by Flaviviruses include fever, rashes, encephalitis, visceral involvement and hemorrhagic fever [ 29 ].

The length of ZIKV genome is 10,794 kb, comprising a positive sense single-stranded RNA molecule having two noncoding regions (NCR); 39 and 59 NCR and a long open reading frame that encode a polyprotein: 59-C-prM-E-NS1-NS2A-NS2BNS3-NS4A-NS4B-NS5-39. The protein is cleaved into capsid (C), envelope (E), precursor of membrane (prM) and seven non-structural proteins (NS1-NS2A-NS2BNS3-NS4A-NS4B-NS5) (Fig.  2 ) [ 30 ]. The major virion surface protein is E protein. This protein is involved in various features of the viral cycle, membrane fusion and mediating binding. The largest viral protein whose C-terminal portion has RNA-dependent RNA polymerase (RdRP) is NS5 protein activity and its N-terminus is responsible for RNA capping because of its processing due to methyl transferase activity [ 31 ]. 428 nucleotides and 27 folding patterns are present in the 39 NCR of the ZIKV genome [ 30 ]. These nucleotides and folding patterns may involve in the cyclization, translation, recognition by cellular factors, RNA packaging, recognition by viral factors and genome stabilization [ 31 ].

The genome organization of ZIKV

All identified structures of flaviviruses vary on the basis of amino acids that are framing a glycosylation spot in the shell of virus that is composed of two dissimilar proteins having 180 copies. ZIKV varies from other flaviviruses bulges by glycosylation spot on the surface of the virus. A carbohydrate molecule holds numerous sugars tied to the surface of viral protein at this spot. Surrounding residues and glycosylation site on ZIKV may be responsible for attachment of virus to human cells. The amino acids variations among different flaviviruses could suggest the differences in the varieties of human cells where it can attach and infect. If the function of glycosylation spot is analogous to DENV (attachment to the cells receptor of human body) it might be a worthy spot to be targeted by an antiviral compound [ 32 ].

Incubation period for ZIKV disease is around 2–7 days [ 33 ], with symptoms like influenza syndrome accompanying fever, malaise, headache, dizziness, stomachache, anorexia and maculopapular rash [ 34 ]. It can also cause retro orbital eye pain, lymph adenopathy, diarrhea and oedema [ 15 ]. Other indications reported are oedema of extremities, gastro intestinal disturbances, photophobia, cough malaise, back pain, aphthous ulcers and sweating. ZIKV infection can be misdiagnosed with other arboviruses and bacterial infections as not explicit to ZIKV infection, especially in prevalent areas. In French Polynesia serious neurological complications with Guillain–Barré syndrome was increased to 20-fold during the epidemic [ 35 ].

Transmission of ZIKV

Zikv vector-borne transmission.

Aedes aegypti , Aedes polynesiensis and Aedes albopictus are the potential vectors responsible for the transmission of ZIKV infection by biting. Aedes aegypti is the foremost vector of DENV and CHIKV. Aedes polynesiensis is the main vector responsible for dissemination of lymphatic filariasis in French Polynesia. After the epidemic in French Polynesia these species of mosquitoes were collected and tested for ZIKV infection by RT-PCR and only one Aedes aegypti mosquito was confirmed having ZIKV RNA; experimental investigations showed the French Polynesian strain of Aedes aegypti can replicate the French Polynesian ZIKV strain (Additional file 1 : Figure S1) [ 36 ].

Altogether, 61 countries and territories in six WHO regions have confirmation of conventional competent Aedes aegypti vectors but have not yet documented ZIKV transmission [ 37 ]. Thus, risk of ZIKV spread to other countries is still likely. Might be due to lack of detection fewer countries did not report transmission. The re-emergence or re-introduction was also reported in all areas with prior reports of ZIKV transmission.

Altogether in the African lineage eight mosquitoes were isolated, while P6-740 was the only mosquito isolated in the Asian lineage (Malaysia/1966). In 2007, ZIKV was identified in patients infected with Aedes aldopictus  mosquitoes from West Africa [ 14 ]. However, the Aedes (stregomyia) hensilli  identified as the probable principal vector that cause Micronesia outbreak [ 38 ]. Later on, in 2013, the ZIKV spread out to French Polynesia, with consequent extent to Oceanian islands (New Caledonia, Cook islands, and Easter island), was mostly related with Aedes aegypti  and  Aedes aldopictus  species [ 39 ]. The major symptoms such as rash, low-grade fever, arthralgia, conjunctivitis and GBS (Guillain–Barré syndrome) were observed in 11% of the total population [ 40 ]. Furthermore, in Central-South America, Aedes aegypti  is considered as the utmost common vector for DENV [ 41 ]. Later on in 2006, Chouin-Carneiro reported that the New World strains of Aedes aegypti and Aedes albopictus which found to be poor transmitters of ZIKV results in continuous divergence of the Asian lineage [ 42 ]. These strains adopted alternative mode of transmission i.e. direct human to human transmission without the involvement of a vector. Indeed, while  Aedes  is widely accepted as the vector for ZIKV [ 1 , 43 , 44 ], Guedes et al. has revealed that ZIKV can infect and replicate in the salivary glands, midgut, and was also spotted in saliva of  Culex  species [ 45 ]. Altogether this work suggests that the transmission vector range for ZIKV may be larger than foreseen (although still a debatable topic demanding more exploration).

Non-vector-borne transmission

Non-vector-borne transmission of ZIKV infection can be caused during labor (mother to child), organ transplantation, blood transfusions and through sexual contact (Fig.  3 ).

Schematic diagram representing the transmission of ZIKV

Antibodies against ZIKV were detected by Serosurvey studies in goats, rodents ( Meriones hurrianae and Tatera indica ), sheep and bats. These studies suggest that there is no clear association between ZIKV and a specific species of animal [ 36 ]. In humans, it spreads through the bite of infected Aedes aegypti mosquitoes that are usually found in tropical and sub-tropical regions in domestic water-holding containers near dwellings [ 33 ]. Consequently, when a mosquito bites a person already infected with ZIKV, the virus infected blood goes into the midgut and prevailed into the circulatory system. Another similar mosquito, Aedes albopictus can also transmit ZIKV. Among humans, transmission of this viral infection may also refer to sexual contact [ 5 ]. High ZIKV RNA load has detected in breast milk, so transmission is possible by breast feeding and ZIKV can also be transmitted by blood transfusions [ 46 ] as reported on December 2015 in Brazil, the first case of ZIKV blood transfusion transmission [ 47 ]. ZIKV is adopted to transmit by enzootic and sub Urban cycle (Fig.  4 ); in enzootic setting this involves mosquitoes of Aedes species and non-human primates, however transmission in Urban setting involves human and mosquitoes of Aedes species demonstrate vector and non-vector borne transmission of ZIKV.

Transmission cycle of ZIKV

Pathophysiology and diagnosis

In the beginning, ZIKV infection was misdiagnosed with dengue infection. Virus isolation and serological methods are carried out for laboratory diagnosis examination for ZIKV (Table  1 ) [ 48 ]. Virus isolation needs several days (i.e. 1–2 weeks) while convalescent and acute sampling and cross-reactions among flaviviruses are the limitations for serological methods [ 15 ]. Cell culture may be utilized to isolate ZIKV [ 5 ] but specialized laboratories are required to practice it [ 5 , 16 ]. Reverse transcription PCR (RT-PCR) is used for confirmation of ZIKV infections whereas IgM against ZIKV can be detected by ELISA [ 48 ]. RT-PCR is time saving, specific and sensitive in order to detect ZIKV in serum or cell culture [ 15 ]. Molecular detection of ZIKV was increased when saliva was used at the acute phase of disease particularly in children and neonates as blood is difficult to collect [ 5 ]. ZIKV fever diagnosis from PAHO is shown in Fig.  5 . RT-PCR for ZIKV is done on blood or saliva sample. Sequencing is performed if the results of RT-PCR are positive. ZIKV IgM serology comprises detection by immunofluorescence or ELISA, with confirmation by plaque reduction neutralization test (PRNT) if results are equivocal or positive [ 36 ].

Flow scheme for ZIKV fever diagnosis [ 73 , 74 ]

Neurological complications of ZIKV infection

Guillain–Barré syndrome and cases of other neurologic manifestations appears in Brazil and French Polynesia throughout ZIKV epidemics, even though it is self-limiting [ 50 , 51 ]. A report from Ministry of Health of Brazil indicates that there is a possible relation between fetal deformities and infection with ZIKV in pregnancy, as the incidences of microcephaly cases among neonates have amplified by a factor of about 20 [ 51 ]. ZIKV infection in fetus can be identified by Ultrasound in second or early third trimester [ 52 ]. Approximately 5640 cases of central nervous system malformation and microcephaly have been stated by Brazil comprising 120 deaths in between 22nd October 2015 and 20th February 2016; however, only 163 cases of microcephaly were recorded in Brazil per year on average from 2001 to 2014. Of the 5640 cases, deaths of 120 children occurred during pregnancy or after birth and 30 of these were associated to congenital ZIKV infection [ 53 ]. It has been published from the Paraíba State recently that ZIKV infection was detected in newborns having severe congenital CNS malformations. Among these, six cases were reported with confirmed laboratory results of ZIKV; in fetal tissues, amniotic fluid and placenta. All of these reported cases have history of visit to Brazil. There are increasing numbers of cases with intertwined relation between congenital CNS malformations during pregnancy and ZIKV infection [ 54 ].

Risk of Guillain–Barré syndrome

Guillain–Barré syndrome (GBS) is one of the new complications and manifestations of ZIKV infection [ 34 ]. GBS is a serious and life threatening neurological disorder eventually resulting in respiratory failure characterized by progressive muscular weakness [ 55 ]. Outbreak of ZIKV in French Polynesia four years ago added it to the viruses that can trigger GBS [ 56 ]. WHO estimated there could be 3 to 4 million cases of this infection in the following year, therefore, there is a probability of hundreds of cases of GBS. Sufficient intravenous (IV) immunoglobulin (Ig) treatment for patients with ZIKV related GBS should be applied [ 57 ]. Increased verification of a ZIKV infection based on laboratory results and GBS prevalence have been reported in 12 countries. In 2015, 1708 GBS cases were recorded in Brazil, indicating a 19% escalation from the preceding year as 1439 GBS cases were reported in 2014. 62% of GBS cases reported in Brazil had a history of signs and symptoms associated to this viral infection. 220 cases of GBS are reported in Colombia while 136 in El Salvador including 5 deaths in the time period from December 2015 to March 2016 [ 53 ].

Treatment of ZIKV

In ZIKV infection, individuals should have adequate water intake, ample rest and treat pain and fever with liquid solutions. If the symptoms aggravate, they should look for counselling and therapeutic consideration (Fig.  6 ). There are no specific medications or vaccine available to treat or prevent ZIKV infections until now; only medications for symptomatic relief can be considered such as paracetamol to relieve pain and fever associated with this infection [ 33 ]. Nonsteroidal anti-inflammatory drugs (NSAIDs) should be avoided and individuals should seek medical advice before taking additional medication if they are already taking medicines for another medical condition [ 54 ]. Homeopathy is a worthy treatment option in ZIKV infection as it proved to be effective in Japanese encephalitis virus which is included in the same genus like Zika virus [ 33 ]. Treatment with belladonna efficaciously reduced the severity of Japanese encephalitis virus infection [ 58 ]. Atropa belladonna plant belongs to family Solanaceae [ 59 ]. It has been effective in numerous medical conditions having great commercial significance as a major source of alkaloids, mainly scopolamine and hyoscyamine that are pharmaceutical bioactive compounds [ 60 ]. Belladonna is native to North Africa, Western Asia and Europe. In Atropa belladonna majority of alkaloidal contents are present in ripe fruit and green leaves. It has been used from ancient times in order to treat various human ailments including menstrual disorders, headache, peptic ulcer, inflammation and histaminic reaction [ 61 ]. Ultra-diluted belladonna concentrations like 1:10 or 1:100 are used in homeopathy and they are recommended for management of all the infectious diseases and illnesses [ 62 ].

Schematic representation of possible ZIKV treatment

Eupatorium is a naturally occurring pharmaceutical homeopathic compound effective against the symptoms of ZIKV disease, so it can be utilized as prophylactic treatment against ZIKV infection [ 63 ]. Eupatorium perfoliatum , Rhustox and Atropa belladonna are the homeopathic prescriptions that may be utilized for ZIKV infection treatment. These medicinal agents are effective against the symptoms of ZIKV infection [ 64 ]. During epidemics homeopathic pharmaceuticals are more effective in reduction of mortality and morbidity as compare to conventional system of medicines [ 65 ].

One of the utmost momentous features of ayurvedic structure is that they are natural substances and free from side effects and there is no scientific evidence of danger for human use [ 66 ]. It is a primordial medical science that contains herbal medicines of natural origin with minimal side effects. Tinospora cordifolia is a herb and utilized for years as potential immunomodulator and effective natural remedy for viral disease of any nature. It boosts up the immune system and make body resistant enough to fight against infections. Theses herbs potentiate phagocytic abilities of macrophages [ 67 ]. Intestinal sickness, urinary tract infections, dengue and swine influenza are effectively treated by the astringent characteristics of these ayurvedic plants so they might also be effective for ZIKV [ 33 ].

Beside homeopathic and ayurveda medicines, engineering approaches were also applied to develop peptide therapeutics and support the potential of a brain-penetrating peptide to treat neurotropic viral infections. Therapeutic treatment protected against mortality and evidently lessened symptoms, neuroinflammation and viral loads, furthermore mitigated microgliosis, neurodegeneration and brain damage [ 68 ].

Current medical recommendations are directed towards resolving symptoms and not the actual infection; however, ZIKV treatments and vaccines are in development. In 2016, WHO enlist all publicly affirmed commercial, government and academic-led projects focused at ZIKV interventions, together with vaccines [ 69 ]. The list encompasses numerous approaches, comprising vaccines via purified inactivated virus, Virus-like particles (VLP), protein subunits, DNA and live recombinant attenuated viruses. Since April 2019, no vaccines have been permitted for clinical usage, though utmost were in the clinical stages of development [ 70 , 71 ].

Suggested workflow for prompt discovery of drug counter to ZIKV is presented in Fig.  7 ; whole process is proposed to initiate from screening moderate or high-throughput in vitro analysis development following with testing of approved drugs or other antiviral agents. Virtual screening based on docking could be selected for testing further compounds by means of advanced model of homology or phenotypic and genotypic analyses if drug repurposing will be unsuccessful. Priority can be given to the compounds resulting from docking for in vitro analysis in parallel. Consequent steps are typical as a pipeline in the discovery of any drug including developing the models of animals, clinical trial and if getting optimistic results, manufacturing the drug against ZIKV by scale up process, advertising and dissemination of drug [ 72 ].

Proposed workflow for drug development against ZIKV

Prevention and control of ZIKV

Most precarious threats for ZIKV infection are mosquitoes including their reproducing localities. Their encounter with humans must be reduced in order to control and prevent their outspread. This can be employed by using mosquito repellents, mosquito nettings and closing the entrances and openings. Insect killing sprays recommended by the WHO Pesticide Evaluation Scheme should be used as larvicides [ 27 , 34 ]. Insect repellents should not be used for babies under two months, mosquito nets should be used to protect babies from insect bite. Centre of disease control recommends mosquito repellents with active ingredients picaridin, DEET, eucalyptus oil, IR3535, oil of lemon and para-menthane-diol. These are safe for pregnant and lactating mothers [ 54 ]. Repellants containing eucalyptus oil, lemon oil and para-menthane-diol should be avoided for children below 3 years of age. Mosquitoes should be killed using indoor mosquito killing sprays which contain active ingredient Imidacloprid and β-Cyfluthrin available in market [ 75 ]. Flying insect fogger can also be used against the mosquitoes containing active ingredients Tetramethrin and Cypermethrin [ 75 ]. Tests against ZIKV infection should be performed before blood transfusions to prevent transfusion related transmission. Pregnancy must be avoided in the high risk ZIKV infection prone areas before complete eradication or extra care must be exercised as microcephaly is associated with ZIKV infection [ 76 ].

Besides, different vector control strategies for averting Zika virus spread can be employed. Subjugation of mosquito population can be accomplished by a bacterium that can infect mosquitoes. Other strategies include the use of intracellular bacteria Wolbachia , which acts as a biopesticide to control mosquito population. Larvae of Toxorhynchites splendens mosquito species does not feed on blood. They feed on the larvae of other mosquito species, while the adults feed on honeydew, fruit, and nectar [ 77 ]. Hence, the spread of ZIKV can be encountered by utilizing these species. Aedes species mosquitoes populations can also be suppressed by the strategy of using sterile males to induce sterility in wild fertile females [ 78 ].

Future directions

Mosquito-borne epidemics are critically aggravating the pre-existing burden that the primary healthcare systems face. Work force will be affected and the societies may be threatened by the epidemic wave if they are not prepared well. Improved investigation and actions against response are required to alleviate the substantial burden on health systems and control promoting it worldwide. At present there is no vaccine available for ZIKV infection. Vaccines against flaviviral infections available for use of human are yellow fever vaccine, Japanese encephalitis vaccine, tick-borne encephalitis vaccines and dengue vaccine, so the rules for the vector borne infections must be followed in order to prevent ZIKV infection, as well as avoiding mosquito bite and control of vector is the only available options. Animal models of the ZIKV disease are immediately required not only for exhibiting the materno-fetal transmission and confirmation of its neurologic manifestations but also to report the influence of virus on host’s immunity and reproductive health throughout the life. ZIKV infection is increasing dramatically, so it is the need of hour to take some necessary steps to eliminate this lethal infection and to constrain its future entrance as well. ZIKV specific rapid molecular diagnosis should be done urgently in order to detect the infection in less time before it aggravates. Modern techniques of molecular biology should be utilized to make vaccine specific to ZIKV. Research gaps should be addressed promptly and systematically. This can be accomplished by understanding the occurrence of broad spectrum clinical consequences that are resulting from fetal ZIKV infection and the environmental influences that effect their emergence. This also require the advancement of flaviviruses selective investigative tools, models of animals to detect developing effects of fetus resulting from viral septicity [ 79 , 80 ], novel products to control vector and strategies, effective medications and the vaccines to shield humans counter to ZIKV disease.

Availability of data and materials

Not applicable.

Dick GWA, Kitchen SF, Haddow AJ. Zika virus (I). Isolations and serological specificity. Trans R Soc Trop Med Hyg. 1952;46:509–20.

Article   CAS   PubMed   Google Scholar  

Leparc-Goffart I, Nougairede A, Cassadou S, Prat C, De Lamballerie X. Chikungunya in the Americas. Lancet. 2014;383:514.

Article   PubMed   Google Scholar  

Christofferson RC. Zika virus emergence and expansion: lessons learned from dengue and chikungunya may not provide all the answers. Am J Trop Med Hyg. 2016. https://doi.org/10.4269/ajtmh.15-0866 .

Article   PubMed   PubMed Central   Google Scholar  

Petersen LR, Jamieson DJ, Powers AM, Honein MA. Zika virus. N Eng J Med. 2016;374:1552–63.

Article   CAS   Google Scholar  

Musso D, Roche C, Robin E, Nhan T, Teissier A, Cao-Lormeau V-M. Potential sexual transmission of Zika virus. Emerg Infect Dis. 2015;21:359–61.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Fauci AS, Morens DM. Zika virus in the Americas—yet another arbovirus threat. N Engl J Med. 2016;374:601–4.

World Health Organization Regional Office for Africa. Microcephaly—suspected congenital Zika syndrome, Angola. Weekly bulletin on outbreaks and other emergencies; Week 48: 25 November-1 December 2017. Accessible at: https://apps.who.int/iris/bitstream/handle/10665/259557/OEW48 - 2504122017.pdf?sequence = 1.

Sassetti M, Zé-Zé L, Franco J, Cunha JD, Gomes A, Tomé A, et al. First case of confirmed congenital Zika syndrome in continental Africa. Trans R Soc Trop Med Hyg. 2018;112:458–62.

Hill SC, Vasconcelos J, Neto Z, Jandondo D, Zé-Ze L, Aguiar RS, et al. Emergence of the Zika virus Asian lineage in Angola: an outbreak investigation. Lancet Inf Dis. 2019. https://doi.org/10.1016/S1473-3099(19)30293-2 .

Article   Google Scholar  

Roos RP. Zika virus—a public health emergency of international concern. JAMA Νeurol. 2016;73:1395–6.

Google Scholar  

Hamel R, Dejarnac O, Wichit S, Ekchariyawat P, Neyret A, Luplertlop N, et al. Biology of Zika virus infection in human skin cells. J Virol. 2015;89:8880–96.

Kirya BG, Okia NO. A yellow fever epizootic in Zika Forest, Uganda, during 1972: part 2: Monkey serology. Trans R Soc Trop Med Hyg. 1977;71:300–3.

Marchette NJ, Garcia R, Rudnick A. Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia. Am J Trop Med Hyg. 1969;18:411–5.

Grard G, Caron M, Mombo IM, Nkoghe D, Ondo SM, Jiolle D, et al. Zika virus in Gabon (Central Africa)—2007: a new threat from Aedes albopictus ? PLoS Negl Trop Dis. 2014;8:e2681.

Faye O, Faye O, Diallo D, Diallo M, Weidmann M, Sall AA. Quantitative real-time PCR detection of Zika virus and evaluation with field-caught mosquitoes. Virol J. 2013;2013(10):311.

Lanciotti RS, Kosoy OL, Laven JJ, Velez JO, Lambert AJ, Johnson AJ, et al. Genetic and serologic properties of Zika virus associated with an epidemic, Yap State, Micronesia, 2007. Emerg Infect Dis. 2008;14:1232–9.

Faye O, Freire CCM, Iamarino A, Faye O, de Oliveira JVC, Diallo M, et al. Molecular evolution of Zika virus during its emergence in the 20th century. PLoS Negl Trop Dis. 2014;8:e2636.

Article   PubMed   PubMed Central   CAS   Google Scholar  

Haddow AD, Schuh AJ, Yasuda CY, Kasper MR, Heang V, Huy R, et al. Genetic characterization of Zika virus strains: geographic expansion of the Asian lineage. PLoS Negl Trop Dis. 2012;6:e1477.

Cao-Lormeau VM, Roche C, Teissier A, Robin E, Berry AL, Mallet HP, et al. Zika virus, French polynesia, South pacific, 2013. Emerg Infect Dis. 2014;20:1085–6.

Campos GS, Bandeira AC, Sardi SI. Zika virus outbreak, Bahia. Brazil. Emerg Infect Dis. 2015;21:1885–6.

Zanluca C, Melo VC, Mosimann AL, Santos GI, Santos CN, Luz K. First report of autochthonous transmission of Zika virus in Brazil. Mem Inst Oswaldo Cruz. 2015;110:569–72.

Wongsurawat T, Athipanyasilp N, Jenjaroenpun P, Jun SR, Kaewnapan B, Wassenaar TM, et al. Case of microcephaly after congenital infection with Asian lineage Zika virus. Thailand. Emerg Infect Dis. 2018. https://doi.org/10.3201/eid2409.180416 .

Lan PT, Quang LC, Huong VTQ, Thuong NV, Hung PC, Huong TTLN, et al. Fetal Zika virus infection in Vietnam. PLOS Curr. 2017. https://doi.org/10.1371/currents.outbreaks.1c8f631e0ef8cd7777d639eba48647fa .

Olson JG, Ksiazek TG, Suhandiman T. Zika virus, a cause of fever in Central Java, Indonesia. Trans R Soc Trop Med Hyg. 1981;75:389–93.

Kindhauser MK, Allen T, Frank V, Santhana RS, Dye C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 2016;94:675–86.

Gourinat CA, O’Connor O, Calvez E, Goarant C, Dupont-Rouzeyrol M. Detection of Zika Virus in Urine. Emerg Infect Dis. 2015;21:84–6.

World Health Organization (2016) Zika virus: Fact sheet http://www.who.int/mediacentre/factsheets/zika/en/ . Accessed 3 Feb 2016.

Wong SS, Poon RW, Wong SC. Zika virus infection-the next wave after dengue? J Formos Med Assoc. 2016;115:226–42.

International committee on taxonomy of viruses. http://www.ictvonline.org/virusTaxonomy.asp .

Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N, Cropp CB. Phylogeny of the genus flavivirus. J Virol. 1998;72:73–83.

Lindenbach BD, Rice CM. Molecular biology of flaviviruses. Adv Virus Res. 2003;59:23–61.

Purdue University. Zika virus structure revealed a critical advance in the development of treatments. Science Daily. www.sciencedaily.com/releases/2016/03/160331153938.htm . Accessed 8 June 2016.

Saxena SK, Elahi A, Gadugu S, Prasad AK. Zika virus outbreak: an overview of the experimental therapeutics and treatment. VirusDisease. 2016;27:111–5.

Fontes MB. Zika virus-related hypertensive iridocyclitis. Arq Bras Oftalmol. 2016;79:63.

Musso D, Nhan TX. Emergence of Zika Virus. Clin Microbiol. 2015;4:1000222.

Musso D, Gubler DJ. Zika Virus. Clin Microbiol Rev. 2016;29:487–524.

World Health Organization. Countries and territories with current or previous Zika virustransmission. Updated July 2019. https://www.who.int/emergencies/diseases/zika/countries-with-zika-and-vectors-table.pdf .

Duffy MR, Chen T-H, Hancock TW, Powers AM, Kool JL, Lanciotti RS, et al. Zika virus outbreak on Yap Island, Federated States of Micronesia. N Engl J Med. 2009;360:2536–43.

Horwood P, Bande G, Dagina R, Guillaumot L, Aaskov J, Pavlin B. The threat of chikungunya in Oceania. Western Pac Surveill Response J. 2013;4:8–10.

Musso D, Nilles EJ, Cao-Lormeau VM. Rapid spread of emerging Zika virus in the Pacific area. Clin Microbiol Infect. 2014;20:O595–6.

Lourenco-de-Oliveira R, Rua AV, Vezzani D, Willat G, Vazeille M, Mousson L, et al. Aedes aegypti from temperate regions of South America are highly competent to transmit dengue virus. BMC Infect Dis. 2013;13:610.

Chouin-Carneiro T, Vega-Rua A, Vazeille M, Yebakima A, Girod R, Goindin D, et al. Differential susceptibilities of Aedes aegypti and Aedes albopictus from the Americas to Zika Virus. PLoS Negl Trop Dis. 2016;10:e0004543.

Hayes EB. Zika virus outside Africa. Emerg Infect Dis. 2009;15:1347–50.

Berthet N, Nakouné E, Kamgang B, Selekon B, Descorps-Declère S, Gessain A, et al. Molecular characterization of three Zika flaviviruses obtained from sylvatic mosquitoes in the Central African Republic. Vector Borne Zoonotic Dis. 2014;14:862–5.

Guedes DR, Paiva MH, Donato MM, Barbosa PP, Krokovsky L, Rocha SWDS, et al. Zika virus replication in the mosquito Culex quinquefasciatus in Brazil. Emerg Microbes Infect. 2017;6:e69.

Besnard M, Lastère S, Teissier A, Cao-Lormeau V, Musso D. Evidence of perinatal transmission of Zika virus, French Polynesia, December 2013 and February 2014. Euro Surveill. 2014;19:20751.

ProMED-mail. 23 December 2015. Zika virus—Americas, Atlantic Ocean. ProMED-mail archive no. 20151223.3886435. http://www.promedmail.org . Accessed 1 Feb 2016.

Fagbami AH. Zika virus infections in Nigeria: virological and seroepidemiological investigations in Oyo State. J Hyg. 1979;83:213–9.

LaBeaud AD. 2016. ZIKV infection: an overview. http://www.uptodate.com/contents/zika-virus-infection-an-overview .

Ioos S, Mallet HP, Leparc Goffart I, Gauthier V, Cardoso T, Herida M. Current Zika virus epidemiology and recent epidemics. Med Mal Infect. 2014;44:302–7.

Rapid risk assessment: Zika virus epidemic in the Americas: potential association with microcephaly and Guillain–Barré syndrome. Stockholm: European Centre for Disease Prevention and Control, December 10, 2015 ( http://ecdceuropa.eu/en/publications/Publications/zika-virus-americas-association-with-microcephaly-rapid-risk-assessment.pdf ).

Australian government department of health, ZIKV—information for clinicians and public health practitioners. http://www.health.gov.au/internet/main/publishing.nsf/Content/ohp-zika-health-practitioners.htm#toc01 .

Pan American Health Organization (PAHO). 2016. Epidemiological Update Neurological syndrome, congenital anomalies, and Zika virus infection. http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&Itemid=270&gid=32879&lang=en .

European Centre for Disease Prevention and Control. Rapid risk assessment: ZIKV infection outbreak, Brazil and the Pacific region. 25 May 2015. http://ecdc.europa.eu/en/publications/Publications/rapidrisk-assessment-Zika%20virus-south-america-Brazil-2015.pdf .

Pithadia AB, Kakadia N. Guillain–Barré syndrome (GBS). Pharmacol Rep. 2010;62:220–32.

Cao-Lormeau VM, Blake A, Mons S, Lastère S, Roche C, Vanhomwegen J, et al. Guillain–Barré syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study. Lancet. 2016;387:1531–9.

Malkki H. Zika virus infection could trigger Guillain–Barré syndrome. Nat Rev Neurol. 2016. https://doi.org/10.1038/nrneurol.2016.30 .

Bandyopadhyay B, Das S, Sengupta M, Saha C, Das KC, Sarkar D, et al. Decreased intensity of Japanese encephalitis virus infection in chick chorioallantoic membrane under influence of ultradiluted Belladonna extract. Am J Infect Dis. 2010;6:24–8.

Rowson JM. The pharmacognosy of Atropa belladonna LINN. J Pharm Pharmacol. 1950. https://doi.org/10.1111/j.2042-7158.1950.tb12925.x .

Rajput H. Effects of Atropa belladonna as anti-cholinergic. Nat Prod Chem Res. 2013;1:104.

Rita P, Animesh DK. An updated overview on Atropa belladonna L. Int Res J Pharm. 2011;2:11–7.

Ulbricht C, Basch E, Hammerness P, Vora M, Wylie J, Woods J. An evidence-based systematic review of Belladonna by the Natural Standard Research Collaboration. J Herb Pharmacother. 2004;4:61–90.

Calvet G, Aguiar RS, Melo ASO, Sampaio SA, de Filippis I, Fabri A, et al. Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: a case study. Lancet Infect Dis. 2016;16:653–60.

Bousta D, Soulimani R, Jarmouni I, Belon P, Falla J, Froment N, et al. Neurotropic, immunological and gastric effects of low doses of Atropa belladonna L., Gelsemium sempervirens L. and Poumon histamine in stressed mice. J Ethnopharmacol. 2001;74:205–15.

Ullman D. Controlled clinical trials evaluating the homeopathic treatment of people with human immunodeficiency virus or acquired immune deficiency syndrome. J Altern Complement Med. 2003;9:133–41.

Patwardhan B, Vaidya ADB, Chorghade M. Ayurveda and natural products drug discovery. Curr Sci. 2004;86:789–99.

Mittal J, Sharma MM, Batra A. Tinospora cordifolia : a multipurpose medicinal plant—a review. J Med Plants Stud. 2014;2:32–47.

Jackman JA, Costa VV, Park S, Real ALC, Park JH, Cardozo PL, et al. Therapeutic treatment of Zika virus infection using a brain-penetrating antiviral peptide. Nature Mater. 2018;17:971–7.

Quanquin N, Wang L, Cheng G. Potential for treatment and a Zika virus vaccine. Curr Opin Pediatr. 2017;29:114–21.

Fernandez E, Diamond MS. Vaccination strategies against Zika virus. Curr Opin Virol. 2017;23:59–67.

Abbink P, Stephenson KE, Barouch DH. Zika virus vaccines. Nat Rev Microbiol. 2018;16:594–600.

Ekins S, Mietchen D, Coffee M, Stratton TP, Freundlich JS, Freitas-Junior L, et al. Open drug discovery for the Zika virus. F1000Res. 2016;5:150.

Pan American Health Organization. 2015. Zika virus (ZIKV) surveillance in the Americas: interim guidance for laboratory detection and diagnosis. Pan American Health Organization, Washington, DC. http://www.paho.org/hq/index.php?option=com_docman&task=doc_view&gid=30176&Itemid=270 .

Organization Pan American Health. Epidemiological alert. Neurological syndrome, congenital malformations, and Zika virus infections. Implications for public health in the Americas. Washington: Pan American Health Organization; 2015.

National Center for Health Statistics, key messages—ZIKV disease, Centre of disease control. http://www.cdc.gov/zika/pdfs/zika-key-messages.pdf .

Burd I, Griffin D. The chasm between public health and reproductive research: what history tells us about Zika virus. J Assist Reprod Genet. 2016;33:439–40.

Benelli G, Jeffries CL, Walker T. Biological control of mosquito vectors: past, present, and future. Insects. 2016;7:E52.

Singh RK, Dhama K, Malik YS, Ramakrishnan MA, Karthik K, Tiwari R, et al. Zika virus—emergence, evolution, pathology, diagnosis, and control: current global scenario and future perspectives—a comprehensive review. Vet Q. 2016;36:150–75.

Rossi SL, Tesh RB, Azar SR, Muruato AE, Hanley KA, Auguste AJ, et al. Characterization of a novel murine model to study Zika virus. Am J Trop Med Hyg. 2016;94:1362–9.

McGrath EL, Rossi SL, Gao J, Widen SG, Grant AC, Dunn TJ, et al. Differential responses of human fetal brain neural stem cells to Zika virus infection. Stem Cell Reports. 2017;8:715–27.

Download references

Acknowledgements

Author information, authors and affiliations.

Department of Bioinformatics, Hazara University Mansehra, Mansehra, Pakistan

Syeda Sidra Kazmi, Waqar Ali, Nousheen Bibi & Faisal Nouroz

Department of Botany, Hazara University Mansehra, Mansehra, Pakistan

Faisal Nouroz

You can also search for this author in PubMed   Google Scholar

Contributions

SSK: write the initial draft. WA: editing and proof reading. NB and FN: proof reading. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Waqar Ali .

Ethics declarations

Ethics approval and consent to participate, consent for publication, competing interests.

Authors declare no conflict of interest.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Additional file 1: figure s1:.

Reproductive cycle of ZIKV.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Kazmi, S.S., Ali, W., Bibi, N. et al. A review on Zika virus outbreak, epidemiology, transmission and infection dynamics. J of Biol Res-Thessaloniki 27 , 5 (2020). https://doi.org/10.1186/s40709-020-00115-4

Download citation

Received : 28 May 2019

Accepted : 24 February 2020

Published : 04 March 2020

DOI : https://doi.org/10.1186/s40709-020-00115-4

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Aedes mosquito
• Epidemiology
• Guillain–Barré syndrome
• Microcephaly

Journal of Biological Research-Thessaloniki

ISSN: 2241-5793

• Submission enquiries: Access here and click Contact Us
• General enquiries: [email protected]

• Search Menu
• Sign in through your institution
• Advance articles
• Editor's Choice
• Supplement Archive
• Editorial Commentaries
• Perspectives
• Cover Archive
• IDSA Journals
• Clinical Infectious Diseases
• Open Forum Infectious Diseases
• Author Guidelines
• Open Access
• Why Publish
• IDSA Journals Calls for Papers
• Advertising and Corporate Services
• Advertising
• Reprints and ePrints
• Sponsored Supplements
• Branded Books
• Journals Career Network
• About The Journal of Infectious Diseases
• About the Infectious Diseases Society of America
• About the HIV Medicine Association
• IDSA COI Policy
• Editorial Board
• Self-Archiving Policy
• For Reviewers
• For Press Offices
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

Zika virus infection: natural history and mechanisms of pathogenesis, forecasting zika virus epidemic spread, antivirals and diagnostics, vector control, vaccine development, conclusions.

• < Previous

Zika Virus and Future Research Directions

• Article contents
• Figures & tables
• Supplementary Data

Emily Erbelding, Cristina Cassetti, Zika Virus and Future Research Directions, The Journal of Infectious Diseases , Volume 216, Issue suppl_10, 15 December 2017, Pages S991–S994, https://doi.org/10.1093/infdis/jix492

• Permissions Icon Permissions

There was a dramatic upsurge in research activity after the recognition of Zika virus (ZIKV) transmission in South America in 2015 and its causal relationship to devastating anomalies in newborn infants. Progress in this area required a community of arbovirologists poised to refocus their research efforts and rapidly characterize the features of ZIKV transmission and infection through diverse multidisciplinary collaborations. Significant gaps remain in our knowledge of the natural history of ZIKV infection, its effects on neurodevelopment, modes and risk of transmission, and its interrelationship with other arbovirus infections. Development of effective countermeasures, such as therapeutics and an effective vaccine, are also research priorities. Lessons learned from our research response to ZIKV may help public health officials plan for the next emerging infectious disease threat.

The last 18 months have witnessed one of the most rapid and coordinated research responses against an emerging disease to date. Zika virus, a pathogen that has been known since 1947 but poorly studied until recently because it was believed to only cause a mild infection, has rapidly become the object of intense investigation by the international research community since the link between infection and severe congenital disease was announced by Brazilian authorities in November 2015. According to PubMed, the total number of ZIKV-related publications skyrocketed from 117 in 2015 to 3253 in August of 2017. This supplement summarizes the tremendous progress that has been made since 2015 to elucidate the biology of this virus, its various disease manifestations in humans and animals, the diverse routes by which it is transmitted, and the role of various mosquito vectors in the recent outbreaks. In addition, several efforts have been initiated to develop new diagnostics, therapeutics, vaccines, and vector control strategies to better detect, treat, and prevent this important infection. There are 3 factors that contributed to the rapid progress in ZIKV research: (1) the availability of dedicated funding for ZIKV research; (2) the prior existence of both flavivirologists and maternal-child health researchers who were poised to tackle this new public health challenge; and (3) the high level of coordination and collaboration between different research agencies worldwide.

Despite the significant progress, many significant questions remain to be addressed to accelerate the development of effective ZIKV countermeasures and increase our preparedness against this significant public health threat. Some of the most pressing scientific gaps that need to be addressed to advance the field are summarized below.

It was the stunning observation that intrauterine exposure to Zika virus (ZIKV) infection caused congenital microcephaly in infants that led to the declaration of a public health emergency in areas where ZIKV transmission was occurring. The causal link between ZIKV exposure and abnormal brain development became established early in the 2015–16 Brazil epidemic through case-control studies of pregnant women and further bolstered by evidence from studies in animal models [ 1 , 2 ]. The impact of ZIKV on the neurodevelopment in utero raises the possibility that more subtle neurodevelopment abnormalities may occur if there is ZIKV exposure peri- or postpartum. Any impact of ZIKV exposure in utero or early life on a child’s neurodevelopment will only be fully understood through carefully designed prospective cohort studies. Observational cohorts comprised of exposed and unexposed infants in regions where there is ZIKV transmission that incorporate neurologic testing, developmental milestones, and cognitive outcomes through school age will further our understanding in this area.

In a minority of cases, ZIKV infection is characterized by clinically significant neurologic disease, most prominently Guillain-Barrè syndrome (GBS) [ 3 ]. The pathophysiology of GBS occurring as a parainfectious syndrome with ZIKV is not well understood and represents a significant knowledge gap that could have important implications for vaccine development, especially if GBS after ZIKV infection is immune-mediated. Animal models that recapitulate this neurologic disease in humans are required to test appropriate countermeasures, such as vaccines, antiviral molecules, or monoclonal antibodies.

Natural history studies that measure ZIKV infectiousness in various body fluids is also an important area for research focus to inform public health interventions to control transmission and allow for the evaluation of experimental therapeutics. Men with ZIKV infection may shed ZIKV ribonucleic acid (RNA) in semen for up to 6 months after initial infection [ 4 , 5 ], and asymptomatic blood donors testing positive for ZIKV RNA appear to shed ZIKV in semen at rates similar to those identified with clinical illness [ 6 ]. Duration of shedding in female genital secretions and in breast milk are also unknown, but these have implications for controlling epidemic spread. The potential role of pre-existing immunity to flaviviruses in ZIKV pathogenesis is another area of research that needs to be further developed to explore possible links between congenital Zika syndrome (CZS) and neurological disease severity and existing immunity to flaviviruses. In contrast, it will be important to understand whether exposure to ZIKV will change the course of disease to subsequent flavivirus infections such as dengue. This information will better inform vaccine developers and public health authorities on the potential risks of introducing Zika vaccine in flavivirus-endemic areas.

Epidemiologic models that predict ZIKV transmission in advance of appearance of clinical cases will be important to planning an effective public health response. However, accurately forecasting the epidemic spread of other flaviviruses has proven to be a formidable challenge and ZIKV is likely to be similar [ 7 ]. West Nile virus, Chikungunya virus, and yellow fever virus epidemics have all demonstrated sporadic and unpredictable patterns of spread [ 8–13 ]. Infectious disease epidemic modelers have identified some factors predictive of ZIKV transmission: mosquito density, temperature, rainfall conditions, management of standing water, and human population density are all variables that contribute to a model’s accuracy. Among flaviviruses, ZIKV is perhaps unique in its capacity for sexual transmission. This contributes to a greater probability of further spread within a population once introduced through the bite of a mosquito vector. As a sexually transmitted infection, the rate of ZIKV spread is thus likely to be influenced by the demographic structure and sexual mixing within a population [ 14 ], adding additional complexity to constructing models that accurately predict the next ZIKV epidemic.

In addition to managing public health resources, accurate forecasting of the next epidemic foci is crucial for executing the evaluation of ZIKV vaccines and therapeutics in clinical trials. The required enrollment for a vaccine trial designed to test the efficacy of a candidate vaccine, for example, will vary widely based upon the event rate (incidence of ZIKV infection) among the enrolled participants. Incidence may be very high when ZIKV is first introduced into a naive population, and then wane the next year. The time necessary to complete a vaccine trial requires brisk enrollment at sites with consistently high incidence. A moving epidemic may necessitate opening and closing research sites as the ZIKV epidemiology changes, leading to delays in bringing a vaccine to the commercial market.

Zika virus infections usually follow a mild course in terms of symptoms. Therefore, the clinical indication for an anti-ZIKV product—either a small molecule or an antibody—that targets ZIKV replication would not likely be symptomatic ZIKV illness. Rather, preventing CZS in utero would be the highest clinical priority. A rational path for testing anti-ZIKV compounds clinically would focus first on demonstrating safety in healthy adults, then testing in ZIKV-exposed pregnant women to prevent CZS. Given the need to minimize teratogenicity, anti-ZIKV monoclonal antibodies may be a more attractive option than small molecule antivirals for the maternal population. A ZIKV therapeutic might also be useful for the treatment of infants born to ZIKV-infected mothers to lower their viral loads, prevent further damage to their central nervous system, and improve their clinical and developmental outcomes. Improved outcomes have been demonstrated in infants with congenital cytomegalovirus infection, providing a rationale for considering similar testing in ZIKV-infected infants [ 15 ].

Zika virus RNA is present in semen for up to 6 months after initial ZIKV infection [ 4 , 5 ]. Based upon this observation, treating men recovering from ZIKV infection with anti-ZIKV drugs or antibodies to reduce infectiousness to sex partners will also be a priority for ZIKV clinical research. Ultimately, if such strategies prove safe and efficacious, pre- and postexposure prophylaxis for ZIKV-exposed women and male sex partners may limit the risk and devastation of CZS.

As the ZIKV epidemic wanes, it will become increasingly difficult to evaluate the efficacy of therapeutic interventions in infected patients. Therefore, it is important to continue developing immune-competent animal models that recapitulate ZIKV pathogenesis and allow for the evaluation of interventions to prevent CZS [ 16 , 17 ]. A safe and ethically acceptable controlled human infection model could also be useful to evaluate the effect of ZIKV therapeutics on mild clinical disease and viremia in healthy, nonpregnant adults [ 18 ].

The evaluation of experimental ZIKV therapeutics hinges on the availability of rapid, specific, and point-of-care ZIKV diagnostics for different populations that might benefit from a ZIKV therapeutic: pregnant women, infants, and men of reproductive age. Substantial progress has been made in the last 2 years in the development of new molecular diagnostics for ZIKV [ 3 ]. Additional research will be needed to convert these diagnostic platforms to rapid, point-of-care testing that can be applied clinically.

Improved serological diagnostics that are sensitive and specific for ZIKV are also urgently needed to be able to diagnose recent and past ZIKV infections and differentiate them from other arboviral infections with similar clinical manifestations (especially dengue and CHIKV). Such improved tests would allow public health laboratories to identify more easily pregnant women that have been infected and greatly facilitate ZIKV epidemiology, natural history, and interventional clinical studies.

Developing and testing preventative vaccines and drug therapies is the standard research approach to combating an infectious disease epidemic. Vector control through pesticides or larvicides is also standard public health practice in limiting mosquito-borne diseases. A challenge arising with the use of current insecticides and larvicides is the rapid development of resistance in mosquitos. An understanding of the molecular mechanism of acquiring resistance will inform the development of the next generation of insecticidal and larvicidal compounds and increase our armamentarium of tools to control ZIKV epidemics. A more detailed understanding of the physiology of vector olfaction might help identify new targets for the development of novel strategies to alter the mosquito olfactory sense and their biting behavior.

Novel technologies in vector manipulation are attractive for public health, especially when they can be applied to several species of mosquitos, because this could result in the control of several mosquito-borne diseases at the same time (eg, ZIKV, dengue, and malaria). Ongoing field studies of Aedes aegypti and Aedes albopictus altered with endosymbiotic bacterium such as Wolbachia sp should help us better understand the effect of manipulated mosquitos on ZIKV epidemic transmission and measure their persistence, fitness, and ecological impact in natural settings [ 19 ]. Finally, we will need to better understand the competence of different mosquito vectors for transmitting ZIKV to target the development and implementation of vector-control strategies to the most important mosquito species.

Several efforts to develop ZIKV vaccines were rapidly initiated in response to the recent ZIKV outbreaks, and some of these candidates are currently being evaluated in Phase I and Phase II clinical trials [ 20 ]. Because the current ZIKV epidemic is waning, it is unclear whether sufficient ZIKV infections will occur in endemic regions to support efficacy evaluation in traditional Phase III clinical trials. In light of this, it will be very important to learn as much as possible from the immune responses to vaccines in ZIKV-endemic areas and, if sufficient infections occur in the current Phase II study, to elucidate what immunological responses correlate with protection from disease and/or viremia. Natural history studies in endemic countries and studies in well characterized animal models can also advance our understanding of ZIKV immunological correlates of protection. A common endpoint for large efficacy trials of vaccines is the prevention of virologically confirmed symptomatic infection [ 21 ]. Because 80% of ZIKV infections are asymptomatic [ 22 ], efficacy trials must enroll a very large number of people to reach statistical significance. If a valid surrogate endpoint could be used in efficacy trials (eg, prevention or reduction of viremia), the size of trials could be drastically reduced making them more feasible and less costly. Longitudinal cohort studies in pregnant women should be leveraged to determine the correlation between the level/timing of maternal viremia and the risk of infection and congenital disease in infants. If such a surrogate marker (maternal viremia) was validated and accepted by regulatory authorities, vaccine developers could use it as an endpoint for efficacy in vaccine trials, allowing for more efficient accumulation of clinical trial endpoints. Safe, controlled human infections studies may also allow us to elucidate the correlates of immunological protection in well controlled experimental settings and provide a tool to vaccine developers to select the most promising vaccine candidates to put forward into larger-scale clinical trials.

Despite the remarkable scientific progress that has been made in the last 18 months, it will be challenging to maintain the continued interest by the scientific community, international research funders, and the pharmaceutical industry, as the ZIKV epidemic wanes. Research investments are always made with hopes for long-term benefits. The full benefits of discovery and development are often reaped decades after the initial investments, when technological advances and accrued knowledge bring new interventions. It will be critical to sustain research efforts on ZIKV to fully capitalize on the recent scientific advances and bring new vaccines and other interventions to the market to protect the global community from future outbreaks.

Zika virus provides a perfect example for re-emerging infections. It came into the public consciousness—seemingly out of nowhere—spreading rapidly and causing a new disease (congenital ZIKV syndrome). The early research response required a robust multidisciplinary effort of virologists, epidemiologists, maternal-fetal clinicians, neurologists, entomologists, bioethicists, and vaccinologists, all working collaboratively. The dramatic events associated with the recent reemergence of ZIKV and the cases of microcephaly in infants remind us, once again, of the importance of supporting and maintaining robust biomedical research programs to prepare for the next inevitable and yet unknown infectious disease threat.

Disclaimer. This article was written by the National Institutes of Health employees in the course of their usual duties without additional funding support.

Supplement sponsorship. This work is part of a supplement sponsored by the National Institute of Allergy and Infectious Diseases (NIAID), part of the National Institutes of Health (NIH).

Potential conflicts of interest. Both authors: No reported conflicts of interest. Both authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.

Rasmussen SA , Jamieson DJ , Honein MA , Petersen LR . Zika virus and birth defects–reviewing the evidence for causality . N Engl J Med 2016 ; 374 : 1981 – 7 .

Google Scholar

Morrison TE , Diamond MS . Animal models of Zika virus infection, pathogenesis, and immunity . J Virol 2017 ; 91 : pii: e00009-17 .

Muñoz LS , Pardo CA . Neurological implications of Zika virus in the adult population . J Infect Dis 2017 ; 216 : S897 – 905 .

Paz-Bailey G , Rosenberg ES , Doyle K et al.  Persistence of Zika virus in body fluids—preliminary report . N Engl J Med 2017 ; doi: 10.1056/NEJMoa1613108 .

Barzon L , Pacenti M , Franchin E et al.  Infection dynamics in a traveller with persistent shedding of Zika virus RNA in semen for six months after returning from Haiti to Italy, January 2016 . Euro Surveill 2016 ; 21 : doi: 10.2807/1560-7917.ES.2016.21.32.30316 .

Musso D , Richard V , Teissier A et al.  Detection of ZIKV RNA in semen of asymptomatic blood donors . Clin Microbiol Infect 2017 ; doi: 10.1016/j.cmi.2017.07.006 .

Keegan LT , Lessler J , Johansson MA . Quantifying Zika: advancing the epidemiology of Zika with quantitative models . J Infect Dis 2017 ; 216 : S884 – 90 .

Mordecai EA , Cohen JM , Evans MV et al.  Detecting the impact of temperature on transmission of Zika, dengue, and chikungunya using mechanistic models . PLoS Negl Trop Dis 2017 ; 11 : e0005568 .

Eisen L , Monaghan AJ , Lozano-Fuentes S , Steinhoff DF , Hayden MH et al.  The impact of temperature on the bionomics of Aedes (Stegomyia) aegypti , with special reference to the cool geographic range margins . J Med Entomol 2014 ; 51 : 496 – 516 .

Cromwell EA , Stoddard ST , Barker CM et al.  The relationship between entomological indicators of Aedes aegypti abundance and dengue virus infection . PLoS Negl Trop Dis 2017 ; 11 : e0005429 .

Manore CA , Ostfeld RS , Agusto FB , Gaff H , LaDeau SL . Defining the risk of Zika and Chikungunya virus transmission in human population centers of the Eastern United States . PLoS Negl Trop Dis 2017 ; 11 : e0005255 .

Erguler K , Chandra NL , Proestos Y , Lelieveld J , Christophides GK et al.  A large-scale stochastic spatiotemporal model for Aedes albopictus -borne chikungunya epidemiology . PLoS One 2017 ; 12 : e0174293 .

Johansson MA , Powers AM , Pesik N , Cohen NJ , Staples JE . Nowcasting the spread of chikungunya virus in the Americas . PLoS One 2014 ; 9 : e104915 .

Maxian O , Neufeld A , Talis EJ , Childs LM , Blackwood JC . Zika virus dynamics: when does sexual transmission matter ? Epidemics 2017 ; doi: 10.1016/j.epidem.2017.06.003 .

James SH , Kimberlin DW . Advances in the prevention and treatment of congenital cytomegalovirus infection . Curr Opin Pediatr 2016 ; 28 : 81 – 5 .

Siddharthan V , Julander JG . Small animal models of Zika virus . J Infect Dis 2017 ; 216 : S919 – 27 .

Osuna CE , Whitney JB . Non-human primate models of Zika virus infection, immunity and therapeutic development . J Infect Dis 2017 ; 216 : S928 – 34 .

Durbin AP , Whitehead SS . Zika vaccines: role for controlled human infection . J Infect Dis 2017 ; 216 : S971 – 75 .

Kauffman EB , Kramer LD . Zika virus mosquito vectors: competence, biology and vector control . J Infect Dis 2017 ; 216 : S976 – 90 .

Morabito KM , Graham BS . Zika virus vaccine development . J Infect Dis 2017 ; 216 : S957 – 63 .

Hadinegoro SR , Arredondo-García JL , Capeding MR et al.  Efficacy and long-term safety of a dengue vaccine in regions of endemic disease . N Engl J Med 2015 ; 373 : 1195 – 206 .

Hills SL , Fischer M , Petersen LR . Epidemiology of Zika virus . J Infect Dis 2017 ; 216 : S868 – 74 .

• zika virus infections

Email alerts

More on this topic, related articles in pubmed, citing articles via, looking for your next opportunity.

• Recommend to your Library

Affiliations

• Online ISSN 1537-6613
• Print ISSN 0022-1899
• Copyright © 2024 Infectious Diseases Society of America
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

MINI REVIEW article

Zikv teratogenesis: clinical findings in humans, mechanisms and experimental models.

• 1 CNS Disease Modeling Laboratory, Department of Microbiology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, Brazil
• 2 CNS Disease Modeling Laboratory, Scientific Platform Pasteur-USP, São Paulo, Brazil

Zika virus (ZIKV) is an arthropod-borne virus (arbovirus) from the Flaviviridae family, first isolated from the Rhesus monkey in 1947 in Uganda. ZIKV is transmitted by mosquito bites, but vertical and sexual transmissions have also been reported. ZIKV infection during pregnancy causes malformation in the developing fetus, especially central nervous system (CNS) damages, with a noticed microcephaly, making ZIKV be recognized as a teratogenic agent and the responsible for congenital Zika syndrome (CZS). However, it is still a short time since CZS was first reported. Consequently, ZIKV pathogenesis is not entirely elucidated, especially considering that affected children are still under neurodevelopment. Here, we will explore the current knowledge about ZIKV teratogenesis focusing on neurological clinical findings in humans, mechanisms, and experimental models used to understand ZIKV pathophysiology.

Introduction

Although ZIKV infection is asymptomatic in most cases, the common signs and symptoms are fever, rash, arthralgia, and conjunctival hyperemia ( 1 ). It is noteworthy that ZIKV infection has also been related to more severe clinical outcomes, especially considering neurological signs, both in CNS and peripheral nervous systems, such as meningoencephalitis, acute myelitis, and Guillain-Barré syndrome ( 2 ).

In 2015, Brazil had a significant increase in the number of cases of newborns with microcephaly. In 2016, key works proved that ZIKV infection during pregnancy was responsible for the malformation in the developing fetus, especially leading to structural and neurological defects ( 3 , 4 ). In vivo and in vitro approaches were decisive to demonstrate that ZIKV can cross the placental barrier affecting fetal development and has a tropism for neural progenitor cells (NPCs), showing a causal relationship between ZIKV and microcephaly ( 5 , 6 ). Later on, and based on clinical investigation, other symptoms were associated with ZIKV pathogenesis during fetus neurodevelopment, such as brain calcifications, hydrocephalus, ventriculomegaly, lissencephaly, holoprosencephaly, seizures, and neurosensorial deficits ( 7 ). ZIKV was first identified as a possible teratogenic agent in Brazil in 2015, calling the clinical picture of newborns as Congenital Zika Syndrome (CZS). Studies suggest that fetal abnormalities induced by ZIKV may occur in all trimesters of pregnancy. However, the manifestations with the most significant negative impact are associated with infections in the first and second trimester ( 8 ), and depending on that period, ZIKV vertical infection can cause limitations of intrauterine growth, spontaneous abortion, and microcephaly.

Considering the information above mentioned, and being established a relationship between the increased number of microcephaly cases in newborns caused by ZIKV infection, the WHO declared in 2016 ZIKV infection during pregnancy as a public health emergency. ZIKV represents a threat on a global scale since there are no drugs and vaccines available to treat or prevent the infection ( 9 ).

The pathogenesis of ZIKV is still not fully understood. Here, we will overview ZIKV teratogenesis focusing on neurological clinical findings in humans, mechanisms, and experimental models used to understand ZIKV pathophysiology.

Neurological Clinical Findings in Human

After the outbreak in Brazil, many studies have associated ZIKV with neurological diseases in newborns whose mothers contracted the virus during pregnancy. Additionally, ZIKV RNA was identified in babies with microcephaly brain tissue ( 4 ). In microscopic examinations of a fetal brain infected with ZIKV, apoptotic neurons were observed, mainly post-migratory neurons with intermediate differentiation ( 10 ).

The harmful effects of congenital viruses on pregnancy and fetal outcomes are partly because of impaired trophoblastic function, as the placenta is a kind of selective barrier due to multiple immune and cellular structures ( 11 ). Profound pathological changes were observed in placentas infected by ZIKV, like abnormal fetal capillaries, trophoblastic apoptosis, increased fetal nucleated erythrocytes, which indicates a biological malfunction ( 12 ). ZIKV can infect the placenta through blood-placenta transmission leading to microcephaly and a severe loss of intracranial volume ( 13 , 14 ). A neuroimaging report showed a cranial bone collapse in babies born from mothers suspected of having ZIKV during pregnancy ( 15 ). Magnetic resonance identified a spectrum of anomalies that include marked cortical thinning with an abnormal gyratory pattern, increased fluid spaces (ventricular and extra-axial), hypoplasia or absence of corpus callosum, and hypoplasia in the cerebellar vermis ( 16 ).

Postmortem CNS analysis from newborns who died within 48 h after birth from ischemia-associated consequences showed that ZIKV infects neuroglial progenitor cells. Calcifications and destructive lesions were also found, supporting changes in the brain, delayed cerebral atrophy, and transient convulsive activities ( 17 – 20 ).

Besides vertical transmission, neurological symptoms were also reported in adults after ZIKV infection. In adults, ZIKV infection has been associated with conditions of transverse myelitis, peripheral neuropathy, and meningoencephalitis ( 2 , 21 ). An imaging study showed a reduced volume of gray matter in specific motor cortical regions compared with controls, leading to a life-term impact on the CNS ( 22 ). Acute myelitis was described 7 days after ZIKV infection in a teenager in Guadalupe. A spinal magnetic resonance imaging showed an increase in the thoracic and cervical spinal cord. ZIKV RNA was found in serum, urine, and cerebrospinal fluid (CSF) on the second day of neurological complaints. The presence of ZIKV in the CSF reinforces that ZIKV is neurotropic ( 23 ). Besides CNS, ocular abnormalities have also been reported as part of the effects of CZS and anomalies of the optic nerve, focal pigmentary gait, and chorioretinal atrophy ( 24 , 25 ).

Based on current knowledge about the pathogenesis of ZIKV and the other defects that the infection causes in fetal development, ZIKV should be considered a TORCH pathogen ( T oxoplasmosis, O ther (syphilis, varicella-zoster, parvovirus B19), R ubella, C ytomegalovirus, and H erpes) ( 26 ). The similarities between congenital disorders considered TORCH and ZIKV are striking and say about their neurotropism ( 27 ). Malformations induced by TORCH and ZIKV pathogen depend on the gestational age of the fetal infection, being more severe as the earlier occurs during pregnancy, like in the first trimester of gestation. As the pregnancy progresses, the risk of congenital malformations that result from virus infections decreases and becomes low during and after the second trimester.

Mechanism of Teratogenesis Caused by ZIKV Infection

Studying the SARS-CoV-2′s pathogenesis mechanisms could help understand the symptoms caused by its illness, find drugs to combat the infection, and select potential targets for vaccines.

ZIKV is composed of a single positive-sense RNA strand, with ~10 kb, protected by a capsid and an envelope of lipids and proteins. Its genome codifies three structural proteins, pre-Membrane (prM), Envelope (E), and Capsid (C), and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4a, NS4b, NS5).

ZIKV can enter Neural Progenitor Cells (NPCs) (and other cells of CNS) using mainly AXL receptor (AXL Receptor Tyrosine Kinase) in the cell surface ( 6 ). Once ZIKV enters the cell, its RNA is rapidly translated by local ribosomes into a polyprotein that encodes structural and non-structural proteins, which become part of the virions and play a role in viral replication. The virus modifies the cellular endoplasmic reticulum (ER), forming “replication factories” where viral replication and production of viral proteins occurs, inducing ER stress and unfolded protein response (UPR), which inhibits protein synthesis and activates ER-associated degradation (ERAD). Lastly, the viral genomes assemble with the new virions particles and are secreted through the Golgi apparatus.

Besides forming the replication machinery, non-structural proteins help to inhibit the antiviral response. NS5, NS2B, and NS3 regulate type 1 IFN pathways, NS5 protein inhibits human STAT2 suppressing IFN-I production and favoring viral proliferation ( 28 ) ( Figure 1 ). Further, NS4A and NS4B have an important function related to apoptosis and growth arrest since they act together to inhibit the AKT-mTOR pathway ( 29 ), which causes mitochondrial elongation, and extends production of ATP (Adenosine Triphosphate) by oxidative phosphorylation resulting in a rise in reactive oxygen species by glial cells, increasing mitochondrial stress ( 30 , 31 ). Increased cellular stress could activate the p53 intrinsic apoptosis pathway ( 32 ). So, proapoptotic proteins such as Bcl-2-associated protein X (BAX) cause the release of cytochrome C by mitochondria, which activates caspase pathways ( 33 ). Moreover, ZIKV's NS4B protein can directly recruit BAX from the cytosol into the mitochondria activating this apoptotic pathway ( 34 ) ( Figure 1 ).

Figure 1 . ZIKV adsorbs to the cell surface receptor AXL to enter CNS cells. When the viral replication machinery is active, ZIKV produces non-structural proteins (NS). The NS2B and NS3 help to inhibit antiviral response by regulating type 1 IFN pathways. The NS5 protein inhibits human STAT2, which indirectly suppresses IFN-I production, favoring viral proliferation. NS4A and NS4B act in the apoptosis pathway and growth arrest, inhibiting the AKT-mTOR pathway and increasing mitochondrial stress, activating the p53 intrinsic apoptosis pathway. Additionally, NS4B activates pro-apoptotic proteins such as Bcl-2-associated protein X (BAX), causing cytochrome C release and activating caspase pathways.

It is believed that the immune response elicited by the infection plays a role in this growth arrest. In NPCs, IFN-independent Interferon Stimulated Genes (ISG) activations, such as IRF3 (Interferon Regulatory Factor 3) or NF-?B (Nuclear Factor kappa B), were observed, while no TLR3 (toll-like receptor 3) responses were activated ( 35 ). Nevertheless, in brain organoids, in the late stage of development, TLR3 was overexpressed after ZIKV infection. TLR3 activation was correlated with 41 genes expression linked to neuronal development, suggesting a perturbation in neurogenesis. Moreover, since these genetic hubs are regulators of axon guidance processes, anti-apoptotic and cell-cycle pathways, they can mediate microcephaly phenotype as revealed in brain organoid models ( 36 ).

The mechanisms described here revealed how ZIKV causes apoptosis, cell cycle-growth arrest and induces premature differentiation, leading to microcephaly and other birth disorders. However, the link between molecular mechanisms and phenotypic clinical findings must be better understood to clarify why some fetuses are affected by ZIKV and others do not or why they have different grades of disease severity. Not only that but elucidating ZIKV pathogenesis will be beneficial for drug discovery to prevent CZS and vaccine development against ZIKV infection.

Experimental In Vitro Models: Brain Cells

Understanding associated teratogenic mechanisms and molecular pathways referred to as CZS are also related to understanding human development. Mouse models have provided important information on the subject, as most protein-coding genes are shared with humans ( 37 , 38 ), but there are relevant restrictions, especially when considering eye and brain development ( 37 ) and gene expression patterns along with development ( 39 ) which present significant discrepancies when compared with humans. Furthermore, rodents need to have their antiviral defenses knocked down with dampened interferon responses to allow the viral infection ( 40 , 41 ), which may raise questions about the use of this model.

Advances in producing and applying induced pluripotent stem cell (iPSC) technology have provided essential tools for disease modeling in vitro ( 42 , 43 ). Through the application of different protocols of differentiation, neural progenitors, neurons, glia cells, and brain organoids derived from iPSC have been helpful for investigations on ZIKV infection ( 44 ).

Neural Progenitor Cells (NPCS)

Reports about ZIKV infection have shown that the Neural Progenitor Cells (NPCs) are sensible and permissive to the virus ( 45 , 46 ). These reports, concomitant with the investigation of the association of prenatal ZIKV infection and microcephaly, and other malformations, revealed that ZIKV is a potential teratogen agent, culminating in physical or functional congenital disabilities from abnormal fetal development ( 47 ).

Until the new circulating strain called ZIKVBR, in 2015, there was no association between the virus and neurological symptoms or brain damage in humans ( 48 ). Up to 12 weeks postconception, the maternal blood and tissue face the fetal membranes within the placenta due to the restructured maternal circulation ( 49 ), which allows the ZIKVBR to target the NPCs after crossing the placenta, inducing cell apoptosis and autophagy ( 5 ). The Brazilian ZIKV strain was revealed as more aggressive and more harmful to the neurogenesis when compared to the first isolated ZIKV strain, the MR766 ( 5 , 8 , 29 ).

The differentiation of NPCs reaches the development process and populates the growing brain with neurons during prenatal development ( 50 ). Modeling the neurodifferentiation process by NPCs iPSC-derived helped to elucidate the mechanisms underlying ZIKV pathogenesis. ZIKV prejudices brain development, impairing cell division, proliferation and inducing apoptosis, leading to potentially disastrous consequences for CNS development ( 51 , 52 ). Human neural stem cells (NSCs) isolated between 18 and 22 weeks of gestational age after conception unveil the suppression of host AKT-mTOR signaling by the cooperation of proteins NS4A and NS4B, upregulating autophagy for viral replication ( 29 ). The importance of autophagy relies on homeostasis control, being an efficient mechanism to limit pathogen infection. An AKT-mTOR signaling pathway is critical for cortical development ( 53 ) and AKT constitutive activation or loss of function is related to disorders as megalencephaly and microcephaly, respectively ( 54 ).

Inductive pathways and signaling shared between two surrounding embryonic structures may influence brain development by paracrine effects ( 55 ), like brain and face integrated development. As that craniofacial disproportion is related to ZIKV congenital infection ( 3 ), another work used cranial neural crest cells (CNCCs) signaling molecules. This approach provided evidence that the addition of leukemia inhibitory factor (LIF) or vascular endothelial growth factor (VEGF) cytokines in equivalent levels as the one produced during ZIKV infection results in precocious neurogenesis. This precocious neurogenesis contributes to a microcephaly phenotype, as migration and proliferation deregulated timing may affect brain size ( 56 ).

In vitro neurons have also contributed to the effort to understand ZIKV infection effects over the CNS. ZIKV can infect mature neurons that express AXL receptors causing neurological disorders ( 30 ). Recent findings exhibited impaired neurogenesis and synaptogenesis process over neurons derived from iPSCs infected by the Brazilian ZIKV strain ( 57 ). Studies revealed a global downregulation of synaptic proteins, such as postsynaptic density protein SHANK2 ( 58 , 59 ), and proteins associated with presynaptic precursors and presynaptic active zone, as VAMP2 (Vesicle-associated Membrane Protein 2) and complexin 2, Piccolo, Basson, and the Soluble NSF Attachment Receptor (SNARE) proteins ( 60 – 62 ). Those findings highlighted the vulnerability of the synaptic formation to the virus, leading to synaptic loss and contributing to mental and motor disabilities.

In another study, researchers analyzed miRNA profiles of primary mouse neurons after ZIKV infection. They showed that ZIKV causes a global downregulation of miRNAs with only a few upregulated miRNAs. On the other hand, ZIKV infection induces upregulation of antiviral, inflammatory, and apoptotic genes ( 63 ).

Besides the destructive effect on neuronal structures, the pathogen also compromises glia cells functioning in the fetus, negatively impacting brain development. Astrocytes extending into the subarachnoid space were identified in affected brain region slices from a 32-week fetus infected with the virus ( 4 ). This period comprises extensive neurogenesis and gliogenesis, suggesting a significant contribution of the astrocyte impaired growth, contributing to microcephaly ( 64 ).

Human microglia cell line (CHME3), human astrocytes, and NPCs were challenged with the African ZIKV strain HD78788 for the study of AXL receptor role in ZIKV infection, reporting it as a crucial receptor for the virus infection on human glial cells by promoting viral entry after binding ZIKV-Gas6 complex, also damping innate immune responses in glial cells ( 65 ). AXL belongs to a group of tyrosine kinases receptors related to innate immunity regulation and mediates phagocytosis of apoptotic cells ( 66 ).

Underlying entry factors, like AXL, have been studied to elucidate flavivirus mechanisms of infection ( 67 ). Although signaling mechanisms that promote the disease outcome are still not well understood, further investigations should unveil mechanisms that could be the basis for developing suitable therapeutic strategies.

Brain Organoids

Brain organoids are a three-dimensional structure derived from human iPSC. Brain organoids can be differentiated in various regions from the brain, as hindbrain, midbrain, and forebrain neuron subtypes ( 68 – 71 ). These tools have been a breakthrough in studying neurodegenerative and neurodevelopmental disorders, allowing the modeling of several conditions such as autism and microcephaly ( 71 – 73 ).

Brain organoids have also proved advantageous to study the mechanisms involved in ZIKV pathogenesis. Important findings from ZIKV infection using brain organoids were possible due to the model's physiological relevance and its capacity to mimic the developing fetal brain. ZIKV infection reduces the neuronal cell layer in human brain organoids ( 52 ).

Cerebral organoids generated from H9 hESCs (Human Embryonic Stem Cells) were treated with MR766 ZIKV to investigate the role of TLR3 (toll-like receptor 3), an innate immune receptor, in the ZIKV infection, unveiling the TLR3 upregulation after infection on organoids. This upregulation causes dysregulation of neurogenesis, apoptosis, and organoid shrinkage, contributing to impaired neurogenesis and microcephaly ( 36 ). TLR3 has also been linked with negative activation of axogenesis ( 74 ).

In another study, Brazilian and African ZIKV strains were used to infect three-dimensional neural cell cultures, neurospheres, and cerebral organoids generated from hiPSCs. Brazilian ZIKV infected neurospheres presented significantly more morphological abnormalities than African ZIKV infected at 96 h post-infection ( 5 ). Cortical plate thickness and dividing cells reduction on ventricular zone were more significant in organoids infected by Brazilian ZIKV strain, as was the increased number of apoptotic cells. Decreased number of dorsal forebrain progenitors cells was verified in both ZIKV infections. Those findings verify the capacity of cerebral organoids to support analysis of different parts of the brain and highlight neurodevelopmental disorders mechanisms.

Author Contributions

PB-B conceptually designed the manuscript, wrote, and edited. FR wrote the manuscript and guided the other three co-authors. CT, FT, and GS wrote the manuscript. All authors contributed to the article and approved the submitted version.

This work was sponsored by FAPESP (18/16748-8 and 16/02978-6), the Brazilian NGO the tooth fairy project and in part by the Coordenação de Aperfeiçoamento de Pessoal de Nivel Superior-Brasil (Capes)-Finance Code 001; and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and a post doc fellowship supported by the Institute Pasteur.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Acknowledgments

We want to thank the University of São Paulo for its support and Beatriz McGilvray for manuscript revision.

Abbreviations

ATP, adenosine triphosphate; AXL, AXL receptor tyrosine kinase; BAX, Bcl-2-associated protein X; CNS, central nervous system; CSF, cerebrospinal fluid; CZS, congenital Zika syndrome; CNCCs, cranial neural crest cells; CHME3, human microglia cell line; ER, endoplasmic reticulum; ERAD, ER-associated degradation; hESCs, human embryonic stem cells; iPSC, induced pluripotent stem cell; IRF3, Interferon Regulatory Factor 3; LIF, leukemia inhibitory factor; NF-κB, nuclear factor kappa B; NPCs, neural progenitor cells; SHANK2, SH3 and multiple ankyrin repeat domains 2; SNARE, soluble NSF attachment receptor; TORCH, toxoplasmosis, Other (syphilis, varicella-zoster, parvovirus B19), Rubella, Cytomegalovirus and Herpes; TLR3, toll-like receptor 3; WHO, World Health Organization; VAMP2, Vesicle-Associated Membrane Protein 2; VEGF, vascular endothelial growth factor; UPR, unfolded protein response; ZIKV, Zika virus.

1. Duffy MR, Chen TH, Hancock WT, Powers AM, Kool JL, Lanciotti RS, et al. Zika virus outbreak on Yap Island, Federated States of Micronesia. N Engl J Med . (2009) 360:2536–43. doi: 10.1056/NEJMoa0805715

PubMed Abstract | CrossRef Full Text | Google Scholar

2. Carteaux G, Maquart M, Bedet A, Contou D, Brugières P, Fourati S, et al. Zika virus associated with meningoencephalitis. N Engl J Med. (2016) 374:1595–6. doi: 10.1056/NEJMc1602964

3. de Fatima Vasco Aragao M, van der Linden V, Brainer-Lima AM, Coeli RR, Rocha MA, Sobral da., Silva P, et al. Clinical features and neuroimaging (CT and MRI) findings in presumed Zika virus related congenital infection and microcephaly: retrospective case series study. BMJ. (2016) 353:i1901. doi: 10.1136/bmj.i1901

PubMed Abstract | CrossRef Full Text

4. Mlakar J, Korva M, Tul N, Popović M, Poljšak-Prijatelj M, Mraz J, et al. Zika virus associated with microcephaly. N Engl J Med . (2016) 374:951–8. doi: 10.1056/nejmoa1600651

5. Cugola FR, Fernandes IR, Russo FB, Freitas BC, Dias JL, Guimarães KP, et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. (2016) 534:267–71. doi: 10.1038/nature18296

6. Nowakowski TJ, Pollen AA, Di Lullo E, Sandoval-Espinosa C, Bershteyn M, Kriegstein AR. Expression analysis highlights AXL as a candidate zika virus entry receptor in neural stem cells. Cell Stem Cell. (2016) 18:591–6. doi: 10.1016/j.stem.2016.03.012

7. Saad T, PennaeCosta AA, de Góes FV, de Freitas M, de Almeida JV, de Santa Ignêz LJ, et al. Neurological manifestations of congenital Zika virus infection. Childs Nerv Syst. (2017) 34:73–8. doi: 10.1007/s00381-017-3634-4

8. Brasil P., Pereira JP Jr, Moreira ME, Ribeiro Nogueira RM, Damasceno L, Wakimoto M, et al. Zika Virus infection in pregnant women in Rio de Janeiro. N Engl J Med. (2016) 375:2321–34. doi: 10.1056/NEJMoa1602412

9. Song BH, Yun SI, Woolley M, Lee YM. Zika virus: history, epidemiology, transmission, and clinical presentation. J Neuroimmunol. (2017) 308:50–64. doi: 10.1016/j.jneuroim.2017.03.001

10. Driggers RW, Ho CY, Korhonen EM, Kuivanen S, Jääskeläinen AJ, Smura T, et al. Zika virus infection with prolonged maternal viremia and fetal brain abnormalities. N Engl J Med. (2016) 374:2142–51. doi: 10.1056/NEJMoa1601824

11. Arechavaleta-Velasco F, Koi H, Strauss JF, Parry S. Viral infection of the trophoblast: time to take a serious look at its role in abnormal implantation and placentation? J Reprod Immunol. (2002) 55:113–21. doi: 10.1016/s0165-0378(01)00143-7

12. Miner JJ, Diamond MS. Understanding how Zika virus enters and infects neural target cells. Cell Stem Cell. (2016) 18:559–60.

PubMed Abstract | Google Scholar

13. Musso D, Roche C, Robin E, Nhan T, Teissier A, Cao-Lormeau VM. Potential sexual transmission of Zika virus. Emerg Infect Dis. (2015) 21:359–61. doi: 10.3201/eid2102.141363

14. Culjat M, Darling SE, Nerurkar VR, Ching N, Kumar M, Min SK, et al. Clinical and imaging findings in an infant with Zika embryopathy. Clin Infect Dis . (2016) 63:805–11. doi: 10.1093/cid/ciw324

15. Dain Gandelman Horovitz D, da Silva Pone MV, Moura Pone S, Dias Saad Salles TR, Bastos Boechat MC. Cranial bone collapse in microcephalic infants prenatally exposed to Zika virus infection. Neurology. (2016) 87:118–9. doi: 10.1212/WNL.0000000000002814

16. Besnard M, Lastere S, Teissier A, Cao-Lormeau V, Musso D. Evidence of perinatal transmission of Zika virus, French Polynesia, December 2013 and February 2014. Euro Surveill. (2014) 19:20751.

17. Chimelli L, Melo ASO, Avvad-Portari E, Wiley CA, Camacho AHS, Lopes VS, et al. The spectrum of neuropathological changes associated with congenital Zika virus infection. Acta Neuropathol. (2017). 133:983–99. doi: 10.1007/s00401-017-1699-5

18. van der Linden V, Filho EL, Lins OG, van der Linden A, Aragão M, Brainer-Lima AM, et al. Congenital Zika syndrome with arthrogryposis: retrospective case series study. BMJ . (2016). 354:i3899. doi: 10.1136/bmj.i3899

19. Nem de Oliveira Souza I, Frost PS, França JV, Nascimento-Viana JB, Neris RLS, Freitas L, et al. Acute and chronic neurological consequences of early-life Zika virus infection in mice. Sci Transl Med. (2018). 10:eaar2749. doi: 10.1126/scitranslmed.aar2749

20. Mavigner M, Raper J, Kovacs-Balint Z, Gumber S, O'Neal JT, Bhaumik SK, et al. Postnatal Zika virus infection is associated with persistent abnormalities in brain structure, function, and behavior in infant macaques. Sci Transl Med. (2018). 10:eaao6975. doi: 10.1126/scitranslmed.aao6975

21. Acosta-Ampudia Y, Monsalve DM, Castillo-Medina LF, Rodríguez Y, Pacheco Y, Halstead S, et al. Autoimmune neurological conditions associated with Zika virus infection. Front Mol Neurosci. (2018) 11:116. doi: 10.3389/fnmol.2018.00116

22. Bido-Medina R, Wirsich J, Rodríguez M, Oviedo J, Miches I, Bido P, et al. Impact of Zika Virus on adult human brain structure and functional organization. Ann Clin Transl Neurol. (2018) 5:752–62. doi: 10.1002/acn3.575

23. Mécharles S, Herrmann C, Poullain P, Tran TH, Deschamps N, Mathon G, et al. Acute myelitis due to Zika virus infection. Lancet. (2016) 387:1481. doi: 10.1016/S0140-6736(16)00644-9

24. de Paula Freitas B, de Oliveira Dias JR, Prazeres J, Sacramento GA, Ko AI, Maia M, et al. Ocular findings in infants with microcephaly associated with presumed Zika virus congenital infection in Salvador, Brazil. JAMA Ophthalmol. (2016) 134:529–35. doi: 10.1001/jamaophthalmol.2016.0267

25. Ventura CV, Maia M, Ventura BV, Linden VV, Araújo EB, Ramos RC, et al. Ophthalmological findings in infants with microcephaly and presumable intra-uterus Zika virus infection. Arq Bras Oftalmol. (2016) 79:1–3. doi: 10.5935/0004-2749.20160002

26. Tahotná A, Brucknerová J, Brucknerová I. Zika virus infection from a newborn point of view. TORCH, or TORZiCH? Interdiscip Toxicol. (2018) 11:241–6. doi: 10.2478/intox-2018-0023

27. Faizan MI, Abdullah M, Ali S, Naqvi IH, Ahmed A, Parveen S. Zika virus-induced microcephaly and its possible molecular mechanism. Intervirology. (2016) 59:152–8. doi: 10.1159/000452950

28. Oyarzún-Arrau A, Alonso-Palomares L, Valiente-Echeverría F, Osorio F, Soto-Rifo R. Crosstalk between RNA metabolism and cellular stress responses during Zika virus replication. Pathogens. (2020) 9:158. doi: 10.3390/pathogens9030158

29. Liang Q, Luo Z, Zeng J, Chen W, Foo SS, Lee SA, et al. Zika Virus NS4A and NS4B Proteins deregulate Akt-mTOR signaling in human fetal neural stem cells to inhibit neurogenesis and induce autophagy. Cell Stem Cell. (2016) 19:663–71. doi: 10.1016/j.stem.2016.07.019

30. Rothan HA, Fang S, Mahesh M, Byrareddy SN. Zika virus and the metabolism of neuronal cells. Mol Neurobiol. (2019) 56:2551–7. doi: 10.1007/s12035-018-1263-x

31. Almeida LT, Ferraz AC, da Silva Caetano CC, da Silva Menegatto MB, dos Santos Pereira Andrade AC, Lima RLS, et al. Zika virus induces oxidative stress and decreases antioxidant enzyme activities in vitro and in vivo . Virus Res. (2020) 286:198084. doi: 10.1016/j.virusres.2020.198084

32. Ghouzzi VE, Bianchi FT, Molineris I, Mounce BC, Berto GE, Rak M, et al. ZIKA virus elicits P53 activation and genotoxic stress in human neural progenitors similar to mutations involved in severe forms of genetic microcephaly and p53. Cell Death Dis. (2016) 7:e2440. doi: 10.1038/cddis.2016.266

33. Haupt S. Apoptosis—the p53 network. J Cell Sci. (2003) 116:4077–85. doi: 10.1242/jcs.00739

34. Han X, Wang J, Yang Y, Qu S, Wan F, Zhang Z, et al. Zika virus infection induced apoptosis by modulating the recruitment and activation of proapoptotic protein bax. J Virol . (2021) 95:e01445. doi: 10.1128/jvi.01445-20

35. Liu L, Chen Z, Zhang X, Li S, Hui Y, Feng H, et al. Protection of ZIKV infection-induced neuropathy by abrogation of acute antiviral response in human neural progenitors. Cell Death Differ. (2019) 26:2607–21. doi: 10.1038/s41418-019-0324-7

36. Dang J, Tiwari SK, Lichinchi G, Qin Y, Patil VS, Eroshkin AM, et al. Zika virus depletes neural progenitors in human cerebral organoids through activation of the innate immune receptor TLR3. Cell Stem Cell. (2016) 19:258–65. doi: 10.1016/j.stem.2016.04.014

37. Gerrelli D, Lisgo S, Copp AJ, Lindsay S. Enabling research with human embryonic and fetal tissue resources. Development. (2015) 142:3073–6. doi: 10.1242/dev.122820

38. Zhu Z, Huangfu D. Human pluripotent stem cells: an emerging model in developmental biology. Development. (2013) 140:705–17. doi: 10.1242/dev.086165

39. Fougerousse F. Human-mouse differences in the embryonic expression patterns of developmental control genes and disease genes. Hum Mol Genet . (2000) 9:165–73. doi doi: 10.1093/hmg/9.2.165

40. Rossi SL, Vasilakis N. Modeling Zika virus infection in mice. Cell Stem Cell. (2016) 19:4–6. doi: 10.1016/j.stem.2016.06.009

41. Mysorekar IU, Diamond MS. Modeling Zika virus infection in pregnancy. N Engl J Med. (2016) 375:481–4. doi: 10.1056/nejmcibr1605445

42. Yamanaka S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. (2012) 10:678–84.

43. Claus C, Jung M, Hübschen JM. Pluripotent stem cell-based models: a peephole into virus infections during early pregnancy. Cells. (2020) 9:542. doi: 10.3390/cells9030542

44. Alvarado MG, Schwartz DA. Zika virus infection in pregnancy, microcephaly, and maternal and fetal health: what we think, what we know, and what we think we know. Arch Pathol Lab Med. (2016) 141:26–32. doi: 10.5858/arpa.2016-0382-ra

45. Ming G, Tang H, Song H. Advances in Zika virus research: stem cell models, challenges, and opportunities. Cell Stem Cell. (2016) 19:690–702. doi: 10.1016/j.stem.2016.11.014

46. Tang H, Hammack C, Ogden SC, Wen Z, Qian X, Li Y, et al. Zika virus infects human cortical neural progenitors and attenuates their growth. Cell Stem Cell. (2016) 18:587–90. doi: 10.1016/j.stem.2016.02.016

47. Rasmussen SA, Jamieson DJ, Honein MA, Petersen LR. Zika virus and birth defects—reviewing the evidence for causality. N Engl J Med. (2016) 374:1981–7. doi: 10.1056/NEJMsr1604338

48. Russo FB, Jungmann P, Beltrão-Braga PCB. Zika infection and the development of neurological defects. Cell Microbiol. (2017) 19:e12744. doi: 10.1111/cmi.12744

49. Arora N, Sadovsky Y, Dermody TS, Coyne CB. Microbial vertical transmission during human pregnancy. Cell Host Microbe. (2017) 21:561–7. doi: 10.1016/j.chom.2017.04.007

50. Götz M, Huttner WB. The cell biology of neurogenesis. Nat Rev Mol Cell Biol. (2005) 6:777–88. doi: 10.1038/nrm1739

51. Garcez PP, Loiola EC, Madeiro da Costa R, Higa LM, Trindade P, Delvecchio R, et al. (2016). Zika virus impairs growth in human neurospheres and brain organoids. Science. 352:816–8. doi: 10.1126/science.aaf6116

52. Qian X, Nguyen HN, Song MM, Hadiono C, Ogden SC, Hammack C, et al. Brain-region-specific organoids using mini-bioreactors for modeling ZIKV exposure. Cell. (2016) 165:1238–54. doi: 10.1016/j.cell.2016.04.032

53. Franke T. PI3K/Akt: getting it right matters. Oncogene. (2008) 27:6473–88. doi: 10.1038/onc.2008.313

54. Mirzaa GM, Rivière JB, Dobyns WB. Megalencephaly syndromes and activating mutations in the PI3K-AKT pathway: MPPH and MCAP. Am J Med Genet C Semin Med Genet. (2013) 163C:122–30. doi: 10.1002/ajmg.c.31361

55. Marcucio R, Hallgrimsson B, Young NM. Facial morphogenesis. In: Current Topics in Developmental Biology . Amsterdam: Elsevier (2015), p. 299–320. doi: 10.1016/bs.ctdb.2015.09.001

56. Bayless NL, Greenberg RS, Swigut T, Wysocka J, Blish CA. Zika virus infection induces cranial neural crest cells to produce cytokines at levels detrimental for neurogenesis. Cell Host Microbe. (2016) 20:423–8. doi: 10.1016/j.chom.2016.09.006

57. Rosa-Fernandes L, Cugola FR, Russo FB, Kawahara R, de Melo Freire CC, Leite PEC, et al. Zika virus impairs neurogenesis and synaptogenesis pathways in human neural stem cells and neurons. Front Cell Neurosci . (2019) 13:64. doi: 10.3389/fncel.2019.00064

58. Li Z, Sheng M. Some assembly required: the development of neuronal synapses. Nat Rev Mol Cell Biol. (2003) 4:833–41. doi: 10.1038/nrm1242

59. Rizo J, Xu J. The synaptic vesicle release machinery. Annu Rev Biophys. (2015) 44:339–67. doi: 10.1146/annurev-biophys-060414-034057

60. Waites CL, Leal-Ortiz SA, Okerlund N, Dalke H, Fejtova A, Altrock WD, et al. Bassoon and Piccolo maintain synapse integrity by regulating protein ubiquitination and degradation. EMBO J. (2013) 32:954–69. doi: 10.1038/emboj.2013.27

61. Mishima T, Fujiwara T, Sanada M, Kofuji T, Kanai-Azuma M, Akagawa K. Syntaxin 1B, but not syntaxin 1A, is necessary for the regulation of synaptic vesicle exocytosis and of the readily releasable pool at central synapses. PLoS ONE. (2014) 9:e90004. doi: 10.1371/journal.pone.0090004

62. Trimbuch T, Rosenmund C. Should I stop or should I go? The role of complexin in neurotransmitter release. Nat Rev Neurosci. (2016) 17:118–25. doi: 10.1038/nrn.2015.16

63. Azouz F, Arora K, Krause K, Nerurkar VR, Kumar M. Integrated microRNA and mRNA profiling in Zika virus-infected neurons. Viruses. (2019) 11:162. doi: 10.3390/v11020162

64. Potokar M, Jorgačevski J, Zorec R. Astrocytes in flavivirus infections. IJMS. (2019) 20:691. doi: 10.3390/ijms20030691

65. Meertens L, Labeau A, Dejarnac O, Cipriani S, Sinigaglia L, Bonnet-Madin L, et al. Axl mediates ZIKA virus entry in human glial cells and modulates innate immune responses. Cell Rep. (2017) 18:324–33. doi: 10.1016/j.celrep.2016.12.045

66. Lemke G, Rothlin C. Immunobiology of the TAM receptors. Nat Rev Immunol. 8:327–36. doi: 10.1038/nri2303

67. Hamel R, Dejarnac O, Wichit S, Ekchariyawat P, Neyret A, Luplertlop N, et al. Biology of Zika virus infection in human skin cells. J Virol. (2015) 89:8880–96. doi: 10.1128/jvi.00354-15

68. Muguruma K, Nishiyama A, Kawakami H, Hashimoto K, Sasai Y. Self-organization of polarized cerebellar tissue in 3D culture of human pluripotent stem cells. Cell Rep. (2015) 10:537–50. doi: 10.1016/j.celrep.2014.12.051

69. Lee CT, Bendriem RM, Wu WW, Shen RF. 3D brain Organoids derived from pluripotent stem cells: promising experimental models for brain development and neurodegenerative disorders. J Biomed Sci. (2017) 24:59. doi: 10.1186/s12929-017-0362-8

70. Bagley JA, Reumann D, Bian S, Lévi-Strauss J, Knoblich JA. Fused cerebral organoids model interactions between brain regions. Nat Methods14. (2017) 743–51. doi: 10.1038/nmeth.4304

71. Sloan SA, Andersen J, Pa?ca AM, Birey F, Pa?ca SP. Generation and assembly of human brain region-specific three-dimensional cultures. Nat Protoc. (2018) 13:2062–85. doi: 10.1038/s41596-018-0032-7

72. Lancaster M, Renner M, Martin CA, Wenzel D, Bicknell LS, Hurles ME, et al. Cerebral organoids model human brain development and microcephaly. Nature. (2013) 501:373–9. doi: 10.1038/nature12517

73. Mariani J, Coppola G, Zhang P, Abyzov A, Provini L, Tomasini L, et al. FOXG1-Dependent dysregulation of GABA/glutamate neuron differentiation in autism spectrum disorders. Cell. (2015) 162:375–90. doi: 10.1016/j.cell.2015.06.034

74. Cameron JS, Alexopoulou L, Sloane JA, DiBernardo AB, Ma Y, Kosaras B, et al. Toll-like receptor 3 is a potent negative regulator of axonal growth in mammals. J Neurosci. (2007) 27:13033–41. doi: 10.1523/JNEUROSCI.4290-06.2007

Keywords: Zika virus, ZIKV, teratogenesis, mechanisms, disease modeling, in vitro models, brain development

Citation: Russo FB, Toledo CM, Tocantins FR, Souza GV and Beltrão-Braga PCB (2022) ZIKV Teratogenesis: Clinical Findings in Humans, Mechanisms and Experimental Models. Front. Virol. 1:775361. doi: 10.3389/fviro.2021.775361

Received: 28 September 2021; Accepted: 29 November 2021; Published: 11 March 2022.

Reviewed by:

Copyright © 2022 Russo, Toledo, Tocantins, Souza and Beltrão-Braga. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) . The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

*Correspondence: Patricia C. B. Beltrão-Braga, patriciacbbbraga@usp.br

Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Volume 27, Number 5—May 2021

Case Series of Laboratory-Associated Zika Virus Disease, United States, 2016–2019

Cite This Article

Zika virus diagnostic testing and laboratory research increased considerably when Zika virus began spreading through the Americas in 2015, increasing the risk for potential Zika virus exposure of laboratory workers and biomedical researchers. We report 4 cases of laboratory-associated Zika virus disease in the United States during 2016–2019. Of these, 2 were associated with needlestick injuries; for the other 2 cases, the route of transmission was undetermined. In laboratories in which work with Zika virus is performed, good laboratory biosafety practices must be implemented and practiced to reduce the risk for infection among laboratory personnel.

Zika virus is a flavivirus that was first isolated in 1947 from a rhesus macaque in the Zika Forest in Uganda. Zika virus is primarily transmitted to humans by infected mosquitoes, but other confirmed transmission modes include intrauterine, sexual, and intrapartum transmission, and probable modes include transmission through blood transfusion and breastfeeding ( 1 ). Laboratory-associated infection also has been reported in a small number of cases; one of the earliest reports of human Zika virus infection was possibly laboratory-acquired ( 2 ). A researcher was working in a Uganda laboratory in 1963 with Zika virus strains isolated from mosquitoes. After he experienced fever and rash, laboratory testing indicated Zika virus infection. However, no apparent breakdown in biosafety procedures was identified, and mosquitoborne transmission could not be excluded. In 1972, Zika virus infection in another laboratory worker occurred, this time in the absence of a potential mosquitoborne route of transmission ( 3 ). The person was symptomatic, and infection was confirmed by virus isolation. He worked in an arboviral laboratory but no exposure that might have led to infection was reported. A 1980 report by the American Committee on Arthropod-borne Viruses, which documented results of global laboratory surveys conducted in 1976 and 1978, noted an additional 3 Zika virus disease cases in laboratory workers. The suspected sources of these infections were through the aerosol route or unknown, and further details were not provided ( 4 ). Finally, a laboratory-acquired Zika virus infection occurred in 2017 in Brazil after an infected mouse bit a researcher’s finger ( 5 ).

Zika virus diagnostic testing and laboratory research increased considerably beginning in 2015 when Zika virus began spreading through the Americas, increasing the risk for potential Zika virus exposure for laboratory workers and researchers. We report 4 cases of laboratory-associated Zika virus disease in the United States during 2016–2019.

Case Reports

Exposure to zika virus through needlestick injury.

In May 2016, a female researcher who worked in a Biosafety Level (BSL) 3 microbiology laboratory sustained a needlestick injury with a bifurcated needle; information on whether the skin was punctured was not available. The incident occurred during in vitro inoculation of human skin cells with wild-type Zika virus for vaccine research purposes. She was wearing 2 pairs of nitrile gloves and working in a biosafety cabinet. She immediately used a surgical sponge and chlorohexidine to scrub the wound for 15 minutes, then washed her hands with soap and water. After 9 days, she experienced a low-grade fever, generalized maculopapular rash, headache, myalgia, and fatigue; mild unilateral conjunctivitis occurred the next day. She did not live in an area with local Zika virus transmission, and in the month before illness onset she had no other risk factors for acquisition of Zika virus infection (i.e., no history of travel, no sexual contact with a traveler, and no history of blood transfusion or organ transplantation). She reported full resolution of her symptoms within 5 days. Zika virus infection was confirmed through the detection of Zika virus RNA in serum and urine and Zika virus IgM and neutralizing antibodies in serum ( Table ).

In July 2018, a female researcher received an accidental needlestick injury while recapping a needle after inoculating a mouse with the Uganda Zika virus strain MR766 at a concentration of 10 7 PFU/mL ( 6 ). At the time of the incident, she was working in a biosafety cabinet and was double gloved. She felt the stick from the needle on her left middle finger but did not see any blood. She immediately removed her gloves, washed her hands with soap and water, and applied alcohol. After 10 days, she became symptomatic with a pruritic maculopapular rash, arthralgia, and myalgia. Zika virus infection was confirmed on the basis of the detection of Zika virus RNA in urine and serologic testing ( Table ). There was no reported local Zika virus transmission where she lived, and apart from the needlestick injury she had no other risk factors for acquisition of Zika virus infection. She recovered completely within ≈2 weeks of symptom onset.

Other Laboratory-Associated Zika Virus Exposures

In November 2017, a male worker in a BSL-2 virology laboratory had onset of symptoms (day 0) of headache, arthralgia, myalgia, fatigue, and a rash that initially appeared on his face and spread to his whole body during the next 2 days. The arthralgia and myalgia became progressively more severe and debilitating through day 5, but recovery occurred by day 13. Zika virus infection was confirmed through detection of Zika virus RNA in serum and semen and with serologic methods ( Table ). He had no other risk factors for acquisition of infection and there was no local Zika virus transmission where he lived.

The patient reported that he typically worked with large quantities (4–100 L) of Zika virus in the laboratory but did not recall any specific exposure or incident of concern within the 2 weeks before illness onset. His activities included clarifying Zika virus materials through filters, performing pump-driven chromatography, using buffers to dilute concentrated Zika virus, and adding formaldehyde to initiate Zika virus inactivation. The recommended personal protective equipment (PPE) he routinely wore included a first PPE layer, donned in an external area, of disposable laboratory coat or coverall, booties, a hairnet, goggles, and 1 pair of gloves and a second PPE layer of a second coverall, hairnet, pair of gloves, and disposable face shield donned once inside the laboratory; no mask was used. He performed his work inside a biosafety cabinet when possible but could not do so when using larger containers (e.g., the biosafety cabinet could not accommodate the large vessels used for pouring liquid live virus through a funnel). The liquid could sometimes potentially splash. On 1 occasion during the probable exposure period, while he was working in a biosafety cabinet, a large droplet of live virus dripped onto his glove; he immediately changed the outer glove. He reported it was possible he might have rubbed his face with the back of a gloved hand; however, no confirmed mucus membrane exposure could be identified. An additional 12 employees working with Zika virus in the same laboratory were subsequently tested and showed no serologic evidence of recent or past Zika virus infection.

In October 2019, a male researcher in a vaccine research laboratory experienced fever, rash, arthralgia, and conjunctival injection. His laboratory activities sometimes involved working with Zika virus, including performing serum neutralization testing, and he had worked with Zika virus 8 and 10 days before symptom onset. He routinely wore gloves in the laboratory, but more detailed PPE information was unavailable. An investigation did not identify any specific exposure or reported breach in biosafety procedures, and no sharps were used in the laboratory. He did not live in an area with a history of Zika virus transmission and he had no other risk factors for Zika virus infection. Confirmation of infection was by detection of Zika virus RNA in urine and by serologic methods ( Table ). Symptoms resolved within 8 days.

During the 4-year period from 2016–2019, 4 cases of laboratory-acquired Zika virus infection were reported in the United States: 2 associated with needlestick injuries and 2 in which the means of exposure was undetermined. In laboratories where work with Zika virus is performed, good laboratory safety practices are critical to reduce the risk to personnel of Zika virus exposure and disease.

Many factors affect the likelihood of Zika virus infection following exposure, including the type and severity of any injury or exposure, route of exposure, viral concentration and dose, transmissibility of the strain, immediate management of any recognized exposure, and the worker’s health status. At least 3 other potential occupational exposures to Zika virus have occurred among researchers without subsequent Zika virus infection: a bite from an infected mouse that punctured the skin of a gloved researcher’s finger ( 7 ), a puncture wound from a needle that occurred when a double-gloved researcher was collecting a blood sample from a Zika virus-infected ferret (M. Sauri, Occupational Health Consultants, pers. comm., 2017 Jan 30), and a thumb laceration from a scalpel contaminated with chicken blood in a researcher harvesting chickens inoculated with Zika virus ( 7 ). Other exposures or infections might have occurred and remained unreported or been undetected if appropriate testing was not completed.

A limitation of this report is that viral sequencing could not be done to provide supporting evidence that the Zika virus infections were laboratory-acquired. However, the patients lived in areas without endemic Zika virus disease and patient investigations revealed no other risk factors for acquisition of Zika virus infection (i.e., no patients had traveled, had sexual contact with a traveler, or received a blood transfusion or organ transplant). Therefore, the infections were likely laboratory-acquired.

The Biosafety in Microbiological and Biomedical Laboratories guidelines recommend BSL-2 practices, safety equipment, and facilities for working with Zika virus ( 8 ). Similarly, recommendations exist for animal BSL-2 practices, equipment, and facility requirements when animal studies involving Zika virus are conducted ( 8 ). In addition, laboratories should perform a risk assessment to determine whether certain procedures or specimens might require higher levels of biocontainment ( 9 ). For example, manipulating large quantities of virus or high titer preparations might warrant a shift to BSL-3 practices, including additional respiratory protection ( 8 ). Altering practices might be particularly critical when working outside a biosafety cabinet or when not wearing adequate PPE to protect against aerosol or droplet transfer of infectious material.

Laboratory personnel should have appropriate training regarding precautions to prevent exposures associated with the tasks they perform ( 8 ). Institutional policies also should be in place and accessible. Because careful management of needles and other sharps is vital, policies should include recommendations for the safe handling of sharps; for needles, actions that involve manipulation by hand before disposal, including bending, recapping, or removing from the syringe, are not advised ( 8 ). Biosafety in Microbiological and Biomedical Laboratories guidelines provide comprehensive information on recommended practices, safety equipment, and laboratory facilities ( 8 ). Broader guidance for protecting workers from occupational exposure to Zika virus also is available from the Occupational Safety and Health Administration and from the Centers for Disease Control and Prevention National Institute for Occupational Safety and Health ( 10 ).

Appropriate evaluation and management of occupational Zika virus exposures is crucial. If an incident occurs, established workplace procedures for initial wound management or mucous membrane exposures should be followed and the event immediately reported to a supervisor. No specific Zika virus post-exposure prophylaxis exists; however, as soon as possible after the incident, a baseline serum sample should be obtained and stored in case comparison with a convalescent serum sample is needed. Persons should be advised to take steps to prevent potential sexual transmission of Zika virus and to avoid mosquito bites if in a geographic area with risk for mosquito-borne transmission of Zika virus. These measures should be continued until laboratory testing excludes infection; if Zika virus infection is confirmed, additional counseling should be provided. If symptoms consistent with Zika virus disease occur within 2 weeks of the exposure, serum and urine should be collected and tested by using appropriate molecular and serologic methods. For an exposed person who remains asymptomatic, a serum sample should be obtained > 2 weeks postexposure. This serum sample should be tested for Zika virus IgM and if positive, tested by plaque-reduction neutralization test, and results compared with those from the baseline sample to assess for asymptomatic infection. Similarly, if a person is symptomatic within 2 weeks of exposure and test results on collected samples are negative, indicating the illness is unrelated to Zika virus infection, consideration should be given to obtaining an additional serum sample at > 2 weeks postexposure and similarly evaluating for asymptomatic infection.

Although Zika virus transmission has declined substantially in recent years, research using Zika virus is ongoing. Exposure and infection are occupational risks for laboratory and biomedical research workers who work with live virus. Strong infection prevention practices are essential for reducing this risk ( 11 ). Establishing and implementing appropriate policies and procedures, providing adequate training, making available and ensuring proper use of PPE and other safety equipment, and confirming facilities are suitable for the type of work being conducted are all required to protect personnel from any adverse health outcomes.

Dr. Hills is a medical epidemiologist in the Arboviral Diseases Branch at the Centers for Disease Control and Prevention, Fort Collins, Colorado, USA. She has worked for more than 20 years on the epidemiology, prevention, and control of arboviral diseases in domestic and international settings.

Acknowledgment

We thank Heather Forbes, Alana Sulka, Brittany Carter, Samir Gunjan, and Tamara Simmons for their contributions to the investigation and laboratory expertise. We thank Ann Powers for her review of the manuscript and Ingrid Rabe for assistance with case investigation.

• Gregory  CJ , Oduyebo  T , Brault  AC , Brooks  JT , Chung  KW , Hills  S , et al. Modes of transmission of Zika virus. J Infect Dis . 2017 ; 216 ( suppl_10 ): S875 – 83 . DOI PubMed Google Scholar
• Simpson  DI . Zika virus infection in man. Trans R Soc Trop Med Hyg . 1964 ; 58 : 335 – 8 . DOI PubMed Google Scholar
• Filipe  AR , Martins  CMV , Rocha  H . Laboratory infection with Zika virus after vaccination against yellow fever. Arch Gesamte Virusforsch . 1973 ; 43 : 315 – 9 . DOI PubMed Google Scholar
• The Subcommittee on Arbovirus Laboratory Safety of the American Committee on Arthropod-Borne Viruses . Laboratory safety for arboviruses and certain other viruses of vertebrates. Am J Trop Med Hyg . 1980 ; 29 : 1359 – 81 . DOI PubMed Google Scholar
• Talon de Menezes  M , Rilo Christoff  R , Higa  LM , Pezzuto  P , Rabello Moreira  FR , Ribeiro  LJ , et al. Laboratory acquired Zika virus infection through mouse bite: a case report. Open Forum Infect Dis. 2020 ;7:ofaa259.
• Lichtenberger  PN , Ricciardi  MJ , Solorzano  D , Raccamarich  P , Leda  A , Sharkey  M , et al. Occupational exposure to the Ugandan research strain (MR766) of Zika virus. Open Forum Infect Dis . 2019 ; 6 : ofz420 . DOI PubMed Google Scholar
• Shugart  JM , Brown  CK . Zika virus presents an ongoing occupational health hazard for laboratory and biomedical research workers. J ABSA Int. 2019 ; 24 : 8 – 9 . DOI Google Scholar
• US Department of Health and Human Services . Biosafety in microbiological and biomedical laboratories. 5th edition. 2009 [ cited 2020 Feb 5 ]. https://www.cdc.gov/labs/pdf/CDC-BiosafetyMicrobiologicalBiomedicalLaboratories-2009-P.PDF
• Centers for Disease Control and Prevention . Laboratory safety when working with Zika virus [ cited 2020 Feb 5 ]. https://www.cdc.gov/zika/laboratories/lab-safety.html
• Occupational Safety and Health Administration, National Institute for Occupational Safety and Health. Interim guidance for protecting workers from occupational exposure to Zika virus [ cited 2020 Feb 5 ]. https://www.osha.gov/zika
• Brown  CK , Shugart  JM . Zika virus in workers: Considerations for ongoing exposure prevention. Am J Ind Med . 2019 ; 62 : 455 – 9 . DOI PubMed Google Scholar
• Table . Laboratory results from 4 patients with laboratory-associated Zika virus disease, United States, 2016–2019

DOI: 10.3201/eid2705.203602

Original Publication Date: April 14, 2021

Table of Contents – Volume 27, Number 5—May 2021

Please use the form below to submit correspondence to the authors or contact them at the following address:

Susan Hills, Arboviral Diseases Branch, Centers for Disease Control and Prevention, 3156 Rampart Road, Fort Collins, CO 80521, USA

Comment submitted successfully, thank you for your feedback.

There was an unexpected error. Message not sent.

Exit Notification / Disclaimer Policy

• The Centers for Disease Control and Prevention (CDC) cannot attest to the accuracy of a non-federal website.
• Linking to a non-federal website does not constitute an endorsement by CDC or any of its employees of the sponsors or the information and products presented on the website.
• You will be subject to the destination website's privacy policy when you follow the link.
• CDC is not responsible for Section 508 compliance (accessibility) on other federal or private website.

Article Citations

Highlight and copy the desired format.

Metric Details

Article views: 3204.

Data is collected weekly and does not include downloads and attachments. View data is from .

What is the Altmetric Attention Score?

The Altmetric Attention Score for a research output provides an indicator of the amount of attention that it has received. The score is derived from an automated algorithm, and represents a weighted count of the amount of attention Altmetric picked up for a research output.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Review Article
• Published: 29 August 2018

The emergence of Zika virus and its new clinical syndromes

• Theodore C. Pierson 1 &
• Michael S. Diamond 2 , 3 , 4 , 5  

Nature volume  560 ,  pages 573–581 ( 2018 ) Cite this article

21k Accesses

265 Citations

54 Altmetric

Metrics details

• Viral pathogenesis

Zika virus (ZIKV) is a mosquito-transmitted flavivirus that has emerged as a global health threat because of its potential to generate explosive epidemics and ability to cause congenital disease in the context of infection during pregnancy. Whereas much is known about the biology of related flaviviruses, the unique features of ZIKV pathogenesis, including infection of the fetus, persistence in immune-privileged sites and sexual transmission, have presented new challenges. The rapid development of cell culture and animal models has facilitated a new appreciation of ZIKV biology. This knowledge has created opportunities for the development of countermeasures, including multiple ZIKV vaccine candidates, which are advancing through clinical trials. Here we describe the recent advances that have led to a new understanding of the causes and consequences of the ZIKV epidemic.

Similar content being viewed by others

Long COVID: major findings, mechanisms and recommendations

Vaccination reduces central nervous system IL-1β and memory deficits after COVID-19 in mice

A guide to vaccinology: from basic principles to new developments

ZIKV was first isolated from a febrile sentinel monkey in Uganda in 1947. Serological data suggest that ZIKV was distributed widely throughout Africa and subsequently in Asia despite the absence of described morbidity 1 . The first ZIKV outbreak to garner international attention occurred on Yap Island in the Western Pacific Ocean in 2007. Forty-nine confirmed human cases were reported 2 . More than half of the inhabitants of Yap were believed to have been infected, with many experiencing rash, fever and arthralgia. ZIKV activity was next detected in the islands of French Polynesia in 2013, with a larger number of infections. Some of the unique clinical features of ZIKV (for example, Guillain–Barré syndrome, congenital malformations and the presence of the virus in semen) were identified during this outbreak or later in retrospective studies 3 . ZIKV was introduced in Brazil in late 2013 or early 2014, spread rapidly within the northeast part of the country, and was repeatedly introduced into regions of the Americas 4 . The large number of infections and links to congenital neurodevelopmental defects identified this epidemic as an international public health emergency. ZIKV activity in the Americas peaked in the early spring of 2016, followed by a marked decrease in reported cases in 2017, which is probably attributable to the effect of herd immunity. Seroprevalence studies suggest that 63% of the inhabitants of Salvador, Brazil were infected during this outbreak 5 . By 2017, more than 220,000 confirmed and 580,000 suspected cases were reported in 52 countries or territories in the Americas (PAHO Zika Cumulative Cases; 4 January 2018).

Viral structure

Flaviviruses encapsulate a positive-stranded RNA genome, which encodes a single open reading frame flanked by two structured untranslated regions (UTRs) (Fig.  1 ). The single viral polyprotein is processed by host and viral proteases into three structural proteins (capsid (C), pre-membrane (prM) and envelope (E)) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5), the latter of which mediate genome replication, viral polyprotein processing and modulation of the host response. ZIKV virions are composed of the three structural proteins, a lipid envelope and the viral RNA genome. The E protein is an elongated protein, which consists of three ectodomains connected by short flexible loops and is anchored to the viral membrane by a helical stem and two antiparallel transmembrane domains (Fig.  1 ). In most ZIKV strains, the E protein is modified by a single N-linked glycan at position E154 located in domain I (E-DI); some pre-epidemic ZIKV strains from Africa lack this N-linked glycan and are less neuroinvasive 6 . Although ZIKV is most closely related to another African flavivirus called Spondweni virus (approximately 68% E protein amino acid identity), it shares sequence similarity with other flaviviruses. Approximately 50% of the E protein is conserved among ZIKV and dengue (DENV) virus strains. Although conserved regions could be targeted by broadly reactive protective antibodies 7 , 8 , this feature complicates the development of virus-specific diagnostics, and raises the prospect of adverse immune reactions in individuals exposed sequentially to ZIKV and DENV 9 . Two lineages of ZIKV (African and Asian) differ from each other by approximately 10% at the nucleotide level 1 . ZIKV strains in the Americas descend from the Asian lineage 10 .

a , ZIKV encapsulates a positive-stranded genomic RNA sequence that encodes a single polyprotein, which is cleaved into three structural and seven non-structural proteins. b , E consists of three ectodomains (E-DI, E-DII and E-DIII, which are shown in red, yellow and blue, respectively) and is anchored into the viral membrane by two anti-parallel transmembrane domains (TMD; grey). A highly conserved fusion loop (DII-FL) is located at the distal end of DII (green). c , Mature virions incorporate 180 copies of the E protein arranged with icosahedral symmetry. E proteins are in three environments defined by their proximity to the two-, three- and fivefold symmetry axes (shades of purple) 12 , 13 .

The prM protein is a small glycoprotein that is connected to the viral membrane by antiparallel transmembrane helices. Immature ZIKV virions assemble on endoplasmic reticulum-derived membranes as particles on which trimers of prM–E heterodimers form spiked projections arranged with icosahedral symmetry 11 . These non-infectious virions transit through the secretory pathway and undergo a conformational change upon exposure to the mildly acidic environment in the trans-Golgi network that enables cleavage of prM by a host furin-like protease. Mature virions are characterized by a relatively smooth structure created by 90 E protein dimers orientated parallel to the plane of the viral membrane 12 , 13 (Fig.  1 ). However, prM cleavage can be inefficient, resulting in partially mature infectious virions that retain uncleaved prM. Although the efficiency of prM cleavage on ZIKV relative to other flaviviruses is not yet known, partially mature ZIKV virions may be infectious. Although there has been rapid progress into the structural biology of ZIKV virions, these studies capture only a single state of mature and immature virions. Insights into the structural ensembles that are adopted by the virus throughout its replication cycle await further study 14 . Additional comparative analyses of prM–E proteins and virion structures of pre- and post-epidemic ZIKV strains could provide further insights into how ZIKV evolved to become more pathogenic and cause distinct clinical syndromes.

ZIKV infection in different clinical contexts

The clinical syndrome caused by ZIKV in humans was historically reported as a mild influenza-like illness that resolved within days and occurred in approximately 20% of infected individuals 2 (Fig.  2 ). However, in French Polynesia, the rate of symptomatic infections was higher (approximately 50%) 15 . The most common signs and symptoms of ZIKV infection in the French Polynesian and American outbreaks occurred within 3–7 days of being bitten by a mosquito and included fever (72%), arthralgia and myalgia (65%), conjunctivitis (63%), headache (46%), fatigue and/or rash 3 . During the recent epidemics, ZIKV infection also has been associated, albeit infrequently, with severe disease in adults, including multi-organ failure 16 , meningitis and encephalitis 17 , and thrombocytopenia 18 . Although ZIKV generally does not cause fatal disease in adults, mortality has been described in children with sickle cell disease, adults with cancer 16 and those cases who develop Guillain–Barré syndrome 19 , a progressive polyneuropathy linked to ZIKV infection, which occurred in 1/6,500 to 1/17,000 individuals in endemic regions 3 , 20 (Fig.  2 ).

a , Transmission. ZIKV is transmitted in an epidemic cycle between Aedes mosquitoes and humans. ZIKV can also be transmitted through sexual contact or vertical transmission from an infected pregnant mother to her fetus. b , Clinical syndromes. Most ZIKV infections are asymptomatic. Among symptomatic cases, most patients develop an illness characterized by fever, rash, conjunctivitis, headaches and muscle and/or joint pain. During pregnancy, ZIKV infection can result in microcephaly, congenital ZIKV syndrome (CZS) and fetal demise. In a subset of adults, infection is linked to Guillain–Barré syndrome, which can result in muscle weakness and paralysis.

A distinguishing feature of ZIKV infection during the recent epidemic is an apparent broadening of cellular tropism and persistence in multiple organs; this has resulted in ostensibly new clinical manifestations. It remains unclear whether this reflects a fundamental change in ZIKV virulence or whether this is now appreciated owing to the greater number of diagnosed infections. ZIKV persists in whole-blood and immune-sanctuary sites. In multiple case reports, whole blood from non-pregnant adults remained positive for ZIKV RNA for 60–100 days, long after serum and other body fluids became negative 21 , 22 . In a pediatric study that evaluated the acute phase of infection, ZIKV principally infected CD14 + CD16 + monocytes in the blood 23 . ZIKV can replicate persistently within cells of the anterior and posterior chambers of the eye 24 , which causes conjunctivitis, maculopathy and uveitis, the latter of which can result in blindness 25 , 26 . ZIKV persistence in the eye has been detected in mice and humans for up to 30 days 24 , 27 , and is speculated to be a means of direct transmission 16 , 24 .

Another site of ZIKV persistence is the male reproductive tract. Persistent ZIKV RNA in sperm and semen has been reported in humans for months 28 , although infectious virus was limited to the first few weeks after disease onset 29 . Experiments in monkeys also show persistence of ZIKV in male reproductive tract tissues 30 . Studies in mice have demonstrated that ZIKV can replicate in cells of the testis, including spermatogonia, Sertoli cells and Leydig cells, which results in destruction of testicular architecture, reduction in sperm counts, lower levels of sex hormones and reduced fertility 31 , 32 . Oligospermia and haematospermia have been observed in humans after ZIKV infection and are speculated to affect fertility 33 . The high viral load in seminal fluid can lead to sexual transmission from men-to-women 34 and men-to-men 35 (Fig.  2 ).

ZIKV is linked to the development of Guillain–Barré syndrome in a small percentage of adults 36 , 37 , although causality has not been proven. Guillain–Barré syndrome is an acute inflammatory immune-mediated polyneuropathy that typically presents with paresthesia, weakness and pain, but can progress to paralysis and even death. Case reports have been published of ZIKV-associated Guillain–Barré syndrome in French Polynesia in 2013 and in the Americas 38 , 39 . Although more investigations into its cause are needed, leading hypotheses include B or T cell-mediated immunopathology due to viral antigen mimicry or direct viral infection and injury of cells of the peripheral nervous system.

Considerable effort has been made to define why ZIKV has teratogenic abilities. Initial studies focused on the placenta, because it acts as a structural and immunologic barrier between the maternal uterine-derived decidua and the developing fetus during pregnancy 40 (Fig.  3 ). The maternal–fetal interface is characterized by an apposition of maternal decidua with fetally derived proliferative cytotrophoblasts and terminally differentiated syncytiotrophoblasts, the latter of which create a multi-nucleated cell barrier. In the first trimester, the human placenta becomes haemochorial, directly contacting maternal blood, which allows for the exchange of gases, nutrients and wastes. Syncytiotrophoblasts also function as a physical and immunological barrier between the maternal and fetal circulation to prevent spread of microbial agents. The maternal–fetal interface is defined by the differentiation of floating and anchoring villous structures. The core of the villous structure beneath the syncytiotrophoblast layer consists of fetal Hofbauer macrophages, fibroblasts and endothelial cells.

Vertical transmission requires ZIKV to spread to the immunologically privileged fetus. Maternal–fetal interactions occur at placental villous structures that are in contact with maternal blood and the adjacent decidua. Placental villi are lined by syncytiotrophoblasts that form a physical barrier against infection and have active roles in antiviral immunity through production of IFNλ and microRNAs 43 , 147 . ZIKV targets several placental cells including trophoblasts, Hofbauer macrophages and endothelial cells.

The importance of trophoblasts to fetal ZIKV infection was first identified in cell culture studies. Human trophoblast cells isolated early during pregnancy propagated ZIKV to high levels 41 , 42 . However, human fetal-derived chorionic villi or trophoblast cells obtained later during gestation supported less ZIKV infection, which probably reflects pregnancy stage-dependent effects of trophoblast differentiation and immunological maturation 43 . The reduced susceptibility to ZIKV infection at later gestational stages results in part from distinct innate immune profiles, including production or response to type-III interferon-λ (IFNλ) 43 , 44 or differential expression of putative entry receptors. ZIKV can also replicate in placental cytotrophoblasts or primitive trophoblasts 41 , 42 , fetal Hofbauer macrophages 45 and fetal endothelial cells 46 . Infection of fetal Hofbauer macrophages may be particularly important in humans, as ZIKV RNA and antigen have been localized to these cells in the placentas of women who had pregnancy losses during the first or second trimester 47 . These data suggest that ZIKV may be transmitted to fetuses by a transplacental route. This tropism of ZIKV may not be unique among flaviviruses, as inoculation of human placental explants or pregnant mice with the related West Nile and Powassan viruses also resulted in infection of trophoblasts and injury to the placenta 48 .

Thousands of infants have been born with ZIKV-induced neurological sequelae (CZS) that will impair their future neurodevelopmental function 49 . Insight into the molecular basis of CZS has been informed by experiments with cultured neuroprogenitor stem cells, cortical organoids, brain slices and mouse brain inoculation studies 50 . In these models, ZIKV preferentially targets progenitor cells of the cerebral cortex and results in reduced cell proliferation and differentiation, and increased inflammation and increased cell death 51 . ZIKV may also infect microglia in the brain, which can produce inflammatory cytokines (for example, TNF, IL-6 and IL-1β) that inhibit proliferation and differentiation of neuronal precursor cells 52 . Studies have also suggested that ZIKV can infect and modulate immune responses of astrocytes, in a manner that depends on expression of the cell surface protein AXL 53 , 54 .

There is a range of penetrance of CZS in different geographical regions for reasons that remain unclear. In one case series of 182 symptomatic, ZIKV-infected pregnant women in Brazil, a remarkable 42% of fetuses had abnormal clinical or brain imaging findings, and adverse outcomes were noted regardless of trimester of infection 55 . Retrospective analysis in French Polynesia also found an increased risk of microcephaly associated with ZIKV infection 56 . In a study of ZIKV infection during pregnancy in the territories of the United States, 5% of fetuses or infants had birth defects, with deleterious outcomes occurring in all trimesters 57 . Neuroimaging of the brains of congenitally infected neonates have reported hypoplasia of the cerebellum and brainstem, ventriculomegaly, myelination defects, calcifications and cortical malformations. The clinical presentation of CZS is variable and includes fetal demise and microcephaly 55 , as well as sensorineural hearing loss, ocular abnormalities and arthrogryposis (joint contractures). Severe microcephaly is associated with mental retardation, learning disabilities, behavioural abnormalities, muscle weakness and altered muscle tone. The devastating effects of CZS are reflected by data from one longitudinal cohort of infants that was followed for eight months after birth: 85% had irritability, 56% had altered muscle tone and movement, 50% had epileptic seizures, 15% had dysphagia, and all of these infants had abnormal brain imaging studies 58 . In a second study of CZS-affected children from Brazil who were followed for 19–24 months, most had severe motor impairment, seizure disorders, hearing and vision abnormalities and sleep difficulties; this resulted in these children falling far behind in achieving developmental milestones, indicating the need for long-term support 59 .

Key questions related to CZS remain: (1) What is the risk of vertical transmission and disease in mothers who contract an asymptomatic ZIKV infection? (2) For neonates of mothers infected with ZIKV during the different stages of pregnancy who appear normal at birth, what is the risk of neurodevelopmental disorders? (3) How does pre-existing maternal flavivirus immunity impact pregnancy-associated disease?

Pathogenesis models in animals

There has been remarkable progress establishing mouse models of ZIKV infection and disease. Peripheral challenge of adult wild-type mice with ZIKV isolates results in little virus replication and no disease 60 . In comparison, infection of neonatal mice often causes non-fatal yet severe neurological disease characterized by tremors, ataxia, seizures and microcephaly. Because of the failure of immunocompetent adult mice to sustain a ZIKV infection, several groups evaluated the capacity of mice with IFN signalling deficiencies to support ZIKV replication, as this strategy had been used for other flaviviruses (for example, DENV and yellow fever virus). Mice that lacked the type-I Ifnar1 gene, or both Ifnar1 and the type-II Ifngr receptors, or that received a neutralizing anti-Ifnar1 antibody were susceptible to infection by most strains of ZIKV, and this resulted in central nervous system disease and death following inoculation through several different routes.

Mouse models of ZIKV infection during pregnancy have been developed to study transmission, teratogenicity and vaccine protection. Subcutaneous inoculation of pregnant Ifnar1 −/− or wild-type dams treated with anti-Ifnar1 antibodies resulted in ZIKV infection of trophoblasts in the placenta, which enabled transplacental transmission, spread to the fetal brain and fetal demise 41 . The gestational stage of the dam affects clinical outcome: ZIKV infection during early pregnancy (embryonic day (E)6) resulted in placental insufficiency and fetal demise, infections at mid-pregnancy (E9) resulted in reduced cranial dimensions consistent with microcephaly, and infection during late pregnancy (E12) caused no apparent fetal disease 44 . These results correlate with human studies, which show ZIKV-associated microcephaly occurs more commonly when infections happen during the first and early second trimesters 61 .

Pregnant immunocompetent mice do not transmit ZIKV to the placenta or fetus when the virus is inoculated subcutaneously, presumably because of the failure to evade type-I IFN immunity 41 . However, intravenous inoculation of pregnant mice with high doses of ZIKV caused cortical brain malformations and fetal ocular abnormalities 62 , 63 . As an alternative model, direct ZIKV inoculation into the uterine wall of pregnant mice resulted in placental infection and inflammation, reduced neonatal brain cortical thickness and reduced fetal viability 64 . One study showed that direct viral infection of the fetus is not essential for demise, as placental pathology may be a stronger contributor to adverse pregnancy outcomes 65 . Other groups have injected ZIKV directly into the developing fetus in the cerebroventricular space; this resulted in decreased brain size, thinning of cortical layers, reduced numbers of cortical neural progenitors and neuronal cell death 66 . Intravaginal transmission of ZIKV during pregnancy has also been modelled in Ifnar1 −/− mice during the progesterone-high, diestrous phase of the estrous cycle 67 . Finally, a recent study generated an immunocompetent mouse model of ZIKV infection and placental transmission by introducing the human STAT2 gene into the mouse Stat2 locus 68 .

In Africa, ZIKV undergoes a sylvatic phase with infection of non-human primates (NHPs) occurring in an endemic cycle. NHP models have advantages over rodent models, as ZIKV naturally targets primates and, thus, is more likely to overcome species-specific immune barriers to infection. Moreover, NHPs are evolutionary closer to humans than rodents, and the findings on pathogenesis and host restriction therefore are probably more relevant. Consequently, experimental ZIKV infection in rhesus, cynomolgus and pigtail macaques as well as marmosets has been used to evaluate ZIKV biology 69 , 70 , 71 , 72 . Because there is concern that ZIKV could establish a sylvatic cycle in the Americas, more recent studies have evaluated ZIKV infection in New World marmosets 73 .

Experimental inoculation of rhesus macaques with ZIKV resulted in weight loss, elevated body temperature, rash and mild hepatitis. These animals developed viraemia that peaks within the first week and then becomes undetectable by day 10, and viral RNA was detected in urine, saliva, lacrimal fluid, cerebrospinal fluid, seminal fluid and vaginal secretions 69 , 70 . ZIKV infected multiple tissues of rhesus and cynomolgus macaques including lymphoid organs, the male reproductive tract, the intestines, and the brain and spinal cord 70 , 72 , 74 . Because infected rhesus macaques also developed ZIKV-specific humoral and cell-mediated immune responses 69 , 70 , 71 , 74 , this model has been used to study sequential ZIKV and DENV infections and vaccine efficacy 75 , 76 .

Although challenging, ZIKV infection of pregnant NHPs is important because the haemochorial placenta and gestational development are more similar to humans than mice. Pregnant rhesus macaques infected with ZIKV developed viraemia that lasted for 30–55 days 69 , which is similar to viraemia observed in pregnant women 77 . The first NHP model of in utero transmission was established after inoculation of a pigtail macaque with an Asian ZIKV strain 78 . Infection resulted in reduced growth of the fetal brain, white matter gliosis and axonal damage, and ZIKV RNA was detected in the placenta, fetal brain and liver. In other studies, pregnant rhesus macaques infected with an Asian or American ZIKV strain also resulted in prolonged maternal viraemia 79 , 80 . Fetal head growth in the last month of gestation was decreased, and ZIKV RNA was detected in fetal tissues at birth. Pathological analysis showed neutrophil infiltration at the maternal–fetal interface and brain lesions in fetuses, including microcalcifications, haemorrhage, vasculitis and apoptosis of neuroprogenitor cells 79 , 80 . Because 26% of NHPs infected with ZIKV during early gestation experienced fetal demise despite showing few clinical signs, pregnancy loss due to asymptomatic infection may be underrecognized 81 . Vertical transmission in NHP models may provide a platform for testing vaccines and antibody-based therapeutics 82 , 83 . In other studies, postnatal ZIKV infection was associated with abnormalities in brain structure, function and behaviour in infant macaques 84 .

Innate immune responses to ZIKV infection

Although the initial innate immune events following ZIKV infection are beginning to be characterized, paradigms for recognition and control by the cytoplasmic (RIG-I-like receptors) and endosomal (Toll-like receptors) viral RNA sensors and signalling through downstream adaptor molecules and transcription factors have been extrapolated largely from studies with other flaviviruses.

Type-I and type-III IFNs induce antiviral states through induction of IFN-stimulated genes (ISG) that control viral replication. Type-I IFNs (for example, IFNα and IFNβ) bind to their heterodimeric receptor (IFNAR1/IFNAR2) and promote phosphorylation of JAK1 and TYK2. This activates STAT1 and STAT2 to bind IRF9 and form the IFN-stimulated gene factor 3 complex (ISGF3), which transcriptionally activates hundreds of ISGs. Type-III IFNλ binds to a selectively expressed, heterodimeric receptor (IFNLR1/IL10Rβ), and analogously promotes ISGF3 nuclear translocation and ISG induction. In addition, IFNλ has antiviral functions against ZIKV in the maternal decidua and placenta during pregnancy 43 , 44 . Constitutive secretion of IFNλ by syncytiotrophoblasts correlated with their ability to restrict ZIKV infection 43 . The importance of IFN signalling in mediating host restriction of ZIKV was shown by the pathogenicity of ZIKV in Ifnar1 −/− and Stat2 −/− but not immunocompetent mice 60 , 85 , 86 . Several antiviral effector genes induced by type-I and type-III IFNs reportedly have antiviral effects against ZIKV. Members of the IFITM family and their interacting proteins inhibit ZIKV infection at an entry step in the viral life cycle 87 , 88 . Expression of viperin also inhibited ZIKV replication in cells 89 .

ZIKV evades IFN responses by impairing induction and signalling pathways at multiple steps. Human dendritic cells can be infected productively by ZIKV 90 , but do not secrete pro-inflammatory cytokines or type-I IFN, probably because antiviral pathogen-recognition receptors and their downstream signalling pathways are downregulated or evaded 91 . ZIKV targets the IFN signalling pathways by inhibiting JAK1 and STAT activity. ZIKV NS5 targets human STAT2, but not mouse Stat2 for proteasomal degradation 92 , 93 . In addition, ZIKV infection prevents STAT1 phosphorylation 90 . ZIKV NS1 and NS4B also appear to inhibit IFNβ induction at the level of TBK1 activation, and the ZIKV NS2B–NS3 protease impairs IFNAR induction and signalling pathways by targeting human STING but not mouse Sting for cleavage 94 and by degrading JAK1 95 . Finally, ZIKV NS4B induces elongation of mitochondria, which physically contact the membranes associated with the endoplasmic reticulum that are sites of replication. This restructuring attenuates RIG-I-dependent activation of IFN responses. Beyond viral protein-mediated evasion mechanisms, ZIKV also generates a subgenomic viral RNA that antagonizes RIG-I-induced type-I IFN responses 96 .

Apart from active innate immune evasion mechanisms, ZIKV targets some cells that are inherently deficient in innate immune responses. Primary neural progenitor cells have a delayed innate response to ZIKV infection 89 and glioblastoma cancer stem cells, which are highly permissive to ZIKV infection, show an absence of IFN signatures 97 . Analogously, in the vagina, ZIKV replication induces a weak antiviral IFN response 98 .

Adaptive immune responses to ZIKV infection

During primary infection, anti-ZIKV IgM becomes detectable as early as three days after onset of illness with most individuals developing responses by day 8. This early antibody response originates from extrafollicular ZIKV-specific plasmablasts, which comprise a large fraction of the circulating B cells 99 , 100 . This plasmablast response, however, is transient and lasts only a few weeks 100 , with germinal centre-derived plasma cells starting to produce antibody at this time. Neutralizing antibodies develop within the first week of illness, and as the IgG response matures, inhibitory antibodies in sera accumulate and neutralize virus strains from both Asian and African lineages 101 .

The functional quality and antigenic targets of ZIKV-induced B cell responses have been evaluated 102 . Prior flavivirus immunity is associated with serological cross-reactivity after ZIKV infection 99 , 103 , 104 . In humans with prior DENV immunity, a substantial proportion of anti-ZIKV antibodies generated during acute infection targets the highly conserved fusion loop in E-DII. Plasmablasts from acutely ZIKV-infected, DENV-immune individuals exhibited high levels of somatic hypermutation, with many derived from common memory B cell clones 99 . By contrast, plasmablasts from ZIKV-infected, flavivirus-naive individuals exhibited less somatic hypermutation or clonal expansion 99 , and antibody responses were more ZIKV-specific 105 . In general, cross-reactive antibodies had poorer neutralizing capacity in vitro and limited protective activity in vivo against ZIKV 106 , 107 . Prior flavivirus immunity triggers cross-reactive responses because the memory B cells formed during the first flavivirus infection encounter conserved epitopes present on ZIKV antigens 102 . The magnitude and durability of the cross-reactive response may depend on the duration separating the two flavivirus infections and the number of prior exposures 108 , 109 .

Functional and structural studies have revealed epitopes on all domains of the ZIKV E protein for engagement by highly neutralizing monoclonal antibodies 102 . One class, which consists of antibodies that are cross-reactive with DENV and recognize the quaternary envelope dimer epitope 110 , neutralized ZIKV infection with high potency 7 and protected mice and NHPs from ZIKV infection 8 , 83 or transplacental transmission 8 . A second class of highly neutralizing and protective anti-ZIKV monoclonal antibodies binds to residues within the lateral ridge epitope of E-DIII and blocks infection at a post-attachment step 111 . E-DIII antibodies appear important for controlling ZIKV, as their depletion from human serum resulted in reduced neutralizing activity against ZIKV 112 . A third class of ZIKV monoclonal antibodies also protects against vertical transmission of ZIKV in mice 104 . The only described monoclonal antibody of this class, ZIKV-117, recognizes an epitope across neighbouring E protein dimers and probably prevents the conformational changes required for pH-dependent fusion in the endosome. Finally, neutralizing monoclonal antibodies binding to additional sites within E-DI and E-DII have also been reported 113 .

We are beginning to understand T cell responses against ZIKV. In mice, polyfunctional, cytotoxic CD8 + T cells become activated 114 and can reduce ZIKV burden, whereas their depletion or genetic absence resulted in greater ZIKV infection and mortality 115 . Consistent with this observation, adoptive transfer of ZIKV-immune CD8 + T cells can protect against ZIKV infection 116 . Another study identified human-relevant ZIKV CD8 + T cell epitopes in naive and DENV-experienced HLA-transgenic mice and demonstrated that both ZIKV-specific and ZIKV–DENV cross-reactive CD8 + T cells can protect against ZIKV infection 117 . Thus, CD8 + T cells probably have a protective activity against ZIKV. Nevertheless, CD8 + T cells could have pathological consequences in the brain 118 and result in ZIKV-associated paralysis 119 .

Less is known about human T cell responses to ZIKV. In one study, ZIKV-infected patients developed polyfunctional CD4 + T cell responses that produced antiviral cytokines 105 . In another study, ZIKV infection induced CD4 + T effector cells with a low frequency of IFNγ production 120 . In comparison, whereas CD8 + T cells were highly activated during the viraemic phase (15% to >25% of blood CD8 + T cells), low levels of antigen-specific CD8 + T cells were identified 105 , although others have reported tetramer-positive ZIKV-specific CD8 + T cells in blood 100 . Another study found that memory T cell responses elicited by prior infection or vaccination with DENV were restimulated with ZIKV-derived peptides 121 ; the consequence of this expanded cross-reactive response (beneficial or detrimental) remains to be determined. Almost 60% of the ZIKV-specific CD8 + T cell response was directed against the structural proteins 122 , which could be beneficial for vaccines that exclusively target the structural proteins (see Figs.  1 , 4 ).

a , Flavivirus prM–E proteins form non-infectious subviral particles that share functional and antigenic features with infectious virions. Subviral particles are smaller with T  = 1 icosahedral symmetry, although they may be heterogeneous in size. Multiple ZIKV vaccine platforms that encode prM–E proteins have been evaluated in humans. DNA vaccines GLS-5700 (NCT02809443), VRC-5288 (NCT02840487) and VRC 5283 (NCT02996461) differ with respect to ZIKV strain and signal sequence preceding prM. The C terminus of VRC5288 is a chimaera of JEV. Nucleoside-modified mRNAs (mRNA-1325) and a measles vector (MV-ZIKV) expressing prM–E have also been evaluated (NCT03014089 and NCT02996890, respectively). b , Vaccine candidates derived from infectious ZIKV. Four inactivated vaccine candidates are being assessed. Phase I studies of the ZPIV vaccine construct developed by WRAIR have been conducted (NCT02963909, NCT02952833 and NCT02937233). Studies of the Takeda PIZV (NCT03343626), Emergent Biosolutions VLA1601 (NCT03425149) and Bharat Biotech ZikaVac are underway. Clinical trials of a chimaeric live-attenuated vaccine derived from the NIAID DENV vaccine platform are anticipated.

Possible explanations for the emergence of ZIKV

How ZIKV has changed to cause massive epidemics, congenital defects, infection in immune sanctuary sites, sexual transmission and Guillain–Barré syndrome remains an area of intensive study. Multiple factors may be responsible for the changing epidemiology and disease pathogenesis.

The presence of NS1 in human blood facilitates flavivirus acquisition by mosquito vectors because this protein suppresses the immune functions of the mosquito midgut. A single alanine to valine (A188V) substitution in NS1 of the epidemic ZIKV strains facilitated greater infectivity in Aedes aegypti mosquitoes and enzootic transmission 123 . Clinical isolates from the Americas with a valine at position 188 had higher NS1 antigenemia in mice and were more infectious in mosquitoes than pre-epidemic strains. This same mutation promotes the binding of NS1 to TBK1, resulting in reduced levels of TBK1 phosphorylation and IFNβ expression in human cells 95 . Thus, sequence changes in NS1 during the pre-epidemic to epidemic transition appear to have facilitated immune evasion and enhanced ZIKV transmissibility from hosts to vectors, which creates conditions for epidemic transmission.

Sequence changes have also been hypothesized to affect ZIKV pathogenicity and explain its tropism for fetal neuroprogenitor cells 10 . A single serine to asparagine substitution (S139N) in the viral polyprotein (residue 17 of prM) increased ZIKV infectivity in neural progenitor cells that resulted in more severe microcephaly and higher mortality rates in neonatal mice 124 . Evolutionary analysis indicated that the S139N substitution arose just before the 2013 outbreak in French Polynesia and has been maintained during the American epidemic. The mechanistic basis for how the S139N in prM mediates this effect remains uncertain.

Noncoding sequence adaptations that affect the RNA structure may contribute to neuropathogenicity of epidemic strains. One group identified a Musashi protein binding element in the SL2 stem loop of the 3′ UTR, with sequence changes between ancestral and contemporary strains immediately upstream of this site 125 . Because Musashi proteins regulate mRNA translation and can modulate progenitor cell growth and differentiation, this group postulated that nucleotide polymorphisms in the 3′ UTR might be linked to alterations in Musashi protein binding activity and neurovirulence. A second group showed that Musashi-1 interacts directly with ZIKV genomic RNA and facilitates viral replication 126 . ZIKV infection disrupted the binding of Musashi-1 to its endogenous targets, which deregulated expression of factors that have been implicated in neural stem cell function.

A feature of DENV pathogenesis is that antibodies to one serotype can exacerbate infection with a second serotype via antibody-dependent enhancement (ADE) 9 . ADE occurs when cross-reactive, non-neutralizing quantities of antibodies bind to a heterologous DENV serotype and facilitate infection of myeloid cells that express Fc-γ receptors. Because of the structural similarity between ZIKV and DENV, antibodies produced against these flaviviruses can cross-react 103 , 127 . ADE between DENV and ZIKV has been proposed to contribute to the severity of ZIKV disease in the Americas, since the epidemics occurred in regions in which most people are DENV-immune. Indeed, cross-reactive anti-DENV antibodies can enhance ZIKV infection in cell culture 106 , 127 . Notwithstanding this observation, ADE in cell culture has been demonstrated for many viruses without evidence of worsened disease in humans. One recent study showed that passive transfer of immune plasma against DENV or West Nile virus can enhance ZIKV infection and pathogenesis in Stat2 −/− mice 128 , which suggest that pre-existing anti-flavivirus immunity can promote ZIKV pathogenesis; a caveat to this model is that these mice lacked immune T cells, which can limit the effects of ADE in the context of DENV infection. However, no differences in ZIKV infection were observed after inoculation of naive and flavivirus-immune rhesus macaques 75 . By contrast, prior exposure to ZIKV enhanced DENV infection in rhesus macaques 76 , which has implications for ZIKV vaccine development and deployment. More detailed epidemiological evidence from humans is necessary to confirm whether clinically relevant ADE of ZIKV pathogenesis occurs, especially in the context of vertical transmission. To date, studies in Brazilian cohorts have not found any evidence of ADE, greater disease severity, or effects on birth outcomes in patients with acute ZIKV infection who had previously been exposed to DENV 129 , 130 .

Development of ZIKV vaccines

Efforts to develop a vaccine were initiated rapidly after the threat of ZIKV congenital disease became clear. Multiple vaccine platforms have been evaluated in preclinical and clinical studies (Fig.  4 ). Because ZIKV circulates as a single serotype and infection provides immunity to re-challenge by heterologous strains, a requirement for only a single vaccine antigen is anticipated 71 , 101 .

Synthetic nucleic acids provide a platform for the rapid development of vaccines. Multiple ZIKV prM–E DNA vaccine configurations have been evaluated that vary with respect to the sequence of the structural genes, method of codon optimization, signal sequence used to direct prM into the endoplasmic reticulum lumen and the plasmid backbone 131 , 132 . A construct that lacks the ‘pr’ portion of prM has also been developed 133 , 134 . Three of these DNA vaccines have been evaluated in human studies 132 , 135 . DNA vaccine GLS-5700, which encodes a consensus of prM–E sequences from divergent ZIKV strains lacking the N-linked glycosylation site at E154, was safe and immunogenic in humans; neutralizing antibodies were present in 62% of recipients 132 . DNA vaccine candidates VRC5283 and VRC5288 encode a codon-optimized prM–E derived from an Asian strain downstream of the signal sequence of Japanese encephalitis virus (JEV). The stem and transmembrane domains at the C terminus of these constructs differ due to the replacement of this sequence in VRC5288 with the analogous sequence of JEV. Phase I studies revealed superior immunogenicity of VRC5283 135 . Three doses of VRC5283 delivered at four-week intervals elicited neutralizing antibodies in all subjects. A phase II study to confirm immunogenicity and define efficacy is underway at twenty sites in the Americas.

Nucleoside-modified mRNAs drive protein expression at high levels in vivo, due in part to an ability to limit recognition by sensors of foreign nucleic acids in transduced cells. Capped mRNAs are synthesized using modified nucleosides, encode a codon-optimized open reading frame flanked by untranslated regions, and are encapsulated in lipid nanoparticles or complexed with lipids. Multiple ZIKV mRNA vaccine candidates expressing prM–E elicit neutralizing antibodies at high titre and protect against viraemia after challenge 136 , 137 , 138 . Similar to DNA vaccine platforms, these constructs differ with respect to the sequence of prM–E and signal sequence at the N terminus of prM; the contribution of these properties to differences in immunogenicity are not yet understood. Protection of NHPs following a single dose highlights the promise of this platform 136 . One of these mRNAs (mRNA-1325) has been evaluated in phase I clinical studies.

The chemical inactivation of flaviviruses is an established method for creating protective immunogens for use in humans. Inactivated vaccines are currently in use against tick-borne encephalitis virus and JEV. The Walter Reed Army Institute of Research (WRAIR) developed an inactivated ZIKV vaccine by formalin-inactivation of a Puerto Rican ZIKV isolate. Administration of this ZIKV-purified inactivated vaccine (ZPIV) into mice and NHPs elicited neutralizing antibodies and conferred protection against viraemia following challenge 133 , 134 . Subsequent studies demonstrated that two doses of ZPIV conferred protection for more than one year after vaccination 139 . Safety and immunogenicity of ZPIV in humans was demonstrated in three placebo-controlled clinical studies of two doses at a 28-day interval. Although the WRAIR ZPIV candidate is not being evaluated further, similar inactivated vaccines are being developed by Takeda Pharmaceuticals (PIZV), Emergent Biosolutions (VLA1601) and Bharat Biotech. In contrast to other ZIKV vaccine candidates, the Bharat inactivated virus (ZikaVac) is derived from an African lineage strain.

Live-attenuated vaccines (LAVs) have been safe and cost-effective approaches to control flaviviruses. Whereas the first LAV was created by extensive passage of a strain of yellow fever virus in animals, molecular clone technology has enabled the rational design of attenuated vaccine candidates. ZIKV LAVs that use multiple attenuation strategies including deletions of the 3′ UTR, mutations to remove N-linked glycans on NS1, and chimerization with other flaviviruses have been evaluated in preclinical studies 140 , 141 , 142 . In each case, vaccine-mediated protection was established in mice or NHPs. Clinical studies of a ZIKV chimeric LAV (National Institute of Allergy and Infectious Diseases) will begin enrollment in 2018.

Viral vectored vaccines engineered to express ZIKV antigens also have promise. An adenovirus vector expressing ZIKV M–E elicited neutralizing antibodies and a protective immune response in mice and NHP models 133 , 134 . Vesicular stomatitis and measles virus vectors expressing ZIKV prM–E are in preclinical development and phase I clinical trials, respectively 143 . Vaccinia virus vectors expressing prM–E 144 or NS1 145 elicit protective responses in mouse models. Because NS1 is not present on virions, the NS1 antigen elicits antibodies that probably contribute to protection by recruiting host effector functions. Finally, partially purified recombinant proteins or virus-like particles elicit protective immune responses in mouse models 146 .

A goal of ZIKV vaccine development is to protect against congenital disease. Most preclinical studies of ZIKV vaccine candidates evaluate protection from viraemia following peripheral challenge. The degree to which viral replication must be inhibited to prevent infection of the fetus or access to other immune privileged sites associated with persistence or transmission is unknown. The requirements for vaccine-mediated protection may also depend on the route of infection (mosquito versus sexual transmission). Several vaccines have the capacity to protect against vertical transmission of ZIKV to the fetus 138 , 142 . Vaccine-elicited maternal immunity in the context of neonatal infection has also been shown using a vesicular stomatitis virus-vectored vaccine platform against ZIKV 143 . Passive transfer of vaccine-elicited antibodies and the identification of neutralization titres that relate to protection suggest ZIKV-reactive antibody levels can be a functional correlate 131 , 133 , 139 . It remains unclear whether estimates of a protective quantity of neutralizing antibody will apply uniformly to all vaccine platforms. Preclinical approaches to identify humoral and cellular correlates of protection may have a key role in vaccine licensure.

Conclusions

The epidemic of ZIKV and its clinical consequences resulted in a rapid research response, which has begun to provide answers as to why this virus transitioned from obscurity to notoriety. The scientific community is now answering questions related to viral evolution, structure and function, virulence, tropism and immune evasion, which begin to explain how ZIKV causes congenital disease. Unanswered questions remain with regard to transmission dynamics, viral persistence, cross-immunity with related viruses, as well as the neurodevelopmental sequelae of congenital infection. Although the last year has seen a waning of ZIKV cases, our new knowledge of ZIKV biology has informed the development of candidate vaccines and therapies, which will hopefully be implemented before a new epidemic. The lessons we have learned from ZIKV may be applicable to other viruses that cause future unanticipated clinical syndromes.

Weaver, S. C. et al. Zika virus: history, emergence, biology, and prospects for control. Antiviral Res . 130 , 69–80 (2016).

Article   PubMed   PubMed Central   CAS   Google Scholar  

Duffy, M. R. et al. Zika virus outbreak on Yap Island, Federated States of Micronesia. N. Engl. J. Med . 360 , 2536–2543 (2009).

Article   PubMed   CAS   Google Scholar  

Musso, D. et al. Zika virus in French Polynesia 2013–14: anatomy of a completed outbreak. Lancet Infect. Dis . 18 , e172–e182 (2018).

Article   PubMed   Google Scholar  

Metsky, H. C. et al. Zika virus evolution and spread in the Americas. Nature 546 , 411–415 (2017).

Article   ADS   PubMed   PubMed Central   CAS   Google Scholar  

Netto, E. M. et al. High Zika virus seroprevalence in Salvador, northeastern Brazil limits the potential for further outbreaks. MBio 8 , e01390-17 (2017).

Article   PubMed   PubMed Central   Google Scholar  

Annamalai, A. S. et al. Zika virus encoding non-glycosylated envelope protein is attenuated and defective in neuroinvasion. J. Virol . e01348-17 (2017).

Barba-Spaeth, G. et al. Structural basis of potent Zika–dengue virus antibody cross-neutralization. Nature 536 , 48–53 (2016).

Article   ADS   PubMed   CAS   Google Scholar  

Fernandez, E. et al. Human antibodies to the dengue virus E-dimer epitope have therapeutic activity against Zika virus infection. Nat. Immunol . 18 , 1261–1269 (2017).

Culshaw, A., Mongkolsapaya, J. & Screaton, G. R. The immunopathology of dengue and Zika virus infections. Curr. Opin. Immunol . 48 , 1–6 (2017).

Faria, N. R. et al. Zika virus in the Americas: early epidemiological and genetic findings. Science 352 , 345–349 (2016). Key phylogenetic analysis of ZIKV entry into the Americas .

Prasad, V. M. et al. Structure of the immature Zika virus at 9 Å resolution. Nat. Struct. Mol. Biol . 24 , 184–186 (2017).

Kostyuchenko, V. A. et al. Structure of the thermally stable Zika virus. Nature 533 , 425–428 (2016).

Sirohi, D. et al. The 3.8 Å resolution cryo-EM structure of Zika virus. Science 352 , 467–470 (2016). Two papers 12 , 13 provide high-resolution cryo-EM structures of ZIKV .

Rey, F. A., Stiasny, K. & Heinz, F. X. Flavivirus structural heterogeneity: implications for cell entry. Curr. Opin. Virol . 24 , 132–139 (2017

Aubry, M. et al. Zika virus seroprevalence, French Polynesia, 2014–2015. Emerg. Infect. Dis . 23 , 669–672 (2017).

Swaminathan, S., Schlaberg, R., Lewis, J., Hanson, K. E. & Couturier, M. R. Fatal Zika virus infection with secondary nonsexual transmission. N. Engl. J. Med . 375 , 1907–1909 (2016).

Carteaux, G. et al. Zika virus associated with meningoencephalitis. N. Engl. J. Med . 374 , 1595–1596 (2016).

Karimi, O. et al. Thrombocytopenia and subcutaneous bleedings in a patient with Zika virus infection. Lancet 387 , 939–940 (2016).

Dirlikov, E. et al. Postmortem findings in patient with Guillain–Barré syndrome and Zika virus infection. Emerg. Infect. Dis . 24 , 114–117 (2018).

Styczynski, A. R. et al. Increased rates of Guillain–Barré syndrome associated with Zika virus outbreak in the Salvador metropolitan area, Brazil. PLoS Negl. Trop. Dis . 11 , e0005869 (2017).

Murray, K. O. et al. Prolonged detection of Zika virus in vaginal secretions and whole blood. Emerg. Infect. Dis . 23 , 99–101 (2017).

Mansuy, J. M. et al. Zika Virus infection and prolonged viremia in whole-blood specimens. Emerg. Infect. Dis . 23 , 863–865 (2017).

Michlmayr, D., Andrade, P., Gonzalez, K., Balmaseda, A. & Harris, E. CD14 + CD16 + monocytes are the main target of Zika virus infection in peripheral blood mononuclear cells in a paediatric study in Nicaragua. Nat. Microbiol . 2 , 1462–1470 (2017).

Miner, J. J. et al. Zika virus infection in mice causes panuveitis with shedding of virus in tears. Cell Rep . 16 , 3208–3218 (2016).

Kodati, S. et al. Bilateral posterior uveitis associated with Zika virus infection. Lancet 389 , 125–126 (2017).

Parke, D. W., III et al. Serologically confirmed Zika-related unilateral acute maculopathy in an adult. Ophthalmology 123 , 2432–2433 (2016).

Tan, J. J. L. et al. Persistence of Zika virus in conjunctival fluid of convalescence patients. Sci. Rep . 7 , 11194 (2017).

Mansuy, J. M. et al. Zika virus in semen and spermatozoa. Lancet Infect. Dis . 16 , 1106–1107 (2016).

Mead, P. S. et al. Zika virus shedding in semen of symptomatic infected men. N. Engl. J. Med . 378 , 1377–1385 (2018).

Hirsch, A. J. et al. Zika virus infection of rhesus macaques leads to viral persistence in multiple tissues. PLoS Pathog . 13 , e1006219 (2017).

Govero, J. et al. Zika virus infection damages the testes in mice. Nature 540 , 438–442 (2016).

Ma, W. et al. Zika virus causes testis damage and leads to male infertility in mice. Cell 167 , 1511–1524 (2016).

Joguet, G. et al. Effect of acute Zika virus infection on sperm and virus clearance in body fluids: a prospective observational study. Lancet Infect. Dis . 17 , 1200–1208 (2017).

Russell, K. et al. Male-to-female sexual transmission of Zika virus—United States, January–April 2016. Clin. Infect. Dis . 64 , 211–213 (2017).

Deckard, D. T. et al. Male-to-male sexual transmission of Zika virus—Texas, January 2016. MMWR Morb. Mortal. Wkly Rep . 65 , 372–374 (2016).

Oehler, E. et al. Zika virus infection complicated by Guillain–Barré syndrome—case report, French Polynesia, December 2013. Euro Surveill . 19 , 20720 (2014).

Parra, B. et al. Guillain–Barré syndrome associated with Zika virus infection in Colombia. N. Engl. J. Med . 375 , 1513–1523 (2016).

dos Santos, T. et al. Zika virus and the Guillain–Barré Syndrome — case series from seven countries. N. Engl. J. Med . 375 , 1598–1601 (2016). Description of ZIKV-associated Guillain–Barré Syndrome in the Americas .

Dirlikov, E. et al. Acute Zika virus infection as a risk factor for Guillain–Barré syndrome in Puerto Rico. J. Am. Med. Assoc . 318 , 1498–1500 (2017).

Article   Google Scholar  

Arora, N., Sadovsky, Y., Dermody, T. S. & Coyne, C. B. Microbial vertical transmission during human pregnancy. Cell Host Microbe 21 , 561–567 (2017).

Article   PubMed   CAS   PubMed Central   Google Scholar  

Miner, J. J. et al. Zika virus infection during pregnancy in mice causes placental damage and fetal demise. Cell 165 , 1081–1091 (2016). Establishment of a mouse model of the fetal injury caused by ZIKV .

Sheridan, M. A. et al. Vulnerability of primitive human placental trophoblast to Zika virus. Proc. Natl Acad. Sci. USA 114 , E1587–E1596 (2017).

Bayer, A. et al. Type III interferons produced by human placental trophoblasts confer protection against Zika virus infection. Cell Host Microbe 19 , 705–712 (2016).

Jagger, B. W. et al. Gestational Stage and IFN-λ signaling regulate ZIKV infection in utero. Cell Host Microbe 22 , 366–376 (2017).

Quicke, K. M. et al. Zika virus infects human placental macrophages. Cell Host Microbe 20 , 83–90 (2016).

Richard, A. S. et al. AXL-dependent infection of human fetal endothelial cells distinguishes Zika virus from other pathogenic flaviviruses. Proc. Natl Acad. Sci. USA 114 , 2024–2029 (2017).

Martines, R. B. et al. Pathology of congenital Zika syndrome in Brazil: a case series. Lancet 388 , 898–904 (2016).

Platt, D. J. et al. Zika virus-related neurotropic flaviviruses infect human placental explants and cause fetal demise in mice. Sci. Transl. Med . 10 , eaao7090 (2018).

Delaney, A. et al. Population-Based surveillance of birth defects potentially related to Zika virus infection — 15 States and U.S. Territories, 2016. MMWR Morb. Mortal. Wkly Rep . 67 , 91–96 (2018).

Li, H., Saucedo-Cuevas, L., Shresta, S. & Gleeson, J. G. The neurobiology of Zika virus. Neuron 92 , 949–958 (2016).

Tang, H. et al. Zika virus infects human cortical neural progenitors and attenuates their growth. Cell Stem Cell 18 , 587–590 (2016). Key paper describing ZIKV infection and injury of neuroprogenitor cells .

Lum, F. M. et al. Zika virus infects human fetal brain microglia and induces inflammation. Clin. Infect. Dis . 64 , 914–920 (2017).

Meertens, L. et al. Axl mediates ZIKA virus entry in human glial cells and modulates innate immune responses. Cell Rep . 18 , 324–333 (2017).

Retallack, H. et al. Zika virus cell tropism in the developing human brain and inhibition by azithromycin. Proc. Natl Acad. Sci. USA 113 , 14408–14413 (2016).

Brasil, P. et al. Zika virus infection in pregnant women in Rio de Janeiro. N. Engl. J. Med . 375 , 2321–2334 (2016). Study describing the effects of ZIKV during pregnancy in Brazil .

Cauchemez, S. et al. Association between Zika virus and microcephaly in French Polynesia, 2013–15: a retrospective study. Lancet 387 , 2125–2132 (2016).

Shapiro-Mendoza, C. K. et al. Pregnancy outcomes after maternal Zika virus infection during pregnancy — U.S. Territories, January 1, 2016–April 25, 2017. MMWR Morb. Mortal. Wkly Rep . 66 , 615–621 (2017).

Moura da Silva, A. A. et al. Early growth and neurologic outcomes of infants with probable congenital Zika virus syndrome. Emerg. Infect. Dis . 22 , 1953–1956 (2016).

Satterfield-Nash, A. et al. Health and development at age 19–24 months of 19 children who were born with microcephaly and laboratory evidence of congenital Zika virus infection during the 2015 Zika virus outbreak — Brazil, 2017. MMWR Morb. Mortal. Wkly Rep . 66 , 1347–1351 (2017).

Lazear, H. M. et al. A mouse model of Zika virus pathogenesis. Cell Host Microbe 19 , 720–730 (2016).

Honein, M. A. et al. Birth defects among fetuses and infants of US women with evidence of possible Zika virus infection during pregnancy. J. Am. Med. Assoc . 317 , 59–68 (2017).

Cugola, F. R. et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature 534 , 267–271 (2016). Establishment of a mouse model of fetal injury and microcephaly caused by ZIKV infection .

Xavier-Neto, J. et al. Hydrocephalus and arthrogryposis in an immunocompetent mouse model of ZIKA teratogeny: a developmental study. PLoS Negl. Trop. Dis . 11 , e0005363 (2017).

Vermillion, M. S. et al. Intrauterine Zika virus infection of pregnant immunocompetent mice models transplacental transmission and adverse perinatal outcomes. Nat. Commun . 8 , 14575 (2017).

Szaba, F. M. et al. Zika virus infection in immunocompetent pregnant mice causes fetal damage and placental pathology in the absence of fetal infection. PLoS Pathog . 14 , e1006994 (2018).

Li, C. et al. Zika virus disrupts neural progenitor development and leads to microcephaly in mice. Cell Stem Cell 19 , 120–126 (2016).

Yockey, L. J. et al. Vaginal exposure to Zika virus during pregnancy leads to fetal brain infection. Cell 166 , 1247–1256 (2016). Animal study showing that intravaginal transmission of ZIKV can result in fetal brain injury .

Gorman, M. J. et al. An immunocompetent mouse model of Zika virus infection. Cell Host Microbe 23 , 672–685 (2018).

Dudley, D. M. et al. A rhesus macaque model of Asian-lineage Zika virus infection. Nat. Commun . 7 , 12204 (2016).

Osuna, C. E. et al. Zika viral dynamics and shedding in rhesus and cynomolgus macaques. Nat. Med . 22 , 1448–1455 (2016).

Aliota, M. T. et al. Heterologous protection against Asian Zika virus challenge in rhesus macaques. PLoS Negl. Trop. Dis . 10 , e0005168 (2016).

Koide, F. et al. Development of a Zika virus infection model in cynomolgus macaques. Front. Microbiol . 7 , 2028 (2016).

Chiu, C. Y. et al. Experimental Zika virus inoculation in a new world monkey model reproduces key features of the human infection. Sci. Rep . 7 , 17126 (2017).

Li, X. F. et al. Characterization of a 2016 clinical isolate of Zika virus in non-human primates. EBioMedicine 12 , 170–177 (2016).

McCracken, M. K. et al. Impact of prior flavivirus immunity on Zika virus infection in rhesus macaques. PLoS Pathog . 13 , e1006487 (2017).

George, J. et al. Prior exposure to Zika virus significantly enhances peak dengue-2 viremia in rhesus macaques. Sci. Rep . 7 , 10498 (2017).

Driggers, R. W. et al. Zika virus infection with prolonged maternal viremia and fetal brain abnormalities. N. Engl. J. Med . 374 , 2142–2151 (2016).

Adams Waldorf, K. M. et al. Fetal brain lesions after subcutaneous inoculation of Zika virus in a pregnant nonhuman primate. Nat. Med . 22 , 1256–1259 (2016).

Nguyen, S. M. et al. Highly efficient maternal–fetal Zika virus transmission in pregnant rhesus macaques. PLoS Pathog . 13 , e1006378 (2017).

Martinot, A. J. et al. Fetal neuropathology in Zika virus-infected pregnant female rhesus monkeys. Cell 173 , 1111–1122 (2018).

Dudley, D. M. et al. Miscarriage and stillbirth following maternal Zika virus infection in nonhuman primates. Nat. Med . (2018).

Morrison, T. E. & Diamond, M. S. Animal models of Zika virus infection, pathogenesis, and immunity. J. Virol . 91 , e00009-17 (2017).

Abbink, P. et al. Therapeutic and protective efficacy of a dengue antibody against Zika infection in rhesus monkeys. Nat. Med . 24 , 721–723 (2018).

Mavigner, M. et al. Postnatal Zika virus infection is associated with persistent abnormalities in brain structure, function, and behavior in infant macaques. Sci. Transl. Med . 10 , eaao6975 (2018).

Rossi, S. L. et al. Characterization of a novel murine model to study Zika virus. Am. J. Trop. Med. Hyg . 94 , 1362–1369 (2016).

Tripathi, S. et al. A novel Zika virus mouse model reveals strain specific differences in virus pathogenesis and host inflammatory immune responses. PLoS Pathog . 13 , e1006258 (2017).

Savidis, G. et al. The IFITMs inhibit Zika virus replication. Cell Rep . 15 , 2323–2330 (2016).

Monel, B. et al. Zika virus induces massive cytoplasmic vacuolization and paraptosis-like death in infected cells. EMBO J . 36 , 1653–1668 (2017).

Van der Hoek, K. H. et al. Viperin is an important host restriction factor in control of Zika virus infection. Sci. Rep . 7 , 4475 (2017).

Bowen, J. R. et al. Zika virus antagonizes type I interferon responses during infection of human dendritic cells. PLoS Pathog . 13 , e1006164 (2017).

Sun, X. et al. Transcriptional changes during naturally acquired Zika virus infection render dendritic cells highly conducive to viral replication. Cell Rep . 21 , 3471–3482 (2017).

Grant, A. et al. Zika virus targets human STAT2 to inhibit type I interferon signaling. Cell Host Microbe 19 , 882–890 (2016). A study that explains in part how ZIKV evades the interferon response in humans but not mice .

Kumar, A. et al. Zika virus inhibits type-I interferon production and downstream signaling. EMBO Rep . 17 , 1766–1775 (2016).

Ding, Q. et al. Species-specific disruption of STING-dependent antiviral cellular defenses by the Zika virus NS2B3 protease. Proc. Natl Acad. Sci. USA 115 , E6310–E6318 (2018).

Xia, H. et al. An evolutionary NS1 mutation enhances Zika virus evasion of host interferon induction. Nat. Commun . 9 , 414 (2018).

Donald, C. L. et al. Full genome sequence and sfRNA Interferon antagonist activity of Zika virus from Recife, Brazil. PLoS Negl. Trop. Dis . 10 , e0005048 (2016).

Zhu, Z. et al. Zika virus has oncolytic activity against glioblastoma stem cells. J. Exp. Med . 214 , 2843–2857 (2017).

Khan, S. et al. Dampened antiviral immunity to intravaginal exposure to RNA viral pathogens allows enhanced viral replication. J. Exp. Med . 213 , 2913–2929 (2016).

Rogers, T. F. et al. Zika virus activates de novo and cross-reactive memory B cell responses in dengue-experienced donors. Sci. Immunol . 2 , eaan6809 (2017).

Ricciardi, M. J. et al. Ontogeny of the B- and T-cell response in a primary Zika virus infection of a dengue-naïve individual during the 2016 outbreak in Miami, FL. PLoS Negl. Trop. Dis . 11 , e0006000 (2017).

Dowd, K. A. et al. Broadly neutralizing activity of Zika virus–immune sera identifies a single viral serotype. Cell Rep . 16 , 1485–1491 (2016).

Priyamvada, L., Suthar, M. S., Ahmed, R. & Wrammert, J. Humoral immune responses against Zika virus infection and the importance of preexisting flavivirus immunity. J. Infect. Dis . 216 , S906–S911 (2017).

Stettler, K. et al. Specificity, cross-reactivity, and function of antibodies elicited by Zika virus infection. Science 353 , 823–826 (2016).

Sapparapu, G. et al. Neutralizing human antibodies prevent Zika virus replication and fetal disease in mice. Nature 540 , 443–447 (2016). First two papers 103 , 104 describing neutralizing human monoclonal antibodies against ZIKV .

Lai, L. et al. Innate, T-, and B-cell responses in acute human Zika patients. Clin. Infect. Dis . 66 , 1–10 (2018).

Priyamvada, L. et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proc. Natl Acad. Sci. USA 113 , 7852–7857 (2016).

Zhao, H. et al. Structural basis of Zika virus-specific antibody protection. Cell 166 , 1016–1027 (2016).

Swanstrom, J. A. et al. Dengue Virus envelope dimer epitope monoclonal antibodies isolated from dengue patients are protective against Zika virus. MBio 7 , e01123-16 (2016).

Collins, M. H. et al. Lack of durable cross-neutralizing antibodies against Zika virus from dengue virus infection. Emerg. Infect. Dis . 23 , 773–781 (2017).

Rouvinski, A. et al. Recognition determinants of broadly neutralizing human antibodies against dengue viruses. Nature 520 , 109–113 (2015).

Wang, J. et al. A Human bi-specific antibody against Zika virus with high therapeutic potential. Cell 171 , 229–241 (2017).

Yu, L. et al. Delineating antibody recognition against Zika virus during natural infection. JCI Insight 2 , 93042 (2017).

Wang, Q. et al. Molecular determinants of human neutralizing antibodies isolated from a patient infected with Zika virus. Sci. Transl. Med . 8 , 369ra179 (2016).

Pardy, R. D. et al. Analysis of the T cell response to Zika virus and identification of a novel CD8 + T cell epitope in immunocompetent mice. PLoS Pathog . 13 , e1006184 (2017).

Elong Ngono, A. et al. Mapping and role of the CD8 + T cell response during primary Zika virus infection in mice. Cell Host Microbe 21 , 35–46 (2017).

Huang, H. et al. CD8 + T cell immune response in immunocompetent mice during Zika virus infection. J. Virol . 91 , e00900-17 (2017).

Wen, J. et al. Identification of Zika virus epitopes reveals immunodominant and protective roles for dengue virus cross-reactive CD8 + T cells. Nat. Microbiol . 2 , 17036 (2017).

Manangeeswaran, M., Ireland, D. D. & Verthelyi, D. Zika (PRVABC59) infection is associated with T cell infiltration and neurodegeneration in CNS of immunocompetent neonatal C57BL/6 mice. PLoS Pathog . 12 , e1006004 (2016).

Jurado, K. A. et al. Antiviral CD8 T cells induce Zika-virus-associated paralysis in mice. Nat. Microbiol . 3 , 141–147 (2018).

Cimini, E. et al. Human Zika infection induces a reduction of IFN-γ producing CD4 T-cells and a parallel expansion of effector Vδ2 T-cells. Sci. Rep . 7 , 6313 (2017).

Grifoni, A. et al. Prior Dengue virus exposure shapes T cell immunity to Zika virus in humans. J. Virol . e01469-17 (2017).

Weiskopf, D. et al. Comprehensive analysis of dengue virus-specific responses supports an HLA-linked protective role for CD8 + T cells. Proc. Natl Acad. Sci. USA 110 , E2046–E2053 (2013). (2013).

Liu, Y. et al. Evolutionary enhancement of Zika virus infectivity in Aedes aegypti mosquitoes. Nature 545 , 482–486 (2017).

Yuan, L. et al. A single mutation in the prM protein of Zika virus contributes to fetal microcephaly. Science 358 , 933–936 (2017). Two papers 123 , 124 describe the genetic changes in epidemic ZIKV strains that may explain altered epidemiology and pathogenicity .

Klase, Z. A. et al. Zika fetal neuropathogenesis: etiology of a viral syndrome. PLoS Negl. Trop. Dis . 10 , e0004877 (2016).

Chavali, P. L. et al. Neurodevelopmental protein Musashi-1 interacts with the Zika genome and promotes viral replication. Science 357 , 83–88 (2017).

Dejnirattisai, W. et al. Dengue virus sero-cross-reactivity drives antibody-dependent enhancement of infection with Zika virus. Nat. Immunol . 17 , 1102–1108 (2016).

Bardina, S. V. et al. Enhancement of Zika virus pathogenesis by preexisting antiflavivirus immunity. Science 356 , 175–180 (2017).

Terzian, A. C. B. et al. Viral load and cytokine response profile does not support antibody-dependent enhancement in dengue-primed Zika virus-infected patients. Clin. Infect. Dis . 65 , 1260–1265 (2017).

Halai, U. A. et al. Maternal Zika virus disease severity, virus load, prior dengue antibodies, and their relationship to birth outcomes. Clin. Infect. Dis . 65 , 877–883 (2017).

Dowd, K. A. et al. Rapid development of a DNA vaccine for Zika virus. Science 354 , 237–240 (2016).

ADS   PubMed   PubMed Central   CAS   Google Scholar  

Tebas, P. et al. Safety and immunogenicity of an anti-Zika virus DNA vaccine — preliminary report. N. Engl. J. Med . https://doi.org/10.1056/NEJMoa1708120 (2017).

Abbink, P. et al. Protective efficacy of multiple vaccine platforms against Zika virus challenge in rhesus monkeys. Science 353 , 1129–1132 (2016).

Larocca, R. A. et al. Vaccine protection against Zika virus from Brazil. Nature 536 , 474–478 (2016).

Gaudinski, M. R. et al. Safety, tolerability, and immunogenicity of two Zika virus DNA vaccine candidates in healthy adults: randomised, open-label, phase 1 clinical trials. Lancet 391 , 552–562 (2018). Five papers 131 , 132 , 133 , 134 , – 135 describe the DNA and inactivated vaccine platforms under development against ZIKV .

Pardi, N. et al. Zika virus protection by a single low-dose nucleoside-modified mRNA vaccination. Nature 543 , 248–251 (2017).

Richner, J. M. et al. Modified mRNA vaccines protect against Zika virus infection. Cell 168 , 1114–1125 (2017).

Richner, J. M. et al. Vaccine mediated protection against Zika virus-induced congenital disease. Cell 170 , 273–283 (2017). Three papers 136 , 137 , – 138 describe the use of mRNA-based vaccines against ZIKV .

Abbink, P. et al. Durability and correlates of vaccine protection against Zika virus in rhesus monkeys. Sci. Transl. Med . 9 , eaao4163 (2017).

Xie, X. et al. Understanding Zika virus stability and developing a chimeric vaccine through functional analysis. MBio 8 , e02134-16 (2017).

Shan, C. et al. A live-attenuated Zika virus vaccine candidate induces sterilizing immunity in mouse models. Nat. Med . 23 , 763–767 (2017).

Shan, C. et al. A single-dose live-attenuated vaccine prevents Zika virus pregnancy transmission and testis damage. Nat. Commun . 8 , 676 (2017).

Betancourt, D., de Queiroz, N. M., Xia, T., Ahn, J. & Barber, G. N. Cutting edge: innate immune augmenting vesicular stomatitis virus expressing Zika virus proteins confers protective immunity. J. Immunol . 198 , 3023–3028 (2017).

Prow, N. A. et al. A vaccinia-based single vector construct multi-pathogen vaccine protects against both Zika and chikungunya viruses. Nat. Commun . 9 , 1230 (2018).

Brault, A. C. et al. A Zika vaccine targeting NS1 protein protects immunocompetent adult mice in a lethal challenge model. Sci. Rep . 7 , 14769 (2017).

Salvo, M. A., Kingstad-Bakke, B., Salas-Quinchucua, C., Camacho, E. & Osorio, J. E. Zika virus like particles elicit protective antibodies in mice. PLoS Negl. Trop. Dis . 12 , e0006210 (2018).

Bayer, A. et al. Chromosome 19 microRNAs exert antiviral activity independent from type III interferon signaling. Placenta 61 , 33–38 (2018).

Download references

Acknowledgements

This work was supported by NIH grants (R01 AI073755, R01 AI104972, U19 AI083019 and R01 HD091218) and by the Division of Intramural Research, National Institute of Allergy and Infectious Diseases, NIH. We thank E. Tyler (NIH) for assistance with figure preparation of virion models. This publication is the responsibility of the authors and does not necessarily represent the official view of the NIH.

Reviewer information

Nature thanks J. Jung and H. Tang for their contribution to the peer review of this work.

Author information

Authors and affiliations.

Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA

Theodore C. Pierson

Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA

Michael S. Diamond

Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, MO, USA

Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, MO, USA

Andrew M. and Jane M. Bursky Center for Human Immunology and Immunotherapy Programs, Washington University School of Medicine, St. Louis, MO, USA

You can also search for this author in PubMed   Google Scholar

Contributions

T.C.P. and M.S.D. conceived and wrote the review.

Corresponding authors

Correspondence to Theodore C. Pierson or Michael S. Diamond .

Ethics declarations

Competing interests.

M.S.D. is a consultant for Inbios and on the Scientific Advisory Board of Moderna. T.C.P. is a co-inventor of NIAID ZIKV vaccine candidates.

Additional information

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Reprints and permissions

About this article

Cite this article.

Pierson, T.C., Diamond, M.S. The emergence of Zika virus and its new clinical syndromes. Nature 560 , 573–581 (2018). https://doi.org/10.1038/s41586-018-0446-y

Download citation

Received : 03 February 2018

Accepted : 19 July 2018

Published : 29 August 2018

Issue Date : 30 August 2018

DOI : https://doi.org/10.1038/s41586-018-0446-y

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Development of a quantitative ns1 antigen enzyme-linked immunosorbent assay (elisa) for zika virus detection using a novel virus-specific mab.

• Stefanny Viloche Morales
• Gabriela Mattoso Coelho
• Claudia Nunes Duarte dos Santos

Scientific Reports (2024)

Defined microbial communities and their soluble products protect mice from Clostridioides difficile infection

• Katya Douchant
• Mabel Guzman

Communications Biology (2024)

Laboratory diagnosis of CNS infections in children due to emerging and re-emerging neurotropic viruses

• Benjamin M. Liu
• Sarah B. Mulkey
• Roberta L. DeBiasi

Pediatric Research (2024)

Nuclear membrane protein SUN2 promotes replication of flaviviruses through modulating cytoskeleton reorganization mediated by NS1

• Yanxia Huang

Nature Communications (2024)

Flavivirus prM interacts with MDA5 and MAVS to inhibit RLR antiviral signaling

• Yinghua Zhao

Cell & Bioscience (2023)

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Fact sheets

• Facts in pictures
• Publications
• Questions and answers
• Tools and toolkits
• HIV and AIDS
• Hypertension
• Mental disorders
• Top 10 causes of death
• All countries
• Eastern Mediterranean
• South-East Asia
• Western Pacific
• Data by country
• Country presence 
• Country strengthening 
• Country cooperation strategies 
• News releases
• Feature stories
• Press conferences
• Commentaries
• Photo library
• Afghanistan
• Cholera 
• Coronavirus disease (COVID-19)
• Greater Horn of Africa
• Israel and occupied Palestinian territory
• Disease Outbreak News
• Situation reports
• Weekly Epidemiological Record
• Surveillance
• Health emergency appeal
• International Health Regulations
• Independent Oversight and Advisory Committee
• Classifications
• Data collections
• Global Health Estimates
• Mortality Database
• Sustainable Development Goals
• Health Inequality Monitor
• Global Progress
• Data collection tools
• Global Health Observatory
• Insights and visualizations
• COVID excess deaths
• World Health Statistics
• Partnerships
• Committees and advisory groups
• Collaborating centres
• Technical teams
• Organizational structure
• Initiatives
• General Programme of Work
• WHO Academy
• Investment in WHO
• WHO Foundation
• External audit
• Financial statements
• Internal audit and investigations 
• Programme Budget
• Results reports
• Governing bodies
• World Health Assembly
• Executive Board
• Member States Portal
• Fact sheets /
• Zika virus is transmitted primarily by Aedes mosquitoes, which bite mostly during the day.
• Most people with Zika virus infection do not develop symptoms; those who do typically have symptoms including rash, fever, conjunctivitis, muscle and joint pain, malaise and headache that last for 2–7 days.
• Zika virus infection during pregnancy can cause infants to be born with microcephaly and other congenital malformations as well as preterm birth and miscarriage.
• Zika virus infection is associated with Guillain-Barré syndrome, neuropathy and myelitis in adults and children.
• In February 2016, WHO declared Zika-related microcephaly a Public Health Emergency of International Concern (PHEIC), and the causal link between the Zika virus and congenital malformations was confirmed. WHO declared the end of the PHEIC in November of the same year.
• Although cases of Zika virus disease declined from 2017 onwards globally, transmission persists at low levels in several countries in the Americas and other endemic regions.

Zika virus is a mosquito-borne virus first identified in Uganda in 1947 in a Rhesus macaque monkey followed by evidence of infection and disease in humans in other African countries in the 1950s.

From the 1960s to 1980s, sporadic human infections were detected across Africa and Asia. However, since 2007 outbreaks of Zika virus disease have been recorded in Africa, the Americas, Asia and the Pacific.

In outbreaks over the last decade Zika virus infection was found to be associated with increased incidence of Guillain-Barré syndrome. When Zika virus emerged in the Americas, with a large epidemic in Brazil in 2015, an association between Zika virus infection and microcephaly (smaller than normal head size) was first described; there were similar findings in French Polynesia upon retrospective review. From February to November 2016, WHO declared a Public Health Emergency of International Concern (PHEIC) regarding microcephaly, other neurological disorders and Zika virus, and the causal link between Zika virus and congenital malformations was soon confirmed (1,2) . Outbreaks of Zika virus disease were identified throughout most of the Americas and in other regions with established Aedes aegypti mosquitos. Infections were detected in travellers from active transmission areas and sexual transmission was confirmed as an alternate route of Zika virus infection.

Cases of Zika virus disease globally declined from 2017 onwards; however, Zika virus transmission persists at low levels in several countries in the Americas and in other endemic regions. In addition, the first local mosquito-transmitted Zika virus disease cases were reported in Europe in 2019 and Zika virus outbreak activity was detected in India in 2021. To date, a total of 89 countries and territories have reported evidence of mosquito transmitted Zika virus infection; however, surveillance remains limited globally. 

• Zika epidemiology update (February 2022)
• History of Zika virus

Most people infected with Zika virus do not develop symptoms. Among those who do, they typically start 3–14 days after infection, are generally mild including rash, fever, conjunctivitis, muscle and joint pain, malaise and headache, and usually last for 2 – 7 days. These symptoms are common to other arboviral and non-arboviral diseases; thus, the diagnosis of Zika virus infection requires laboratory confirmation.

Complications

Zika virus infection during pregnancy is a cause of microcephaly and other congenital malformations in the infant, including limb contractures, high muscle tone, eye abnormalities and hearing loss. These clinical features are collectively referred to as congenital Zika syndrome.

The risk of congenital malformations following infection in pregnancy remains unknown; an estimated 5–15% of infants born to women infected with Zika virus during pregnancy have evidence of Zika-related complications (3) . Congenital malformations occur following both symptomatic and asymptomatic infection. Zika infection in pregnancy can also cause complications such as fetal loss, stillbirth and preterm birth.  

Zika virus infection can also cause Guillain-Barré syndrome, neuropathy and myelitis, particularly in adults and older children.

Research is ongoing to investigate the risk and effects of Zika virus infection on pregnancy outcomes, strategies for prevention and control, and effects of infection on other neurological disorders in children and adults.

• Questions and answers: Zika virus and complications

Transmission

Zika virus is primarily transmitted by infected mosquitoes of the  Aedes  ( Stegomyia ) genus, mainly  Aedes aegypti , in tropical and subtropical regions.  Aedes  mosquitoes usually bite during the day. These mosquitoes also transmit dengue, chikungunya and urban yellow fever.

Zika virus is also transmitted from mother to fetus during pregnancy, as well as through sexual contact, transfusion of blood and blood products, and possibly through organ transplantation.

Infection with Zika virus may be suspected based on symptoms of persons living in or visiting areas with Zika virus transmission and/or  Aedes  mosquito vectors. A diagnosis of Zika virus infection can only be confirmed by laboratory tests of blood or other body fluids, and it must be differentiated from cross-reactive related flaviviruses such as dengue virus, to which the patient may have been exposed or previously vaccinated.

• Laboratory testing for Zika virus and dengue virus infections

There is no specific treatment available for Zika virus infection or disease.

People with symptoms such as rash, fever or joint pain should get plenty of rest, drink fluids, and treat symptoms with antipyretics and/or analgesics. Nonsteroidal anti-inflammatory drugs should be avoided until dengue virus infections are ruled out because of bleeding risk. If symptoms worsen, patients should seek medical care and advice.

Pregnant women living in areas with Zika transmission or who develop symptoms of Zika virus infection should seek medical attention for laboratory testing, information, counselling and other clinical care.  

No vaccine is yet available for the prevention or treatment of Zika virus infection. Development of a Zika vaccine remains an active area of research.

Mosquito bites

Protection against mosquito bites during the day and early evening is a key measure to prevent Zika virus infection, especially among pregnant women, women of reproductive age and young children.

Personal protection measures include wearing clothing (preferably light-coloured) that covers as much of the body as possible; using physical barriers such as window screens and closed doors and windows; and applying insect repellent to skin or clothing that contains DEET, IR3535 or icaridin according to the product label instructions.

Young children and pregnant women should sleep under mosquito nets if sleeping during the day or early evening. Travellers and those living in affected areas should take the same basic precautions described above to protect themselves from mosquito bites.

Aedes  mosquitoes breed in small collections of water around homes, schools and work sites. It is important to eliminate these mosquito breeding sites, including covering water storage containers, removing standing water in flowerpots, and cleaning up trash and used tires. Community initiatives are essential to support local government and public health programs to reduce mosquito breeding sites. Health authorities may also advise use of larvicides and insecticides to reduce mosquito populations and disease spread.

• Vector control operations framework for Zika virus

Prevention of sexual transmission

For regions with active transmission of Zika virus, all people with Zika virus infection and their sexual partners (particularly pregnant women) should receive information about the risks of sexual transmission of Zika virus.

WHO recommends that sexually active men and women be counselled and offered a full range of contraceptive methods to be able to make an informed choice about whether and when to become pregnant in order to prevent possible adverse pregnancy and fetal outcomes.

Women who have had unprotected sex and do not wish to become pregnant due to concerns about Zika virus infection should have ready access to emergency contraceptive services and counselling. Pregnant women should practice safer sex (including correct and consistent use of condoms) or abstain from sexual activity for at least the entire duration of pregnancy.

For regions with no active transmission of Zika virus, WHO recommends practicing safer sex or abstinence for a period of three months for men and two months for women who are returning from areas of active Zika virus transmission to prevent infection of their sex partners. Sexual partners of pregnant women living in or returning from areas where local transmission of Zika virus occurs should practice safer sex or abstain from sexual activity throughout pregnancy.

• Prevention of sexual transmission of Zika virus

WHO response

WHO supports countries to conduct surveillance and control of arboviruses through the implementation of the Global Arbovirus Initiative , which is aligned with and expands upon recommendations laid out in the Zika Strategic Response Plan .

WHO responds to Zika in the following ways:

• supporting countries in the confirmation of outbreaks through its collaborating network of laboratories;
• providing technical support and guidance to countries for the effective management of mosquito-borne disease outbreaks;
• reviewing the development of new tools, including insecticide products and application technologies;
• formulating evidence-based strategies, policies, and outbreak management plans;
• providing technical support and guidance to countries for the effective management of cases and outbreaks;
• supporting countries to improve their reporting systems;
• providing training on clinical management, diagnosis and vector control at the regional level with some of its collaborating centres; and
• publishing guidelines and handbooks on epidemiological surveillance, laboratory, clinical case management and vector control for Member States.
• de Araújo TVB, Ximenes RA de A, Miranda-Filho D de B, et al. Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study. Lancet Infect Dis . 3099(17)30727-2
• Krauer F, Riesen M, Reveiz L, et al. Zika Virus Infection as a Cause of Congenital Brain Abnormalities and Guillain–Barré Syndrome: Systematic Review. PLoS Med . 2017;14(1). doi:10.1371/journal.pmed.10022
• Musso D, Ko AI, Baud D. Zika Virus Infection – After the Pandemic. N Engl J Med . 2019;381(15). doi:10.1056/nejmra1808246

Zika virus disease

• WHO's work on Zika
• History of Zika
• Zika virus questions and answers
• Zika information for travellers

Microcephaly

• Microcephaly fact sheet
• More on Microcephaly

In Portuguese

• Access resources in Portuguese
• Zika included in the 2018 annual review of the Blueprint list of priority diseases
• Global vector control response 2017-2030

Progress toward discovery of Zika virus vaccines and therapeutics

• Latest News
• Entertainment
• Money Matters
• Writer's Archive
• Oped Opinion Newspost Editorial
• Magazines Instep Money Matters YOU US TNS

Likely cause of 2021 mysterious illness: Researchers finally confirm Zika virus in Pakistan

Zika virus is primarily transmitted by aedes mosquitoes, which bite mostly during the day.

ISLAMABAD: Pakistani researchers at the Aga Khan University have finally solved the mystery behind a ‘dengue-like outbreak’ that gripped Karachi in 2021, saying they identified Zika virus as the cause, circulating in Karachi and other parts of the country, and causing dengue-like symptoms.

“Investigators associated with the United World Antiviral Research Network (UWARN) at the Aga Khan University, Karachi, detected two cases of the Zika virus in 2021 during an outbreak of a mysterious viral illness (following a news story in The News International). These cases were later confirmed through metagenomics at the Gale Lab at the University of Washington, Seattle,” Dr Najeeha Talat Iqbal, Principal Investigator of the UWARN study, told The News on Friday. In November 2021, The News International reported cases of a ‘mysterious viral fever’ in Karachi that behaved like dengue fever, reducing patients’ platelets and white blood cells, yet testing negative for dengue. Following the news, UWARN began its investigation and, in 2021 and 2022, detected two single and two mixed infections of Zika and Dengue confirmed by serology and PCR.

Dr Najeeha Iqbal explained that the UWARN consortium is a multi-center study involving Pakistan, Senegal, South Africa, Brazil, and Taiwan, centrally operated by the University of Washington under Prof Wes Van Voorhis along with Co-Principal Investigators.

“This study aims to characterise new emerging viruses and conduct active surveillance of arboviruses in UWARN centers. AKU has been working with the UWARN network for active surveillance of arboviruses, including Dengue, Chikungunya, and other hemorrhagic viruses,” she said.

She noted that they enrolled patients with acute viral illnesses between the ages of 1 and 75 from AKU wards, outpatient clinics, and physician referrals. In the Arbovirus cohort, 44 patients were enrolled, six of whom were NS1 negative with acute febrile illness, vomiting, and diarrhea. These cases were enrolled between August and November 2021.

“During our study, we confirmed the presence of the Zika virus in Pakistan, which had not been previously detected,” she added.

Confirming the findings, Dr Faisal Mehmood, head of infectious diseases at AKU, said he was aware of the presence and detection of the Zika virus in Pakistan, adding that it is now confirmed that Zika is circulating in the environment in Karachi.

According to the WHO, the Zika virus is primarily transmitted by Aedes mosquitoes, which bite mostly during the day. Most people with Zika virus infection do not develop symptoms; those who do typically experience rash, fever, conjunctivitis, muscle and joint pain, malaise, and headache that last for 2–7 days.

“However, Zika virus infection during pregnancy can cause infants to be born with microcephaly and other congenital malformations, as well as preterm birth and miscarriage,” states the WHO fact sheet on Zika virus, adding that Zika virus infection is associated with Guillain-Barré syndrome, neuropathy, and myelitis in adults and children.

In February 2016, WHO declared Zika-related microcephaly a Public Health Emergency of International Concern (PHEIC), and the causal link between the Zika virus and congenital malformations was confirmed. WHO declared the end of the PHEIC in November of the same year. Although global cases of Zika virus disease declined from 2017 onwards, transmission persists at low levels in several countries in the Americas and other endemic regions.

Meanwhile, officials in the Sindh Health Department reported that hundreds of cases of dengue, chikungunya, and other vector-borne illnesses are being reported in Karachi weekly.

“At least 10 people have died due to Dengue fever since January 2024 in Karachi alone. The number of confirmed dengue cases is in the hundreds, while hundreds have been hospitalized with Chikungunya at various public and private health facilities,” an official claimed.

The official added that he was not aware of the presence of the Zika virus in Karachi, as they had not been officially informed about its presence in Pakistan. However, cases of viral illnesses testing negative for dengue have also been reported at different health facilities.

Officials at the National Institute of Health (NIH) in Islamabad said they were unaware of the presence of the Zika virus in the country, noting that no lab or health institution had formally reported its presence to the NIH.

Asian strain found in city, say ICMR-NIV scientists

Visual Stories

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Iran J Public Health
• v.48(1); 2019 Jan

Zika Virus Infection, Basic and Clinical Aspects: A Review Article

Farshid noorbakhsh.

1. Department of Immunology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Kamal ABDOLMOHAMMADI

2. Department of Immunology, Faculty of Medicine, Kurdistan University of Medical Sciences, Sanandaj, Iran

3. Department of Stem Cell Biology, Stem Cell Technology Research Center, Tehran, Iran

Yousef FATAHI

4. Department of Pharmaceutical Nanotechnology, School of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran

5. Nanotechnology Research Center, School of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran

Hossein DALILI

6. Department of Pediatrics, Breastfeeding Research Center, Tehran University of Medical Sciences, Tehran, Iran

Mehrnaz RASOOLINEJAD

7. Department of Infectious Diseases, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Farshid REZAEI

8. Center for Control of Communicable Diseases, Ministry of Health and Medical Education, Tehran, Iran

Mostafa SALEHI-VAZIRI

9. Department of Arboviruses and Viral Hemorrhagic Fevers (National Reference Laboratory), Pasteur Institute of Iran, Tehran, Iran

Nazanin Zahra SHAFIEI-JANDAGHI

10. Department of Virology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran

Ehsan Shamsi GOOSHKI

11. Department of Medical Ethics, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

12. Medical Ethics and History of Medicine Research Center, Tehran University of Medical Sciences, Tehran, Iran

Morteza ZAIM

13. Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran

Mohammad Hossein NICKNAM

14. Molecular Immunology Research Center, Tehran University of Medical Sciences, Tehran, Iran

Background:

Zika virus infection has recently attracted the attention of medical community. While clinical manifestations of the infection in adult cases are not severe and disease is not associated with high mortality rates, Zika virus infection can have an impact on fetal development and lead to severe neurodevelopmental abnormalities.

To gain insight into different aspects of Zika virus infection, a comprehensive literature review was performed. With regard to epidemiology and geographical distribution of Zika virus infection, relevant information was extracted from CDC and WHO websites.

In this review, we discuss different basic and clinical aspects of Zika virus infection including virology, epidemiology and pathogenesis of disease. Laboratory methods required for the diagnosis of disease together with ethical issues associated with Zika virus infection will also be discussed in detail.

Conclusion:

Herein, we have tried to provide a multi-faceted view of Zika virus infection, with greater emphasis on disease status in Eastern Mediterranean Region.

Introduction

Flaviviruses are responsible for several important human diseases including Dengue, West Nile and Yellow fevers, Japanese encephalitis, Tick-borne encephalitis, and Zika fever. The major route of transmission for most Flaviviruses is through arthropod vectors and central nervous system injury and hemorrhagic fevers represent major clinical outcomes. In recent years, Zika virus infections have attracted the attention of international medical community, chiefly because of their role in causing microcephaly and other neurodevelopmental abnormalities which occur as a consequence of maternal infections ( 1 ).

Zika virus was first isolated in 1947 in the Zika forest in Uganda from a rhesus macaque ( 2 ). Serological studies performed on human serum samples in Uganda later showed the presence of neutralizing antibodies against the virus, providing the first evidence that the virus can infect humans ( 3 ). Later studies revealed the presence of infection in other regions of Africa as well as Asian countries ( 4 ). Until 2007 Zika virus infections were mostly considered an infection of limited geographical distribution; however, later outbreaks of infection in Pacific islands and South America, associated with reports that the virus might cause nervous system abnormalities in newborns attracted the attention of a wide range of people in the scientific community. The situation reached its peak in 2015 when a striking increase occurred in reports of Zika virus infections in Brazil ( 5 ). The outbreak then spread to other countries in South, Central, and North America. The infections were associated with a significant increase in the number of microcephaly and Guillain–Barré syndrome cases in the infected regions, and this led to the declaration of a Public Health Emergency of International Concern (PHEIC) by the WHO in early 2016 ( 6 – 8 ). Since then, a strong international effort has been started to investigate epidemiological, molecular, pathogenic and clinical aspects of Zika virus infections.

In this review, we have discussed the current knowledge about various aspects of Zika virus infection and recent developments including antiviral treatments for this infection. The first four sections of this review cover virology, epidemiology, pathogenesis, and laboratory diagnosis of Zika virus infection. While Zika virus infection is a global concern, in the epidemiology section we have put some more emphasis on findings from Eastern Mediterranean Region (EMRO) countries. Considering the ethical considerations related to feto-maternal and neurodevelopmental dimensions of the Zika virus infection, the final section of this review provides a detailed account of ethical aspects of Zika virus infection ( Fig. 1 ).

Zika virus infection at a glance (Original)

Virology of the Zika virus

Zika virus is a new emerging mosquito-borne virus belonging to the Flaviviridae family of viruses ( 9 ). This family is comprised of 4 genera: Flavivirus, Hepacivirus, Pegivirus, and Pestivirus ( 10 ). Zika virus belongs to the Flavivirus genus, which antigenically and phylogenetically is related to the Spondweni virus ( 9 , 11 ). Many important human pathogens are included in this genus, for instance, Dengue, West Nile, Yellow fever, tick-borne encephalitis, Japanese encephalitis, Murray Valley encephalitis and St. Louis encephalitis viruses. These viruses are associated with a range of infections from asymptomatic or self-limiting febrile infections to some fatal diseases such as hemorrhage, shock, meningitis, and encephalitis ( 12 ).

In Flaviviridae family, all members have enveloped viruses with a single-stranded RNA genome of positive polarity ( 10 ) which contained one open reading frame (ORF) with two flanking noncoding regions (at 5′ and 3′ end) ( 13 ). The genomes are 5′ capped without a 3′ poly (A) tail.

A polyprotein is coded by the ORF then processed into three structural proteins (the envelope (E), the capsid (C) and the precursor of the membrane (prM)) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) ( 1 , 12 ). The ssRNA is held within an icosahedral capsid shaped from 12-kDa protein blocks; the nucleocapsid is surrounded by a host-derived membrane contained two viral glycoproteins ( 14 ).

Similar replication strategies are employed by the members of Flaviviridae family despite significant differences in tissue tropism, transmission, and pathogenesis ( 10 ).

Recent developments in Zika antiviral treatments

At the present time, no effective antiviral treatments are available for Zika virus infection ( 15 ). However, considering rapid geographic expansion of Zika virus, its severe neurological complications and devastating effects on the fetus, investigations are underway to find safe and potent drugs and therapies. These approaches range from repurposing earlier approved drugs to the screening and testing of in silico designed drugs ( 16 ). The antiviral candidates comprise agents targeting cellular components in addition to viral ones ( 15 ). All of the steps of Zika virus life cycle in the host cell from entry to release can be targeted by antiviral agents.

In order to block the viral entry into the cell, various strategies have been used. On one hand, blocking the entry by receptor binding agents such as nanchangmycin (previously used as antibacterial and insecticidal agent), ZINC33683341 and ZINC49605556 (both in silico designed) has been proposed. The other approaches include the inhibition of endosomal fusion using compounds that reduce the acidity of endolysosomal vesicles like chloroquine (an anti-malaria drug) and disrupting the electrostatic interaction between cell and virus membrane using squalamine (a cationic chemical) ( 16 ).

RdRP activity of NS5 is an outstanding target for antiviral drugs. Therefore, several nucleoside analogues are investigated for their ability to inhibit Zika virus replication. Despite demonstrated efficacy of these drugs in cell cultures and animal models, some of them were unsuccessful in the clinical trials. Sofosbuvir (a nucleotide analog inhibitor) is a RdRP inhibitor approved by FDA for chronic HCV treatment. It also inhibits Zika virus replication ( 15 – 17 ). Zika virus N2B-NS3 protease and NS3 helicase, which play essential roles in virus replication, constitute potential targets for antiviral drugs ( 15 ). As the Zika virus helicase is similar to those of the other members of Flaviviridae , antiviral agents targeted their helicase could also be used for the Zika virus ( 18 ). Likewise, berberine previously used against dengue virus showed a high binding affinity to the Zika virus NS3 protease ( 19 ) as well.

Despite the many studies done on Zika antiviral treatments, so far no FDA approved category A drug has been found safe to use in mothers and fetuses ( 16 ).

Epidemiology of Zika virus infection

Before the first large outbreak of Zika virus infection on Yap Island, Federated States of Micronesia ( 20 ), only sporadic cases and serological evidence of Zika virus were reported in western and central Africa and south-east Asia ( 21 , 22 ), but in 2007 Zika Virus emerged as an important human pathogen.

An increased incidence of cases of the Guillain– Barré syndrome (GBS) was reported after a larger epidemic of Zika virus infection in French Polynesia in 2013 ( 23 ). In 2014, autochthonous transmission of Zika virus infection occurred in Easter Island (Chile) from Feb until Jul ( 24 ).

In early 2015, several cases presenting a “dengue-like syndrome” investigated in Brazil (a non-Dengue virus and non-Chikungunya virus infection) and Zika virus was detected by reverse transcription polymerase chain reaction (RT-PCR) assay and confirmed by DNA sequencing ( 25 , 26 ). The Brazil Zika virus strain shares a common ancestor with the Zika virus strain that circulated in French Polynesia ( 27 ).

On Jul 2015, in the State of Bahía, Brazil, an increase in the number of Guillain-Barré cases in which half of them had reported symptoms consistent with Zika virus infection ( 28 ).

In Jan 2016, an unusually significant increase of GBS was reported in El Salvador. An Emergency Committee was convened by the Director-General of WHO, under the International Health Regulations (2005) on 1 Feb 2016, and finally announced “the recent cluster of microcephaly and other neurologic disorders reported in Brazil to be a PHEIC ( 28 ).

Situation and risk analysis in Eastern Mediterranean Region, regional strategic plan

Although no countries of the Eastern Mediterranean Region of WHO have reported importation of Zika virus disease or autochthonous transmission, however, of the 22 countries in the Region, the following 8 have reported dengue outbreaks in recent years and/or have the presence of competent Aedes mosquitoes: Djibouti, Egypt, Oman, Pakistan, Saudi Arabia, Somalia, Sudan and Yemen. Some of these countries are particularly vulnerable to emerging of Zika virus, because of the fragility of health systems, weakness of disease surveillance systems, the inadequacy of response capacities, and a suboptimal level of public health preparedness ( 29 – 31 ). Pakistan is the most-at-risk country in the Region, primarily due to a large number of travelers to and from the Americas, dense urban populations, a documented large epidemic of dengue, and the most favorable climatic conditions for the reproduction of Aedes mosquitoes ( 29 ). In Iran, national committee of Aedes -borne diseases recommended enhancement of surveillance after 2016 and updated national guidelines of surveillance and clinical management of suspected cases, especially for travelers returning from at-risk countries. As of Sep 2018, all of the samples from suspected cases of Zika virus sent to the National Laboratory of Aedes- borne diseases were shown to be negative. Prevention of Aedes -borne diseases needs comprehensive national strategic action plan with “one health” approach and close collaboration between community, academic, and public health authorities. Global map of Zika virus infection demonstrated in ( Fig. 2 ) and areas potentially at risk of Zika in ( Table 1 ).

Global map of Zika virus infection

Areas and countries potentially at risk of Zika

Content source: Centers for Disease Control and Prevention, September 2018 updated. ( https://wwwnc.cdc.gov/travel/page/world-map-areas-with-zika )

Content source: Centers for Disease Control and Prevention, Sep 2018 updated. ( https://wwwnc.cdc.gov/travel/page/world-map-areas-with-zika )

Pathogenesis of Zika virus infection

Studies on the pathogenesis of Zika virus have shown similarities with the pathogenesis of other Flavivirus infections. Following transmission by the mosquito bite, Zika virus can infect several different cell types including skin keratinocytes, dermal fibroblasts and dendritic cells (DCs) ( 9 ). In vitro studies on fibroblasts exposed to Zika virus have shown high infection rates in these cells 24 to 48 h after infection. Flow cytometric analyses of DCs exposed to the virus have also shown that up to 60% of DCs express viral antigens around 24 h after infection ( 9 ). Different cell surface receptors have been proposed to mediate Zika infection of permissive cells; including DC-SIGN, AXL and Tyro3 molecules ( 9 ) ( Fig. 3 ).

Immunopathogenic pathways and virus-host cell interaction in Zika virus infection. Infected vectors ( Aedes aegypti and Aedes albopictus ) introduce Zika viruses into the host during their blood meal. A variety of cells (keratinocytes, fibroblasts, and immature dendritic cells) can be infected through receptor-mediated endocytosis using flaviviruses E glycoprotein. Zika virus entry into these cells is mediated by several receptors including DC-SIGN (CD209), TIM-1, 4 (T-cell immunoglobulin and mucin domain-1, 4), AXL and Tyro3 (cell surface receptor tyrosine kinases, part of the TAM family) (Original)

Following cell entry, Zika virus induces strong interferon responses in infected cells. Studies on Zika virus-infected human primary fibroblasts have shown strong upregulation of interferon-beta transcripts 24 to 48 h after infection ( 9 ). A milder response has been reported for interferon-alpha. Upregulation of intracellular “pattern recognition receptors” (PRRs) involved in sensing non-self-nucleic acids seems to be a crucial part of the initial immune response to the virus ( 9 ). Studies on Zika virus-infected fibroblasts have revealed strong induction of RIG-I and MDA-5 transcripts. Both of these molecules are capable of initiating a signaling process following the detection of intracytoplasmic viral RNA molecules. Innate immune responses are followed by adaptive immune events including the activation of T cells; Zika virus-infected DCs migrate to regional lymph nodes where they stimulate T cell proliferation, differentiation and cytokine production ( 32 ).

Productive infection of dermal fibroblasts and dendritic cells together with insufficient control of infection by innate and adaptive immune mechanisms usually leads to Zika virus viremia, which underlies the non-specific clinical symptoms which might last for a few days. In a pregnant woman, maternal viremia might lead to fetal viremia. It is not well known how the virus is transmitted to developing nervous system following the establishment of fetal viremia. While in circulation, Zika virus can infect fetal monocytes and these monocytes can carry the infection to the developing nervous system. Studies on fetal brain tissue derived from Zika virus-infected mothers who have undergone abortion have shown viral particles in neural cells, indicating that the virus can proliferate inside neural cells in a developing brain ( 5 ). While inside the CNS, Zika virus can exert direct neurovirulence, similar to other Flaviviruses. There is also evidence that Zika virus might cause indirect neurovirulence through the activation of immune mechanisms including microglial activation and macrophage infiltration ( 5 ). Indeed, in adults Zika virus might be an etiological factor for “Acute Disseminated Encephalomyelitis” (ADEM) ( 33 ), an immune-mediated disease of the CNS, which occurs subsequent to varieties of viral and nonviral infections ( 34 ). Whether an ADEM-like process might affect developing brain remains an open question.

Laboratory diagnosis of Zika virus infection

Depending on the purpose of the investigation, laboratory diagnosis of Zika virus can be conducted by virus isolation, antigen detection, viral RNA detection with molecular assays and anti-Zika virus antibodies detection with serological assays ( 35 ).

Virus Isolation

The first isolation of Zika virus was performed by intracerebral mouse inoculation considered as the reference assay for arboviruses isolation ( 25 , 36 ). Among human clinical specimens, Zika virus can be cultured from blood ( 37 ), urine ( 38 ), saliva ( 39 ) and semen ( 40 ).

Antigen Detection

Antigen detection is a valuable assay to approved Zika virus infection in autopsy tissues. Using immunohistochemistry (IHC) technique, Zika virus antigen has been detected in brain and placental tissues from congenitally infected newborns with microcephaly and miscarriages ( 41 , 42 ). Recently, new assays for detection of Zika virus antigen including NS3 protein identification by flow cytometry in whole blood ( 43 ), aptamer-based ELISA assay for targeting of Zika virus NS1 protein ( 44 ), NS1 protein based competitive ELISA ( 45 ), NS1 protein–based rapid tests ( 46 ) have been developed.

Molecular Assays

Zika virus RNA is detectable in different types of body fluids such as blood (serum or plasma) ( 47 – 50 ), urine ( 49 , 51 ), saliva ( 52 ) semen ( 40 ), breast milk ( 49 ), conjunctival fluid ( 53 ) and amniotic fluid ( 54 ); and brain and placental tissues of congenitally infected fetuses ( 41 , 42 ).

Reverse transcriptase PCR (RT-PCR) is highly sensitive and specific and known as the “gold standard” for ZIKV diagnosis ( 55 ). Regarding Zika virus-specific RT-PCR, several conventional and real-time assays targeting prM, E, NS1, NS3, NS4, and NS5 genes have been developed ( 50 , 56 – 59 ). However, to the best of our knowledge, the Food and Drug Administration (FDA) has approved only one commercial assay e.g. Cobas Zika test (Roche) which is a qualitative nucleic acid test for screening Zika virus RNA in blood donors. Additionally, FDA has authorized the use of several molecular assays under an Emergency Use Authorization (EUA) ( 60 ) all of them are based on RT-PCR (such as Triplex Real-Time RT-PCR, a multiplex assay for detection of Zika virus, Dengue virus, and Chikungunya virus (CDC) ( 61 ), Zika virus RNA qualitative real-time RT-PCR (Quest Diagnostics Infectious Disease, Inc.) and RealStar Zika virus RT-PCR kit (Altona Diagnostics, GmbH)) expect Aptima Zika virus assay based on Transcription-Mediated Amplification (TMA) Technology ( 60 ).

Molecular diagnosis of Zika virus infection in human usually performs on plasma or serum specimens within the first week after onset of clinical symptoms ( 60 ). Although, there are several lines of evidence for advantage of urine for Zika virus RNA detection because of the long duration of viral shedding in this easily collectable specimen ( 55 , 12 , 62 ), interesting findings indicating the shorter persistence of ZIKV RNA in urine versus serum have been observed ( 60 , 63 , 64 ).

Serological Assays

Despite the fact that the molecular diagnosis possesses high sensitivity and specificity, short period of viremia can negatively affect the Zika virus RNA detection ( 65 ). Therefore, detection of anti-Zika virus antibodies by serological assays could be an advantageous option for a wider diagnostic window.

Detection of anti-Zika virus antibodies can be performed by different serological tests including complement fixation, haemagglutination inhibition, immunofluorescence (IF) assay, ELISA and neutralization tests ( 13 , 35 ). Typically, anti-Zika virus IgM antibody develops within the first week after the onset of symptoms and is detectable from day five to 12 wk of illness. Anti Zika virus IgG antibody rises few days after IgM and is traceable for months to years.

So far there is no FDA approved a serological test for Zika virus. However, FDA has authorized the use of five serological assays with emergency use authorization for detection of anti-Zika virus IgM antibody including IgM antibody capture ELISA (Zika MAC-ELISA) (CDC) ( 61 ), ZIKV Detect IgM capture ELISA (InBios International, Inc.), Liaison XL Zika capture IgM assay (DiaSorin Incorporated), ADVIA Centaur Zika test (Siemens Healthcare Diagnostics Inc.) and DPP Zika IgM system (Chembio Diagnostic Systems, Inc.) ( 60 ).

Because of cross-reactivity with other Flaviviruses such as dengue and yellow fever viruses, and the possibility of nonspecific reactivity, results of IgM detection assays should be interpreted with caution and positive or equivocal results must be confirmed by plaque-reduction neutralization testing (PRNT) ( 66 ).

Laboratory Biosafety

Zika virus has been classified as a risk group 2 human pathogen. Therefore, diagnostic laboratory tests should be performed in a Biosafety Level 2 (BSL-2) facility ( 13 ). The virus can be inactivated by Ultraviolet (UV) radiation, temperatures above 58 °C, solutions of pH under 6.2 above < 7.8, ether, and 5% potassium permanganate ( 67 – 69 ).

Ethical aspects and challenges of Zika virus infection

Addressing ethical questions and moral conflicts of Zika virus infection may be essential to develop a comprehensive approach to control this public health crisis ( 70 ). Therefore, the health authorities commitment to allocating a fair portion of health resources for responding to this situation is morally required ( 71 ). The government should priorities paying the noticeable amount of money for preventive measures in order to control the Zika virus spread ( 72 ). This priority setting is usually the most difficult step while encountering such situations, especially is the absence of enough scientific evidence to measure the real burden of disease and also the presence of social and media pressure, amplified by 2016 Olympic games in Brazil ( 73 ).

National and international health authorities should observe the principle of veracity, by clear and transparent informing system for raising the public awareness regarding the real situation ( 74 ). At the international level, the “Cosmopolitan Solidarity” for encountering such universal pattern of disease spread seems to be inevitable ( 75 ). Like Ebola outbreak, responsiveness to actions required by responsible international bodies especially WHO is another responsibility of states to form a global health governance network ( 76 ). In mosquito control, governments should try to keep the moral obligation of observing biosafety and protecting the ecosystems in the mind while trying to restrict the insect spread and reproduction ( 77 ). During policy-making for disease control, deliberative ethical evaluation is required in order to protect of population basic civil and human rights such as people’s free mobilization or reproductive rights in case that border or birth control are among the solutions ( 78 , 79 ). Similarly, confidentiality of patients’ health information and protecting people against stigmatization must be observed when policies for reporting the probable cases to health authorities are discussed ( 80 ).

The fear raised from high probability of congenital problems, mainly microcephaly, of neonates delivered by mothers with Zika virus infection in their first trimester of pregnancy ( 81 ), puts abortion at the center of moral concerns ( 82 ). The position of various schools of ethics regarding abortion has a range from strict prohibition to complete moral justification based on the moral status they consider for the fetus in each development stage. Accordingly, abortion laws are still different in various countries according to the social, political, religious and cultural context ( 83 , 84 ). In Iran despite of general prohibition of abortion by Criminal Law, the “Therapeutic Abortion Act” of 2005 allowed performing abortion in presence of a “definite diagnosis of retardation or malformation of the fetus that is unbearable for the mother…” only before 4 months (19th wk) after conception and any attempt for abortion after this gestational age is illegal and even criminal ( 85 ).

Together with Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS), Zika virus infection qualifies as a “newly emerging” infectious disease, with the potential to cause serious public health issues. Unlike the other “newly emerging” infections which can lead to severe morbidity and mortality in infected adults or pediatric hosts, Zika infection does not pose a significant threat to infected adults and its risk is more due to the potential to cause fetal abnormalities, provided that the infection occurs during pregnancy. Indeed, among the four recent PHEIC declarations by WHO (i.e. 2009 Swine flu declaration, 2014 Polio and Ebola declarations and 2016 Zika virus declaration), Zika is unique in the sense that it is a member of the TORCH group of infections; i.e. the group of pathogens with the ability to lead to congenital infections/anomalies. This might influence both disease prevention and management strategies as well as raising ethical and sociological issues. Thus, increased awareness of the medical community together with improvements in vector control and disease surveillance systems are of utmost importance for controlling any potential Zika virus-related threats in different countries.

Ethical considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.

Acknowledgments

No financial resources or support was used for preparing this article.

Conflicts of interest

The authors declare that they have no conflicts of interest.

• Culture & Lifestyle

• Madhesh Province
• Lumbini Province
• Bagmati Province
• National Security
• Koshi Province
• Gandaki Province
• Karnali Province
• Sudurpaschim Province
• International Sports
• Brunch with the Post
• Life & Style
• Entertainment
• Investigations
• Climate & Environment
• Science & Technology
• Visual Stories
• Crosswords & Sudoku
• Corrections
• Letters to the Editor
• Today's ePaper

Without Fear or Favour UNWIND IN STYLE

What's News :

• Deuba-Oli Balkot meet
• Experts to study transactions
• Tilaurakot as World Heritage Site
• Zika virus outbreak risk
• Interview: Usha Jha

Outbreak of Zika virus in India raises concern in Nepal

Post Report

The Epidemiology and Disease Control Division says it has been closely monitoring the outbreak of the Zika virus in India, as the spread of the deadly disease is a matter of serious concern in neighbouring Nepal due to multiple risk factors.

Currently, Nepal is tackling a dengue outbreak, and the same vectors— Aedes aegypti and Aedes albopictus —that spread the dengue virus also spread the Zika virus.

“Unrestricted cross-border movements of people from the two countries and the proximity and presence of virus-spreading vectors are the main risk factors,” said Dr Gokarna Dahal, chief of the Vector Control section at the Division. “Some hospitals and laboratories carry out other tests when they get negative reports of patients having dengue-like symptoms.”

Zika causes microcephaly, a condition in which babies are born with underdeveloped head and brain damage. It is also linked to Guillain-Barre syndrome, a condition in which the immune system attacks the nerves causing muscle weakness and sometimes paralysis.

Last week, India reported three cases of zike infection in Maharashtra state. Since 2016, India has witnessed Zika outbreaks every year except in 2019 and 2020.

A risk assessment survey carried out in 2018 with the technical and financial support of the World Health Organisation showed that Nepal was a high-risk country for dengue and Zika outbreaks.

Dengue-spreading mosquitoes—Aedes aegypti and Aedes albopictus—also transmit Zika and Chikungunya viruses, which means the vectors are present throughout the country.

Doctors say all that is needed for an outbreak is a Zika-infected person, which could be anyone. Outbreaks of the disease in India every year and global movement of the people have increased the risk of an outbreak in our country too, according to them.

The Ministry of Health and Population had carried out Zika surveillance in the past and tested samples of people having dengue-like symptoms, but the results came back negative, according to Dahal. The World Health Organisation Nepal had provided financial as well as technical support to acquire the technology to carry out the testing of the viruses, officials said.

Doctors say Zika virus symptoms match those of the dengue virus—mild fever, rashes, muscle pain, headache, red eyes and a general feeling of discomfort in up to 80 percent of cases.

Studies show that pregnant women and their foetuses are at high risk of Zika infection, as the virus causes microcephaly in the foetus.

Zika virus was first identified in Uganda in 1947 in monkeys, according to the UN health agency. It was later detected in humans. Brazil saw the worst outbreak of the virus in 2015 and it has since then spread to 24 other countries. The WHO had declared Zika outbreak an international health emergency in 2016.

Meanwhile, Nepal has recorded at least 1,268 dengue cases since January this year. Of the 72 districts that reported dengue outbreaks, Kathmandu has the highest number of cases: 141.

Public health experts say reported cases could be just the tip of the iceberg, as around 80 percent of those infected are asymptomatic.

Related News

Madhesh to be declared fully immunised. Experts say it may backfire

Over 1,000 people infected with swine flu virus since January

Take period pains seriously. It could be endometriosis

Monsoon in, snakebite risk up. Even mountain districts are not immune

Authorities promote open-air gyms, alternative medicines to fight rising non-communicable diseases

Most read from health.

As dengue control falters, focus shifts to individual cases

Reports show threefold drop in diarrhoeal cases in a year

Editor's Picks

Partisan interest in envoy picks tarnishes Nepal’s image

Beijing bets on tourism diplomacy as soft power tool

The Balen-Oli duel

Can Nepal’s new and old forces collaborate?

E-paper | july 01, 2024.

• Read ePaper Online

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Ppars in clinical experimental medicine after 35 years of worldwide scientific investigations and medical experiments.

1. Introduction

1.1. peroxisome proliferator-activated receptor alpha (pparα), 1.2. peroxisome proliferator-activated receptor beta/delta (pparβ/δ), 1.3. peroxisome proliferator-activated receptor gamma (pparγ), 1.4. pan-ppar (alpha, beta/delta, gamma), 2. aim of the work, 3.1. introduction, 3.2. electronic search strategy, 3.3. calendar with commentary, 4. discussion, 5. concluding remarks, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

• Vamecq, J.; Latruffe, N. Medical significance of peroxisome proliferator-activated receptors. Lancet 1999 , 354 , 141–148. [ Google Scholar ] [ CrossRef ]
• Issemann, I.; Green, S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 1990 , 347 , 645–650. [ Google Scholar ] [ CrossRef ]
• Dreyer, C.; Krey, G.; Keller, H.; Givel, F.; Helftenbein, G.; Wahli, W. Control of the peroxisomal β-oxidation pathway by a novel family of nuclear hormone receptors. Cell 1992 , 68 , 879–887. [ Google Scholar ] [ CrossRef ]
• Reilly, M.M.; Rossor, A.M. Humans: The Ultimate Animal Models. J. Neurol. Neurosurg. Psychiatry 2020 , 91 , 1132–1136. [ Google Scholar ] [ CrossRef ]
• Tahri-Joutey, M.; Andreoletti, P.; Surapureddi, S.; Nasser, B.; Cherkaoui-Malki, M.; Latruffe, N. Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid Beta-Oxidation by PPARα. Int. J. Mol. Sci. 2021 , 22 , 8969. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Zhou, T.; Yan, X.; Wang, G.; Liu, H.; Gan, X.; Zhang, T.; Wang, J.; Li, L. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members. Biomed. Res. Int. 2015 , 2015 , 613910. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lathion, C.; Michalik, L.; Wahli, W. Physiological Ligands of PPARs in Inflammation and Lipid Homeostasis. Future Lipidol. 2006 , 1 , 191–201. [ Google Scholar ] [ CrossRef ]
• Willson, T.M.; Brown, P.J.; Sternbach, D.D.; Henke, B.R. The PPARs: From orphan receptors to drug discovery. J. Med. Chem. 2000 , 43 , 527–550. [ Google Scholar ] [ CrossRef ]
• Chinetti-Gbaguidi, G.; Fruchart, J.C.; Staels, B. Role of the PPAR family of nuclear receptors in the regulation of metabolic and cardiovascular homeostasis: New approaches to therapy. Curr. Opin. Pharmacol. 2005 , 5 , 177–183. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Seok, H.; Cha, B.S. Refocusing Peroxisome Proliferator Activated Receptor-α: A New Insight for Therapeutic Roles in Diabetes. Diabetes Metab. J. 2013 , 37 , 326–332. [ Google Scholar ] [ CrossRef ]
• Waterham, H.R.; Ferdinandusse, S.; Wanders, R.J. Human disorders of peroxisome metabolism and biogenesis. Biochim. Biophys. Acta. 2016 , 1863 , 922–933. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Staels, B.; Fruchart, J.C. Therapeutic Roles of Peroxisome Proliferator–Activated Receptor Agonists. Diabetes 2005 , 54 , 2460–2470. [ Google Scholar ] [ CrossRef ]
• Pyper, S.R.; Viswakarma, N.; Jia, Y.; Zhu, Y.J.; Fondell, J.D.; Reddy, J.K. PRIC295, a Nuclear Receptor Coactivator, Identified from PPARα-Interacting Cofactor Complex. PPAR Res. 2010 , 2010 , 173907. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lefebvre, P.; Chinetti, G.; Fruchart, J.-C.; Staels, B. Sorting out the roles of PPARα in energy metabolism and vascular homeostasis. J. Clin. Investig. 2006 , 116 , 571–580. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gacka, M.; Adamiec, R. Mutacje genu receptora aktywowanego przez proliferatory peroksysomów γ (PPARγ)—Implikacje kliniczne. Postępy Hig. I Med. Doświadczalnej 2004 , 58 , 483–489. [ Google Scholar ]
• Cullingford, T.E.; Dolphin, C.T.; Sato, H. The peroxisome proliferator-activated receptor alpha-selective activator ciprofibrate upregulates expression of genes encoding fatty acid oxidation and ketogenesis enzymes in rat brain. Neuropharmacology 2002 , 42 , 724–730. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rudolph, J.; Chen, L.; Majumdar, D.; Bullock, W.H.; Burns, M.; Claus, T.; Dela Cruz, F.E.; Daly, M.; Ehrgott, F.J.; Johnson, J.S.; et al. Indanylacetic acid derivatives carrying 4-thiazolyl-phenoxy tail groups, a new class of potent PPAR alpha/gamma/delta pan agonists: Synthesis, structure-activity relationship, and in vivo efficacy. J. Med. Chem. 2007 , 50 , 984–1000. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Huang-Jin, H.; Kuei-Jen, L.; Hsin, W.Y.; Hsin-Yi, C.; Fuu-Jen, T.; Calvin, Y.-C.C. A novel strategy for designing the selective PPAR agonist by the “sum of activity” model. J. Biomol. Struct. Dyn. 2010 , 28 , 187–200. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Vamecq, J.; Cherkaoui-Malki, M.; Andreoletti, P.; Latruffe, N. The human peroxisome in health and disease: The story of an oddity becoming a vital organelle. Biochimie 2014 , 98 , 4–15. [ Google Scholar ] [ CrossRef ]
• Reddy, J.K.; Lalvvai, N.D.; Farber, E. Carcinogenesis by peroxisome proliferators: Evaluation of the risk of hypolipidemic drugs and industrial plasticizers to humans. Crit. Rev. Toxicol. 1988 , 18 , 1–58. [ Google Scholar ] [ CrossRef ]
• Reddy, J.K.; Rao, M.S. Peroxisome proliferators and cancer: Mechanisms and implications. Adv. Exp. Med. Biol. 1988 , 283 , 131–148. [ Google Scholar ]
• Martinez, E.; Givel, F.; Wahli, W.; Keller, H. The peroxisome proliferator-activated receptor (PPAR) is a transcriptional regulator of the peroxisomal beta-oxidation pathway. J. Cell Sci. 1991 , 100 , 711–717. [ Google Scholar ]
• Liu, J.; Ormö, M.; Nyström, A.C.; Claesson, J.; Giordanetto, F. Transient expression, purification and characterisation of human full-length PPARγ2 in HEK293 cells. Protein Expr. Purif. 2013 , 89 , 189–195. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Alvares, K.; Carrillo, A.; Yuan, P.M.; Kawano, H.; Morimoto, R.I.; Reddy, J.K. Identification of cytosolic peroxisome proliferator binding protein as a member of the heat shock protein HSP70 family. Proc. Natl. Acad. Sci. USA 1990 , 87 , 5293–5297. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Maksymowych, A.B.; Hsu, T.C.; Litwack, G. A novel, highly conserved structural motif is present in all members of the steroid receptor superfamily. Receptor 1992 , 2 , 225–240. [ Google Scholar ] [ PubMed ]
• Göttlicher, M.; Demoz, A.; Svensson, D.; Tollet, P.; Berge, R.K.; Gustafsson, J.A. Structural and metabolic requirements for activators of the peroxisome proliferator-activated receptor. Biochem. Pharmacol. 1993 , 46 , 2177–2184. [ Google Scholar ] [ CrossRef ]
• Keller, H.; Wahli, W. Peroxisome proliferator-activated receptors A link between endocrinology and nutrition? Trends Endocrinol. Metab. 1993 , 4 , 291–296. [ Google Scholar ] [ CrossRef ]
• Keller, H.; Mahfoudi, A.; Dreyer, C.; Hihi, A.K.; Medin, J.; Ozato, K.; Wahli, W. Peroxisome proliferator-activated receptors and lipid metabolism. Ann. N. Y. Acad. Sci. 1993 , 684 , 157–173. [ Google Scholar ] [ CrossRef ]
• Issemann, I.; Prince, R.A.; Tugwood, J.D.; Green, S. The retinoid X receptor enhances the function of the peroxisome proliferator activated receptor. Biochimie 1993 , 75 , 251–256. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bardot, O.; Aldridge, T.C.; Latruffe, N.; Green, S. PPAR-RXR heterodimer activates a peroxisome proliferator response element upstream of the bifunctional enzyme gene. Biochem. Biophys. Res. Commun. 1993 , 192 , 37–45. [ Google Scholar ] [ CrossRef ]
• Boie, Y.; Adam, M.; Rushmore, T.H.; Kennedy, B.P. Enantioselective activation of the peroxisome proliferator-activated receptor. J. Biol. Chem. 1993 , 268 , 5530–5534. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Motojima, K. Proliferator-Activated Receptor (PPAR): Structure, Mechanisms of Activation and Diverse Functions. Cell Struct. Funct. 1993 , 18 , 267–277. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sher, T.; Yi, H.F.; McBride, O.W.; Gonzalez, F.J. cDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptor. Biochemistry 1993 , 32 , 5598–5604. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bass, N.M. Cellular binding proteins for fatty acids and retinoids: Similar or specialized functions? Mol. Cell Biochem. 1993 , 123 , 191–202. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gibson, G.G. Peroxisome proliferators: Paradigms and prospects. In Proceedings of the 1992 Conference on Toxicology: Application of Advances in Toxicology to Risk Assessment; Dodd, D.E., Clewell, H.J., III, Mattie, D.R., Eds.; ManTech Environmental Technology, Inc.: Dayton, OH, USA, 1993; pp. 194–202. [ Google Scholar ]
• Chen, F.; Law, S.W.; O’Malley, B.W. Identification of two mPPAR related receptors and evidence for the existence of five subfamily members. Biochem. Biophys. Res. Commun. 1993 , 196 , 671–677. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kainu, T.; Wikström, A.C.; Gustafsson, J.A.; Pelto-Huikko, M. Localization of the peroxisome proliferator-activated receptor in the brain. Neuroreport 1994 , 5 , 2481–2485. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aleshin, S.; Grabeklis, S.; Hanck, T.; Sergeeva, M.; Reiser, G. Peroxisome proliferator-activated receptor (PPAR)-gamma positively controls and PPARalpha negatively controls cyclooxygenase-2 expression in rat brain astrocytes through a convergence on PPARbeta/delta via mutual control of PPAR expression levels. Mol Pharmacol. 2009 , 76 , 414–424. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lemberger, T.; Saladin, R.; Vázquez, M.; Assimacopoulos, F.; Staels, B.; Desvergne, B.; Wahli, W.; Auwerx, J. Expression of the peroxisome proliferator-activated receptor alpha gene is stimulated by stress and follows a diurnal rhythm. J. Biol. Chem. 1996 , 271 , 1764–1769. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wahli, W.; Braissant, O.; Desvergne, B. Peroxisome proliferator activated receptors: Transcriptional regulators of adipogenesis, lipid metabolism and more…. Chem. Biol. 1995 , 2 , 261–266. [ Google Scholar ] [ CrossRef ]
• Gustafsson, J.A. Receptor-mediated toxicity. Toxicol. Lett. 1995 , 82–83 , 465–470. [ Google Scholar ] [ CrossRef ]
• Bocos, C.; Göttlicher, M.; Gearing, K.; Banner, C.; Enmark, E.; Teboul, M.; Crickmore, A.; Gustafsson, J.A. Fatty acid activation of peroxisome proliferator-activated receptor (PPAR). J. Steroid. Biochem. Mol. Biol. 1995 , 53 , 467–473. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lemberger, T.; Desvergne, B.; Wahli, W. Peroxisome proliferator-activated receptors: A nuclear receptor signaling pathway in lipid physiology. Annu. Rev. Cell Dev. Biol. 1996 , 12 , 335–363. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yu, K.; Bayona, W.; Kallen, C.B.; Harding, H.P.; Ravera, C.P.; McMahon, G.; Brown, M.; Lazar, M.A. Differential activation of peroxisome proliferator-activated receptors by eicosanoids. J. Biol. Chem. 1995 , 270 , 23975–23983. [ Google Scholar ] [ CrossRef ]
• Keller, H.; Givel, F.; Perroud, M.; Wahli, W. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements. Mol. Endocrinol. 1995 , 9 , 794–804. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Juge-Aubry, C.E.; Gorla-Bajszczak, A.; Pernin, A.; Lemberger, T.; Wahli, W.; Burger, A.G.; Meier, C.A. Peroxisome proliferator-activated receptor mediates cross-talk with thyroid hormone receptor by competition for retinoid X receptor. Possible role of a leucine zipper-like heptad repeat. J. Biol. Chem. 1995 , 270 , 18117–18122. [ Google Scholar ] [ CrossRef ]
• Baes, M.; Castelein, H.; Desmet, L.; Declercq, P.E. Antagonism of COUP-TF and PPAR alpha/RXR alpha on the activation of the malic enzyme gene promoter: Modulation by 9-cis RA. Biochem. Biophys. Res. Commun. 1995 , 215 , 338–345. [ Google Scholar ] [ CrossRef ]
• Forman, B.M.; Chen, J.; Evans, R.M. The peroxisome proliferator-activated receptors: Ligands and activators. Ann. N. Y. Acad. Sci. 1996 , 804 , 266–275. [ Google Scholar ] [ CrossRef ]
• Willson, T.M.; Cobb, J.E.; Cowan, D.J.; Wiethe, R.W.; Correa, I.D.; Prakash, S.R.; Beck, K.D.; Moore, L.B.; Kliewer, S.A.; Lehmann, J.M. The structure-activity relationship between peroxisome proliferator- activated receptor gamma agonism and the antihyperglycemic activity of thiazolidinediones. J. Med. Chem. 1996 , 39 , 665–668. [ Google Scholar ] [ CrossRef ]
• Aubert, J.; Ailhaud, G.; Negrel, R. Evidence for a novel regulatory pathway activated by (carba)prostacyclin in preadipose and adipose cells. FEBS Lett. 1996 , 397 , 117–121. [ Google Scholar ] [ CrossRef ]
• Patel, C.B.; De Lemos, J.A.; Wyne, K.L.; McGuire, D.K. Thiazolidinediones and risk for atherosclerosis: Pleiotropic effects of PPar gamma agonism. Diab. Vasc. Dis. Res. 2006 , 3 , 65–71. [ Google Scholar ] [ CrossRef ]
• Brun, R.P.; Tontonoz, P.; Forman, B.M.; Ellis, R.; Chen, J.; Evans, R.M.; Spiegelman, B.M. Differential activation of adipogenesis by multiple PPAR isoforms. Genes Dev. 1996 , 10 , 974–984. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Guan, Y.; Zhang, Y.; Davis, L.; Breyer, M.D. Expression of peroxisome proliferator-activated receptors in urinary tract of rabbits and humans. Am. J. Physiol. 1997 , 273 , F1013–F1022. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bernlohr, D.A.; Simpson, M.A.; Hertzel, A.V.; Banaszak, L.J. Intracellular lipid-binding proteins and their genes. Annu. Rev. Nutr. 1997 , 17 , 277–303. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Clarke, S.D.; Jump, D. Polyunsaturated fatty acids regulate lipogenic and peroxisomal gene expression by independent mechanisms. Prostaglandins Leukot Essent Fat. Acids. 1997 , 57 , 65–69. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rowe, A. Retinoid X receptors. Int. J. Biochem. Cell Biol. 1997 , 29 , 275–278. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Marx, N.; Schönbeck, U.; Lazar, M.A.; Libby, P.; Plutzky, J. Peroxisome Proliferator-Activated Receptor Gamma Activators Inhibit Gene Expression and Migra-tion in Human Vascular Smooth Muscle Cells. Circ Res. 1998 , 83 , 1097–1103. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kruszynska, Y.T.; Mukherjee, R.; Jow, L.; Dana, S.; Paterniti, J.R.; Olefsky, J.M. Skeletal muscle peroxisome proliferator- activated receptor-gamma expression in obesity and non- insulin-dependent diabetes mellitus. J. Clin. Investig. 1998 , 101 , 543–548. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Schulman, I.G.; Shao, G.; Heyman, R.A. Transactivation by Retinoid X Receptor–Peroxisome Proliferator-Activated Receptor gamma (PPARgamma) Heterodimers: Intermolecular Synergy Requires Only the PPAR? Hormone-Dependent Activation Function. Mol. Cell Biol. 1998 , 18 , 3483–3494. [ Google Scholar ] [ CrossRef ]
• Ricote, M.; Huang, J.; Fajas, L.; Li, A.; Welch, J.; Najib, J.; Witztum, J.L.; Auwerx, J.; Palinski, W.; Glass, C.K. Expression of the peroxisome proliferator-activated receptor gamma (PPARgamma) in human atherosclerosis and regulation in macrophages by colony stimulating factors and oxidized low density lipoprotein. Proc. Natl. Acad. Sci. USA 1998 , 95 , 7614–7619. [ Google Scholar ] [ CrossRef ]
• Zhou, Y.-T.; Shimabukuro, M.; Wang, M.-Y.; Lee, Y.; Higa, M.; Milburn, J.L.; Newgard, C.B.; Unger, R.H. Role of peroxisome proliferator-activated receptor alpha in disease of pancreatic ß cells. Proc. Natl. Acad. Sci. USA 1998 , 95 , 8898–8903. [ Google Scholar ] [ CrossRef ]
• Ribon, V.; Johnson, J.H.; Camp, H.S.; Saltiel, A.R. Thiazolidinediones and insulin resistance: Peroxisome proliferator activated receptor gamma activation stimulates expression of the CAP gene. Proc. Natl. Acad. Sci. USA 1998 , 95 , 14751–14756. [ Google Scholar ] [ CrossRef ]
• Shimomura, I.; Hammer, R.E.; Richardson, J.A.; Ikemoto, S.; Bashmakov, Y.; Goldstein, J.L.; Brown, M.S. Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in adi-pose tissue: Model for congenital generalized lipodystrophy. Genes Dev. 1998 , 12 , 3182–3194. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Elstner, E.; Müller, C.; Koshizuka, K.; Williamson, E.A.; Park, D.; Asou, H.; Shintaku, P.; Said, J.W.; Heber, D.; Koeffler, H.P. Ligands for peroxisome proliferator-activated receptor gamma and retinoic acid receptor inhibit growth and induce apoptosis of human breast cancer cells in vitro and in BNX mice. Proc. Natl. Acad. Sci. USA 1998 , 95 , 8806–8811. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sørensen, H.N.; Treuter, E.; Gustafsson, J.A. Regulation of peroxisome proliferator-activated receptors. Vitam. Horm. 1998 , 54 , 121–166. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Goodman, A.B. Three independent lines of evidence suggest retinoids as causal to schizophrenia. Proc. Natl. Acad. Sci. USA 1998 , 95 , 7240–7244. [ Google Scholar ] [ CrossRef ]
• Guan, Y.-F.; Zhang, Y.-H.; Breyer, R.M.; Davis, L.; Breyer, M.D. Expression of Peroxisome Proliferator-Activated Receptor Gamma (PPARgamma) in Human Transition-al Bladder Cancer and its Role in Inducing Cell Death. Neoplasia 1999 , 1 , 330–339. [ Google Scholar ] [ CrossRef ]
• Demetri, G.D.; Fletcher, C.D.M.; Mueller, E.; Sarraf, P.; Naujoks, R.; Campbell, N.; Spiegelman, B.M.; Singer, S. Induction of solid tumor differentiation by the peroxisome proliferator-activated receptor-gamma ligand troglitazone in patients with liposarcoma. Proc. Natl. Acad. Sci. USA 1999 , 96 , 3951–3956. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kitamura, S.; Miyazaki, M.; Shinomura, Y.; Kondo, S.; Kanayama, S.; Matsuzawa, Y. Peroxisome Proliferator-activated Receptor Gamma Induces Growth Arrest and Differentiation Markers of Human Colon Cancer Cells. Jpn J. Cancer Res. 1999 , 90 , 75–80. [ Google Scholar ] [ CrossRef ]
• Sarraf, P.; Mueller, E.; Smith, W.M.; Wright, H.M.; Kum, J.B.; Aaltonen, L.A.; de la Chapelle, A.; Spiegelman, B.M.; Eng, C. Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol. Cell. 1999 , 3 , 799–804. [ Google Scholar ] [ CrossRef ]
• Zhu, Y.; Qi, C.; Jain, S.; Le Beau, M.M.; Espinosa, R., 3rd; Atkins, G.B.; Lazar, M.A.; Yeldandi, A.V.; Rao, M.S.; Reddy, J.K. Amplification and overexpression of peroxisome proliferator activated receptor binding protein (PBP/PPARBP) gene in breast cancer. Proc. Natl. Acad. Sci. USA 1999 , 96 , 10848–10853. [ Google Scholar ] [ CrossRef ]
• Doucas, V.; Evans, R.M. The human T-cell leukemia virus type 1 tax oncoprotein represses nuclear receptor signaling. Proc. Natl. Acad. Sci. USA 1999 , 96 , 2633–2638. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Shappell, S.B.; Boeglin, W.E.; Olson, S.J.; Kasper, S.; Brash, A.R. 15-Lipoxygenase-2 (15-LOX-2) Is Expressed in Benign Prostatic Epithelium and Reduced in Prostate Adenocarcinoma. Am. J. Pathol. 1999 , 155 , 235–245. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lazennec, G.; Canaple, L.; Saugy, D.; Wahli, W. Activation of peroxisome proliferator-activated receptors (PPARs) by their ligands and protein kinase A activators. Mol. Endocrinol. 2000 , 14 , 1962–1975. [ Google Scholar ] [ CrossRef ] [ PubMed ] [ PubMed Central ]
• Kawahito, Y.; Kondo, M.; Tsubouchi, Y.; Hashiramoto, A.; Bishop-Bailey, D.; Inoue, K.; Kohno, M.; Yamada, R.; Hla, T.; Sano, H. 15-deoxy-delta(12,14)-PGJ(2) induces synoviocyte apoptosis and sup-presses adjuvant-induced arthritis in rats. J. Clin. Investig. 2000 , 106 , 189–197. [ Google Scholar ] [ CrossRef ] [ PubMed ] [ PubMed Central ]
• Tong, B.J.; Tan, J.; Tajeda, T.; Das, S.K.; Chapman, J.A.; DuBoist, R.N.; Dey, S.K. Heightened Expression of Cyclooxygenase-2 and Peroxisome Proliferator-Activated Recep-tor-δ in Human Endometrial Adenocarcinoma. Neoplasia 2000 , 2 , 483–490. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gupta, R.A.; Tan, J.; Krause, W.F.; Geraci, M.W.; Willson, T.M.; Dey, S.K.; DuBois, R.N. Prostacyclin-mediated activation of peroxisome proliferator-activated receptor δ in colorectal cancer. Proc. Natl. Acad. Sci. USA 2000 , 97 , 13275–13280. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jehl-Pietri, C.; Bastie, C.; Gillot, I.; Luquet, S.; Grimaldi, P.A. Peroxisome-proliferator-activated recep-tor delta mediates the effects of long-chain fatty acids on post-confluent cell proliferation. Biochem. J. 2000 , 350 , 93–98. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sato, H.; Ishihara, S.; Kawashima, K.; Moriyama, N.; Suetsugu, H.; Kazumori, H.; Okuyama, T.; Rumi, M.A.; Fukuda, R.; Nagasue, N.; et al. Expression of peroxisome proliferator-activated receptor (PPAR)gamma in gastric cancer and inhibitory effects of PPARgamma agonists. Br. J. Cancer. 2000 , 83 , 1394–1400. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Mueller, E.; Smith, M.; Sarraf, P.; Kroll, T.; Aiyer, A.; Kaufman, D.S.; Oh, W.; Demetri, G.; Figg, W.D.; Zhou, X.P.; et al. Effects of ligand activation of peroxisome proliferator-activated receptor gamma in human prostate cancer. Proc. Natl. Acad. Sci. USA 2000 , 97 , 10990–10995. [ Google Scholar ] [ CrossRef ]
• Combs, C.K.; Johnson, D.E.; Karlo, J.C.; Cannady, S.B.; Landreth, G.E. Inflammatory mechanisms in Alz-heimer’s disease: Inhibition of beta-amyloid-stimulated proinflammatory responses and neurotoxi-city by PPARgamma agonists. J. Neurosci. 2000 , 20 , 558–567. [ Google Scholar ] [ CrossRef ]
• Zhou, X.P.; Smith, W.M.; Gimm, O.; Mueller, E.; Gao, X.; Sarraf, P.; Prior, T.W.; Plass, C.; von Deimling, A.; Black, P.M.; et al. Over-representation of PPARgamma sequence variants in sporadic cases of glioblastoma multiforme: Preliminary evidence for common low penetrance modifiers for brain tumour risk in the general population. J. Med. Genet. 2000 , 37 , 410–414. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Debril, M.B.; Renaud, J.P.; Fajas, L.; Auwerx, J.; Girard, J. Transcription factors and nuclear receptors interact with the SWI/SNF complex through the BAF60c subunit. J. Biol. Chem. 1999 , 274 , 8945–8951. [ Google Scholar ] [ CrossRef ]
• Chinetti, G.; Fruchart, J.C.; Staels, B. Peroxisome proliferator-activated receptors (PPARs): Nuclear receptors with functions in the vascular wall. Z Kardiol. 2001 , 90 (Suppl. S3), 125–132. [ Google Scholar ] [ CrossRef ]
• Delerive, P.; Fruchart, J.C.; Staels, B. Peroxisome Proliferator-Activated Receptors in Inflammation Control. J. Endocrinol. 2001 , 169 , 453–459. [ Google Scholar ] [ CrossRef ]
• Duez, H.; Fruchart, J.C.; Staels, B. PPARS in Inflammation, Atherosclerosis and Thrombosis. J. Cardiovasc. Risk 2001 , 8 , 187–194. [ Google Scholar ] [ CrossRef ]
• Elangbam, C.S.; Tyler, R.D.; Lightfoot, R.M. Peroxisome Proliferator-Activated Receptors in Atherosclerosis and Inflammation--an Update. Toxicol. Pathol. 2001 , 29 , 224–231. [ Google Scholar ] [ CrossRef ]
• Stumvoll, M.; Häring, H. The Peroxisome Proliferator-Activated Receptor-Gamma2 Pro12Ala Polymorphism. Diabetes 2002 , 51 , 2341–2347. [ Google Scholar ] [ CrossRef ]
• Roberts, R.A.; Chevalier, S.; Hasmall, S.C.; James, N.H.; Cosulich, S.C.; Macdonald, N. PPARα and the Regulation of Cell Division and Apoptosis. Toxicology 2002 , 181–182 , 167–170. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Berger, J.; Moller, D.E. The Mechanisms of Action of PPARs. Annu. Rev. Med. 2002 , 53 , 409–435. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Fauconnet, S.; Lascombe, I.; Chabannes, E.; Adessi, G.-L.; Desvergne, B.; Wahli, W.; Bittard, H. Differential Regulation of Vascular Endothelial Growth Factor Expression by Peroxisome Proliferator-Activated Receptors in Bladder Cancer Cells. J. Biol. Chem. 2002 , 277 , 23534–23543. [ Google Scholar ] [ CrossRef ]
• Haydon, R.C.; Zhou, L.; Feng, T.; Breyer, B.; Cheng, H.; Jiang, W.; Ishikawa, A.; Peabody, T.; Montag, A.; Simon, M.A.; et al. Nuclear receptor agonists as potential differentiation therapy agents for human osteosarcoma. Clin. Cancer Res. 2002 , 8 , 1288–1294. [ Google Scholar ] [ PubMed ]
• Koumanis, D.J.; Christou, N.V.; Wang, X.L.; Gilfix, B.M. Pilot study examining the frequency of several gene polymorphisms in a morbidly obese population. Obes. Surg. 2002 , 12 , 759–764. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Berger, J.; Wagner, J.A. Physiological and therapeutic roles of peroxisome proliferator-activated receptors. Diabetes Technol. Ther. 2002 , 4 , 163–174. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Francis, G.A.; Annicotte, J.-S.; Auwerx, J. PPAR Agonists in the Treatment of Atherosclerosis. Curr. Opin. Pharmacol. 2003 , 3 , 186–191. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Margeli, A.; Kouraklis, G.; Theocharis, S. Peroxisome Proliferator Activated Receptor-γ (PPAR-γ) Ligands and Angiogenesis. Angiogenesis 2003 , 6 , 165–169. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Larsen, T.M.; Toubro, S.; Astrup, A. PPARgamma Agonists in the Treatment of Type II Diabetes: Is Increased Fatness Commensurate with Long-Term Efficacy? Int. J. Obes. Relat. Metab. Disord. J. Int. Assoc. Study Obes. 2003 , 27 , 147–161. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jiang, M.; Shappell, S.B.; Hayward, S.W. Approaches to Understanding the Importance and Clinical Implications of Peroxisome Proliferator-Activated Receptor Gamma (PPARgamma) Signaling in Prostate Cancer. J. Cell. Biochem. 2004 , 91 , 513–527. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bedu, E.; Wahli, W.; Desvergne, B. Peroxisome proliferator-activated receptor beta/delta as a therapeutic target for metabolic diseases. Expert Opin. Ther. Targets. 2005 , 9 , 861–873. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Tenenbaum, A.; Motro, M.; Fisman, E.Z. Dual and pan-peroxisome proliferator-activated receptors (PPAR) co-agonism: The bezafibrate lessons. Cardiovasc. Diabetol. 2005 , 4 , 14. [ Google Scholar ] [ CrossRef ]
• Buzzetti, R.; Petrone, A.; Caiazzo, A.M.; Alemanno, I.; Zavarella, S.; Capizzi, M.; Mein, C.A.; Osborn, J.A.; Vania, A.; di Mario, U. PPAR-Gamma2 Pro12Ala Variant Is Associated with Greater Insulin Sensitivity in Childhood Obesity. Pediatr. Res. 2005 , 57 , 138–140. [ Google Scholar ] [ CrossRef ]
• Tyagi, S.C.; Rodriguez, W.; Patel, A.M.; Roberts, A.M.; Falcone, J.C.; Passmore, J.C.; Fleming, J.T.; Joshua, I.G. Hyperhomocysteinemic diabetic cardiomyopathy: Oxidative stress, remodeling, and endothelial-myocyte uncoupling. J. Cardiovasc. Pharmacol. Ther. 2005 , 10 , 1–10. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Harris, G.; Ghazallah, R.A.; Nascene, D.; Wuertz, B.; Ondrey, F.G. PPAR activation and decreased proliferation in oral carcinoma cells with 4-HPR. Otolaryngol. Head Neck Surg. 2005 , 133 , 695–701. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Lowe, D.B.; Bifulco, N.; Bullock, W.H.; Claus, T.; Coish, P.; Dai, M.; Dela Cruz, F.E.; Dickson, D.; Fan, D.; Hoover-Litty, H.; et al. Substituted indanylacetic acids as PPAR-alpha-gamma activators. Bioorg. Med. Chem. Lett. 2006 , 16 , 297–301. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• LoVerme, J.; La Rana, G.; Russo, R.; Calignano, A.; Piomelli, D. The search for the palmitoylethanolamide receptor. Life Sci. 2005 , 77 , 1685–1698. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Michalik, L.; Auwerx, J.; Berger, J.P.; Chatterjee, V.K.; Glass, C.K.; Gonzalez, F.J.; Grimaldi, P.A.; Kadowaki, T.; Lazar, M.A.; O’Rahilly, S.; et al. International Union of Pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacol. Rev. 2006 , 58 , 726–741. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aung, C.S.; Faddy, H.M.; Lister, E.J.; Monteith, G.R.; Roberts-Thomson, S.J. Isoform Specific Changes in PPAR Alpha and Beta in Colon and Breast Cancer with Differentiation. Biochem. Biophys. Res. Commun. 2006 , 340 , 656–660. [ Google Scholar ] [ CrossRef ]
• Trivedi, N.R.; Cong, Z.; Nelson, A.M.; Albert, A.J.; Rosamilia, L.L.; Sivarajah, S.; Gilliland, K.L.; Liu, W.; Mauger, D.T.; Gabbay, R.A.; et al. Peroxisome Proliferator-Activated Receptors Increase Human Sebum Production. J. Investig. Dermatol. 2006 , 126 , 2002–2009. [ Google Scholar ] [ CrossRef ]
• Burdick, A.D.; Kim, D.J.; Peraza, M.A.; Gonzalez, F.J.; Peters, J.M. The Role of Peroxisome Proliferator-Activated Receptor-Beta/Delta in Epithelial Cell Growth and Differentiation. Cell. Signal. 2006 , 18 , 9–20. [ Google Scholar ] [ CrossRef ]
• Michalik, L.; Wahli, W. Peroxisome proliferator-activated receptors (PPARs) in skin health, repair and disease. Biochim. Biophys. Acta. 2007 , 1771 , 991–998. [ Google Scholar ] [ CrossRef ]
• Akhmetov, I.I.; Astranenkova, I.V.; Rogozkin, V.A. Association of PPARD gene polymorphism with human physical performance. Mol. Biol. 2007 , 41 , 852–857. (In Russian) [ Google Scholar ]
• Piqueras, L.; Reynolds, A.R.; Hodivala-Dilke, K.M.; Alfranca, A.; Redondo, J.M.; Hatae, T.; Tanabe, T.; Warner, T.D.; Bishop-Bailey, D. Activation of PPARbeta/delta induces endothelial cell proliferation and angiogenesis. Arterioscler. Thromb. Vasc. Biol. 2007 , 27 , 63–69. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Grarup, N.; Albrechtsen, A.; Ek, J.; Borch-Johnsen, K.; Jørgensen, T.; Schmitz, O.; Hansen, T.; Pedersen, O. Variation in the peroxisome proliferator-activated receptor delta gene in relation to common metabolic traits in 7495 middle-aged white people. Diabetologia 2007 , 50 , 1201–1208. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hollingshead, H.E.; Killins, R.L.; Borland, M.G.; Girroir, E.E.; Billin, A.N.; Willson, T.M.; Sharma, A.K.; Amin, S.; Gonzalez, F.J.; Peters, J.M. Peroxisome Proliferator-Activated Receptor-Beta/Delta (PPARbeta/Delta) Ligands Do Not Potentiate Growth of Human Cancer Cell Lines. Carcinogenesis 2007 , 28 , 2641–2649. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Pedchenko, T.V.; Gonzalez, A.L.; Wang, D.; DuBois, R.N.; Massion, P.P. Peroxisome Proliferator-Activated Receptor Beta/Delta Expression and Activation in Lung Cancer. Am. J. Respir. Cell Mol. Biol. 2008 , 39 , 689–696. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Borland, M.G.; Foreman, J.E.; Girroir, E.E.; Zolfaghari, R.; Sharma, A.K.; Amin, S.; Gonzalez, F.J.; Ross, A.C.; Peters, J.M. Ligand Activation of Peroxisome Proliferator-Activated Receptor-Beta/Delta Inhibits Cell Proliferation in Human HaCaT Keratinocytes. Mol. Pharmacol. 2008 , 74 , 1429–1442. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ahmed, N.; Riley, C.; Quinn, M.A. An Immunohistochemical Perspective of PPAR Beta and One of Its Putative Targets PDK1 in Normal Ovaries, Benign and Malignant Ovarian Tumours. Br. J. Cancer 2008 , 98 , 1415–1424. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Billin, A.N. PPAR-Beta/Delta Agonists for Type 2 Diabetes and Dyslipidemia: An Adopted Orphan Still Looking for a Home. Expert Opin. Investig. Drugs 2008 , 17 , 1465–1471. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gallardo-Soler, A.; Gómez-Nieto, C.; Campo, M.L.; Marathe, C.; Tontonoz, P.; Castrillo, A.; Corraliza, I. Arginase I induction by modified lipoproteins in macrophages: A peroxisome proliferator-activated receptor-gamma/delta-mediated effect that links lipid metabolism and immunity. Mol. Endocrinol. 2008 , 22 , 1394–1402. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Fernandez, A.Z. Peroxisome proliferator-activated receptors in the modulation of the im-mune/inflammatory response in atherosclerosis. PPAR Res. 2008 , 2008 , 285842. [ Google Scholar ] [ CrossRef ]
• Takata, Y.; Liu, J.; Yin, F.; Collins, A.R.; Lyon, C.J.; Lee, C.H.; Atkins, A.R.; Downes, M.; Barish, G.D.; Evans, R.M.; et al. PPARdelta-mediated antiinflammatory mechanisms inhibit angiotensin II-accelerated atherosclerosis. Proc. Natl. Acad. Sci. USA 2008 , 105 , 4277–4282. [ Google Scholar ] [ CrossRef ]
• Cavalieri, D.; Calura, E.; Romualdi, C.; Marchi, E.; Radonjic, M.; Van Ommen, B.; Müller, M. Filling gaps in PPAR-alpha signaling through comparative nutrigenomics analysis. BMC Genom. 2009 , 10 , 596. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Porcuna, J.; Mínguez-Martínez, J.; Ricote, M. The PPARα and PPARγ Epigenetic Landscape in Cancer and Immune and Metabolic Disorders. Int. J. Mol. Sci. 2021 , 22 , 10573. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Małodobra-Mazur, M.; Cierzniak, A.; Ryba, M.; Sozański, T.; Piórecki, N.; Kucharska, A.Z. Cornus mas L. Increases Glucose Uptake and the Expression of PPARG in Insulin-Resistant Adipocytes. Nutrients 2022 , 14 , 2307. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Danesi, F.; Di Nunzio, M.; Boschetti, E.; Bordoni, A. Green Tea Extract Selectively Activates Peroxisome Proliferator-Activated Receptor Beta/Delta in Cultured Cardiomyocytes. Br. J. Nutr. 2009 , 101 , 1736–1739. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jiang, B.; Liang, P.; Zhang, B.; Song, J.; Huang, X.; Xiao, X. Role of PPAR-Beta in Hydrogen Peroxide-Induced Apoptosis in Human Umbilical Vein Endothelial Cells. Atherosclerosis 2009 , 204 , 353–358. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jiang, B.; Liang, P.; Zhang, B.; Huang, X.; Xiao, X. Enhancement of PPAR-β Activity by Repetitive Low-Grade H 2 O 2 Stress Protects Human Umbilical Vein Endothelial Cells from Subsequent Oxidative Stress-Induced Apoptosis. Free Radic. Biol. Med. 2009 , 46 , 555–563. [ Google Scholar ] [ CrossRef ]
• Bishop-Bailey, D.; Bystrom, J. Emerging Roles of Peroxisome Proliferator-Activated Receptor-Beta/Delta in Inflammation. Pharmacol. Ther. 2009 , 124 , 141–150. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ramanan, S.; Zhao, W.; Riddle, D.R.; Robbins, M.E. Role of PPARs in Radiation-Induced Brain Injury. PPAR Res. 2010 , 2010 , 234975. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Genovese, S.; Foreman, J.E.; Borland, M.G.; Epifano, F.; Gonzalez, F.J.; Curini, M.; Peters, J.M. A natural propenoic acid derivative activates peroxisome proliferator-activated receptor-beta/delta (PPARbeta/delta). Life Sci. 2010 , 86 , 493–498. [ Google Scholar ] [ CrossRef ]
• Grimaldi, P.A. Metabolic and Nonmetabolic Regulatory Functions of Peroxisome Proliferator-Activated Receptor Beta. Curr. Opin. Lipidol. 2010 , 21 , 186–191. [ Google Scholar ] [ CrossRef ]
• McKinnon, B.; Bersinger, N.A.; Huber, A.W.; Kuhn, A.; Mueller, M.D. PPAR-γ Expression in Peritoneal Endometriotic Lesions Correlates with Pain Experienced by Patients. Fertil. Steril. 2010 , 93 , 293–296. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Mistry, N.F.; Cresci, S. PPAR transcriptional activator complex polymorphisms and the promise of individualized therapy for heart failure. Heart Fail Rev. 2010 , 15 , 197–207. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bassaganya-Riera, J.; Song, R.; Roberts, P.C.; Hontecillas, R. PPAR-gamma activation as an anti-inflammatory therapy for respiratory virus infections. Viral Immunol. 2010 , 23 , 343–352. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Housley, W.J.; Adams, C.O.; Vang, A.G.; Brocke, S.; Nichols, F.C.; LaCombe, M.; Rajan, T.V.; Clark, R.B. Peroxisome proliferator-activated receptor gamma is required for CD4+ T cell-mediated lymphopenia-associated autoimmunity. J. Immunol. 2011 , 187 , 4161–4169. [ Google Scholar ] [ CrossRef ]
• Shahin, D.; Toraby, E.E.; Abdel-Malek, H.; Boshra, V.; Elsamanoudy, A.Z.; Shaheen, D. Effect of peroxisome proliferator-activated receptor gamma agonist (pioglitazone) and methotrexate on disease activity in rheumatoid arthritis (experimental and clinical study). Clin. Med. Insights Arthritis Musculoskelet Disord. 2011 , 4 , 1–10. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sertznig, P.; Reichrath, J. Peroxisome proliferator-activated receptors (PPARs) in dermatology: Challenge and promise. Dermatoendocrinol 2011 , 3 , 130–135. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Laschke, M.W.; Menger, M.D. Anti-angiogenic treatment strategies for the therapy of endometriosis. Hum. Reprod. Update. 2012 , 18 , 682–702. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Nickkho-Amiry, M.; McVey, R.; Holland, C. Peroxisome proliferator-activated receptors modulate proliferation and angiogenesis in human endometrial carcinoma. Mol. Cancer Res. 2012 , 10 , 441–453. [ Google Scholar ] [ CrossRef ]
• Knapp, P.; Chabowski, A.; Błachnio-Zabielska, A.; Jarząbek, K.; Wołczyński, S. Altered peroxisome-proliferator activated receptors expression in human endometrial cancer. PPAR Res. 2011 , 2012 , 471524. [ Google Scholar ] [ CrossRef ]
• Montero, T.D.; Racordon, D.; Bravo, L.; Owen, G.I.; Bronfman, M.L.; Leisewitz, A.V. PPARα and PPARγ regulate the nucleoside transporter hENT1. Biochem. Biophys. Res. Commun. 2012 , 419 , 405–411. [ Google Scholar ] [ CrossRef ]
• Abbas, A.; Blandon, J.; Rude, J.; Elfar, A.; Mukherjee, D. PPAR- γ agonist in treatment of diabetes: Cardiovascular safety considerations. Cardiovasc. Hematol. Agents Med. Chem. 2012 , 10 , 124–134. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Chen, Y.C.; Wu, J.S.; Tsai, H.D.; Huang, C.Y.; Chen, J.J.; Sun, G.Y.; Lin, T.N. Peroxisome proliferator-activated receptor gamma (PPAR-γ) and neurodegenerative disorders. Mol. Neurobiol. 2012 , 46 , 114–124. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Greene, N.P.; Fluckey, J.D.; Lambert, B.S.; Greene, E.S.; Riechman, S.E.; Crouse, S.F. Regulators of blood lipids and lipoproteins? PPARδ and AMPK, induced by exercise, are correlated with lipids and lipoproteins in overweight/obese men and women. Am. J. Physiol. Endocrinol. Metab. 2012 , 303 , E1212–E1221. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wadosky, K.M.; Willis, M.S. The story so far: Post-translational regulation of peroxisome proliferator-activated receptors by ubiquitination and SUMOylation. Am. J. Physiol. Heart Circ. Physiol. 2012 , 302 , H515–H526. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Peyrou, M.; Ramadori, P.; Bourgoin, L.; Foti, M. PPARs in Liver Diseases and Cancer: Epigenetic Regulation by MicroRNAs. PPAR Res. 2012 , 2012 , 757803. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Costa, V.; Ciccodicola, A. Is PPARG the key gene in diabetic retinopathy? Br. J. Pharmacol. 2012 , 165 , 1–3. [ Google Scholar ] [ CrossRef ]
• Balakumar, P.; Mahadevan, N. Interplay between statins and PPARs in improving cardiovascular outcomes: A double-edged sword? Br. J. Pharmacol. 2012 , 165 , 373–379. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wahli, W.; Michalik, L. PPARs at the crossroads of lipid signaling and inflammation. Trends. Endocrinol. Metab. 2012 , 23 , 351–363. [ Google Scholar ] [ CrossRef ]
• Reichenbach, G.; Starzinski-Powitz, A.; Sloane, B.F.; Doll, M.; Kippenberger, S.; Bernd, A.; Kaufmann, R.; Meissner, M. PPARα agonist Wy14643 suppresses cathepsin B in human endothelial cells via transcriptional, post-transcriptional and post-translational mechanisms. Angiogenesis 2013 , 16 , 223–233. [ Google Scholar ] [ CrossRef ]
• Tailleux, A.; Wouters, K.; Staels, B. Roles of PPARs in NAFLD: Potential therapeutic targets. Biochim. Biophys. Acta 2012 , 1821 , 809–818. [ Google Scholar ] [ CrossRef ]
• Videla, L.A.; Pettinelli, P. Misregulation of PPAR Functioning and Its Pathogenic Consequences Associated with Nonalcoholic Fatty Liver Disease in Human Obesity. PPAR Res. 2012 , 2012 , 107434. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Benedusi, V.; Martorana, F.; Brambilla, L.; Maggi, A.; Rossi, D. The Peroxisome Proliferator-activated Receptor γ (PPARγ) Controls Natural Protective Mechanisms against Lipid Peroxidation in Amyotrophic Lateral Sclerosis*. J. Biol. Chem. 2012 , 287 , 35899–35911. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hu, W.; Wang, X.; Ding, X.; Li, Y.; Zhang, X.; Xie, P.; Yang, J.; Wang, S. MicroRNA-141 represses HBV replication by targeting PPARA. PLoS ONE 2012 , 7 , e34165. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Zuo, C.; Liang, P.; Huang, X. Role of PPARbeta in fibroblast response to heat injury. Indian J. Biochem. Biophys. 2012 , 49 , 219–227. [ Google Scholar ] [ PubMed ]
• Le Foll, B.; Di Ciano, P.; Panlilio, L.V.; Goldberg, S.R.; Ciccocioppo, R. Peroxisome proliferator-activated receptor (PPAR) agonists as promising new medications for drug addiction: Preclinical evidence. Curr. Drug Targets 2013 , 14 , 768–776. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aleshin, S.; Reiser, G. Role of the peroxisome proliferator-activated receptors (PPAR)-α, β/δ and γ triad in regulation of reactive oxygen species signaling in brain. Biol. Chem. 2013 , 394 , 1553–1570. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Contreras, A.V.; Torres, N.; Tovar, A.R. PPAR-α as a key nutritional and environmental sensor for metabolic adaptation. Adv. Nutr. 2013 , 4 , 439–452. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Akyürek, N.; Aycan, Z.; Çetinkaya, S.; Akyürek, Ö.; Yilmaz Ağladioğlu, S.; Ertan, Ü. Peroxisome proliferator activated receptor (PPAR)-gamma concentrations in childhood obesity. Scand J. Clin. Lab. Investig. 2013 , 73 , 355–360. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yao, P.L.; Morales, J.L.; Zhu, B.; Kang, B.H.; Gonzalez, F.J.; Peters, J.M. Activation of Peroxisome Proliferator-Activated Receptor-β/δ (PPAR-β/δ) Inhibits Human Breast Cancer Cell Line Tumorigenicity. Mol. Cancer Ther. 2014 , 13 , 1008–1017. [ Google Scholar ] [ CrossRef ]
• Young, K.C.; Bai, C.H.; Su, H.C.; Tsai, P.J.; Pu, C.Y.; Liao, C.S.; Tsao, C.W. Fluoxetine a novel anti-hepatitis C virus agent via ROS-, JNK-, and PPARβ/γ-dependent pathways. Antivir. Res. 2014 , 110 , 158–167. [ Google Scholar ] [ CrossRef ]
• Montagner, A.; Wahli, W.; Tan, N.S. Nuclear receptor peroxisome proliferator activated receptor (PPAR) β/δ in skin wound healing and cancer. Eur. J. Dermatol. 2015 , Suppl. 1 , 4–11. [ Google Scholar ] [ CrossRef ]
• de Melo, N.F.; de Macedo, C.G.; Bonfante, R.; Abdalla, H.B.; da Silva, C.M.; Pasquoto, T.; de Lima, R.; Fraceto, L.F.; Clemente-Napimoga, J.T.; Napimoga, M.H. 15d-PGJ2-Loaded Solid Lipid Nanopar-ticles: Physicochemical Characterization and Evaluation of Pharmacological Effects on In-flammation. PLoS ONE 2016 , 11 , e0161796. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Xue, Y.; Xu, X.; Zhang, X.Q.; Farokhzad, O.C.; Langer, R. Preventing diet-induced obesity in mice by adipose tissue transformation and angiogenesis using targeted nanoparticles. Proc. Natl. Acad. Sci. USA. 2016 , 113 , 5552–5557. [ Google Scholar ] [ CrossRef ]
• Strojny, B.; Grodzik, M.; Sawosz, E.; Winnicka, A.; Kurantowicz, N.; Jaworski, S.; Kutwin, M.; Urbańska, K.; Hotowy, A.; Wierzbicki, M.; et al. Diamond Nanoparticles Modify Curcumin Activity: In Vitro Studies on Cancer and Normal Cells and In Ovo Studies on Chicken Embryo Model. PLoS ONE 2016 , 11 , e0164637. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Fidoamore, A.; Cristiano, L.; Laezza, C.; Galzio, R.; Benedetti, E.; Cinque, B.; d’Angelo, M.; Castelli, V.; Cifone, M.G.; Ippoliti, R.; et al. Annamaria Cimini Energy metabolism in glioblastoma stem cells: PPARα a metabolic adaptor to intratumoral microenvironment. Oncotarget 2017 , 8 , 108430–108450. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rolver, M.G.; Holland, L.K.K.; Ponniah, M.; Prasad, N.S.; Yao, J.; Schnipper, J.; Kramer, S.; Elingaard-Larsen, L.; Pedraz-Cuesta, E.; Liu, B.; et al. Chronic acidosis rewires cancer cell metabolism through PPARα signaling. Int. J. Cancer. 2023 , 152 , 1668–1684. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kado, T.; Kusakari, N.; Tamaki, T.; Murota, K.; Tsujiuchi, T.; Fukushima, N. Oleic acid stimulates cell proliferation and BRD4-L-MYC-dependent glucose transporter transcription through PPARα activation in ovarian cancer cells. Biochem. Biophys. Res. Commun. 2023 , 657 , 24–34. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wright, S.K.; Wuertz, B.R.; Harris, G.; Abu Ghazallah, R.; Miller, W.A.; Gaffney, P.M.; Ondrey, F.G. Functional Activation of PPARγ in Human Upper Aerodigestive Cancer Cell Lines. Mol. Carcinog. 2017 , 56 , 149–162. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ivanova, E.A.; Myasoedova, V.A.; Melnichenko, A.A.; Orekhov, A.N. Peroxisome Proliferator-Activated Receptor (PPAR) Gamma Agonists as Therapeutic Agents for Cardiovascular Disorders: Focus on Atherosclerosis. Curr. Pharm. Des. 2017 , 23 , 1119–1124. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gross, B.; Pawlak, M.; Lefebvre, P.; Staels, B. PPARs in Obesity-Induced T2DM, Dyslipidaemia and NAFLD. Nat. Rev. Endocrinol. 2017 , 13 , 36–49. [ Google Scholar ] [ CrossRef ]
• Borland, M.G.; Kehres, E.M.; Lee, C.; Wagner, A.L.; Shannon, B.E.; Albrecht, P.P.; Zhu, B.; Gonzalez, F.J.; Peters, J.M. Inhibition of tumorigenesis by peroxisome proliferator-activated receptor (PPAR)-dependent cell cycle blocks in human skin carcinoma cells. Toxicology 2018 , 404–405 , 25–32. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Leiguez, E.; Giannotti, K.C.; Viana, M.D.N.; Matsubara, M.H.; Fernandes, C.M.; Gutiérrez, J.M.; Lomonte, B.; Teixeira, C. A Snake Venom-Secreted Phospholipase A2 Induces Foam Cell Formation Depending on the Activation of Factors Involved in Lipid Homeostasis. Mediat. Inflamm. 2018 , 2018 , 2547918. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sun, H.; Shao, W.; Liu, H.; Jiang, Z. Exposure to 2,4-dichlorophenoxyacetic acid induced PPARβ-dependent disruption of glucose metabolism in HepG2 cells. Environ. Sci. Pollut. Res. 2018 , 25 , 17050–17057. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Quintão, N.L.M.; Santin, J.R.; Stoeberl, L.C.; Corrêa, T.P.; Melato, J.; Costa, R. Pharmacological Treatment of Chemotherapy-Induced Neuropathic Pain: PPAR Agonists as a Promising Tool. Front. Neurosci. 2019 , 13 , 907. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Vallée, A.; Lecarpentier, Y.; Vallée, J.N. Targeting the Canonical WNT/β-Catenin Pathway in Cancer Treatment Using Non-Steroidal Anti-Inflammatory Drugs. Cells 2019 , 8 , 726. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Toraih, E.A.; Fawzy, M.S.; Abushouk, A.I.; Shaheen, S.; Hobani, Y.H.; Alruwetei, A.M.; Badran, D.I. Prognostic Value of the miRNA-27a and PPAR/RXRα Signaling Axis in Patients with Thyroid Carcinoma. Epigenomics 2020 , 12 , 1825–1843. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hirao-Suzuki, M.; Takeda, S.; Koga, T.; Takiguchi, M.; Toda, A. Cannabidiolic acid dampens the expression of cyclooxygenase-2 in MDA-MB-231 breast cancer cells: Possible implication of the peroxisome proliferator-activated receptor β/δ abrogation. J. Toxicol. Sci. 2020 , 45 , 227–236. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Elie-Caille, C.; Lascombe, I.; Péchery, A.; Bittard, H.; Fauconnet, S. Molecular and nanoscale evaluation of N-cadherin expression in invasive bladder cancer cells under control conditions or GW501516 exposure. Mol. Cell Biochem. 2020 , 471 , 113–127. [ Google Scholar ] [ CrossRef ]
• Moosavi, S.M.; Akhavan Sepahi, A.; Mousavi, S.F.; Vaziri, F.; Siadat, S.D. The effect of Faecalibacterium prausnitzii and its extracellular vesicles on the permeability of intestinal epithelial cells and expression of PPARs and ANGPTL4 in the Caco-2 cell culture model. J. Diabetes Metab. Disord. 2020 , 19 , 1061–1069. [ Google Scholar ] [ CrossRef ]
• Liu, X.; Qian, D.; Liu, H.; Abbruzzese, J.L.; Luo, S.; Walsh, K.M.; Wei, Q. Genetic variants of the peroxisome proliferator-activated receptor (PPAR) signaling pathway genes and risk of pancreatic cancer. Mol Carcinog. 2020 , 59 , 930–939. [ Google Scholar ] [ CrossRef ]
• Wouters, E.; Grajchen, E.; Jorissen, W.; Dierckx, T.; Wetzels, S.; Loix, M.; Tulleners, M.P.; Staels, B.; Stinissen, P.; Haidar, M.; et al. Altered PPARγ Expression Promotes Myelin-Induced Foam Cell Formation in Macrophages in Multiple Sclerosis. Int. J. Mol. Sci. 2020 , 21 , 9329. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Xia, Y.; Li, J.; Chen, K.; Feng, J.; Guo, C. Bergenin Attenuates Hepatic Fibrosis by Regulating Autophagy Mediated by the PPAR- γ /TGF- β Pathway. PPAR Res. 2020 , 2020 , e6694214. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Shen, J.; Sun, B.; Yu, C.; Cao, Y.; Cai, C.; Yao, J. Choline and methionine regulate lipid metabolism via the AMPK signaling pathway in hepatocytes exposed to high concentrations of nonesterified fatty acids. J. Cell Biochem. 2020 , 121 , 3667–3678. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yu, J.; Berga, S.L.; Zou, W.; Rajakumar, A.; Man, M.; Sidell, N.; Taylor, R.N. Human Endometrial Stromal Cell Differentiation is Stimulated by PPARβ/δ Activation: New Targets for Infertility? J. Clin. Endocrinol. Metab. 2020 , 105 , 2983–2995. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Zhang, C.; Liu, Y.W.; Chi, Z.; Chen, B. Ligand-Activated Peroxisome Proliferator-Activated Receptor β / δ Facilitates Cell Proliferation in Human Cholesteatoma Keratinocytes. PPAR Res. 2020 , 2020 , e8864813. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wójtowicz, S.; Strosznajder, A.K.; Jeżyna, M.; Strosznajder, J.B. The Novel Role of PPAR Alpha in the Brain: Promising Target in Therapy of Alzheimer’s Disease and Other Neurodegenerative Disorders. Neurochem. Res. 2020 , 45 , 972–988. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Manickam, R.; Duszka, K.; Wahli, W. PPARs and Microbiota in Skeletal Muscle Health and Wasting. Int. J. Mol. Sci. 2020 , 21 , 8056. [ Google Scholar ] [ CrossRef ]
• da Cruz, B.O.; Cardozo, L.F.M.F.; Magliano, D.C.; Stockler-Pinto, M.B. Nutritional strategies to modulate inflammation pathways via regulation of peroxisome proliferator-activated receptor β/δ. Nutr. Rev. 2020 , 78 , 207–214. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wagner, K.D.; Wagner, N. PPARs and Myocardial Infarction. Int. J. Mol. Sci. 2020 , 21 , 9436. [ Google Scholar ] [ CrossRef ]
• Phua, W.W.T.; Tan, W.R.; Yip, Y.S.; Hew, I.D.; Wee, J.W.K.; Cheng, H.S.; Leow, M.K.S.; Wahli, W.; Tan, N.S. PPARβ/δ Agonism Upregulates Forkhead Box A2 to Reduce Inflammation in C2C12 Myoblasts and in Skeletal Muscle. Int. J. Mol. Sci. 2020 , 21 , 1747. [ Google Scholar ] [ CrossRef ]
• Zhang, Z.; Su, H.; Ahmed, R.Z.; Zheng, Y.; Jin, X. Critical biomarkers for myocardial damage by fine particulate matter: Focused on PPARα-regulated energy metabolism. Environ. Pollut. 2020 , 264 , 114659. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Andrade-Souza, V.A.; Ghiarone, T.; Sansonio, A.; Santos Silva, K.A.; Tomazini, F.; Arcoverde, L.; Fyfe, J.; Perri, E.; Saner, N.; Kuang, J.; et al. Exercise twice-a-day potentiates markers of mitochondrial biogenesis in men. FASEB J. 2020 , 34 , 1602–1619. [ Google Scholar ] [ CrossRef ]
• Faulkner, A.; Lynam, E.; Purcell, R.; Jones, C.; Lopez, C.; Board, M.; Wagner, K.-D.; Wagner, N.; Carr, C.; Wheeler-Jones, C. Context-dependent regulation of endothelial cell metabolism: Differential effects of the PPARβ/δ agonist GW0742 and VEGF-A. Sci. Rep. 2020 , 10 , 7849. [ Google Scholar ] [ CrossRef ]
• Chai, C.Y.; Tai, I.C.; Zhou, R.; Song, J.; Zhang, C.; Sun, S. MicroRNA-9-5p inhibits proliferation and induces apoptosis of human hypertrophic scar fibroblasts through targeting peroxisome proliferator-activated receptor β. Biol. Open. 2020 , 9 , bio051904. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Capozzi, M.E.; Savage, S.R.; McCollum, G.W.; Hammer, S.S.; Ramos, C.J.; Yang, R.; Bretz, C.A.; Penn, J.S. The peroxisome proliferator-activated receptor-β/δ antagonist GSK0660 mitigates retinal cell inflammation and leukostasis. Exp. Eye Res. 2020 , 190 , 107885. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Contreras-Lopez, R.A.; Elizondo-Vega, R.; Torres, M.J.; Vega-Letter, A.M.; Luque-Campos, N.; Paredes-Martinez, M.J.; Pradenas, C.; Tejedor, G.; Oyarce, K.; Salgado, M.; et al. PPARβ/δ-dependent MSC metabolism determines their immunoregulatory properties. Sci. Rep. 2020 , 10 , 11423. [ Google Scholar ] [ CrossRef ]
• Petr, M.; Maciejewska-Skrendo, A.; Zajac, A.; Chycki, J.; Stastny, P. Association of Elite Sports Status with Gene Variants of Peroxisome Proliferator Activated Receptors and Their Transcriptional Coactivator. Int. J. Mol. Sci. 2019 , 21 , 162. [ Google Scholar ] [ CrossRef ]
• Tutunchi, H.; Ostadrahimi, A.; Saghafi-Asl, M.; Hosseinzadeh-Attar, M.J.; Shakeri, A.; Asghari-Jafarabadi, M.; Roshanravan, N.; Farrin, N.; Naemi, M.; Hasankhani, M. Oleoylethanolamide supplementation in obese patients newly diagnosed with non-alcoholic fatty liver disease: Effects on metabolic parameters, anthropometric indices, and expression of PPAR-α, UCP1, and UCP2 genes. Pharmacol. Res. 2020 , 156 , 104770. [ Google Scholar ] [ CrossRef ]
• Grabacka, M.; Pierzchalska, M.; Płonka, P.M.; Pierzchalski, P. The Role of PPAR Alpha in the Modulation of Innate Immunity. Int. J. Mol. Sci. 2021 , 22 , 10545. [ Google Scholar ] [ CrossRef ]
• Willems, S.; Morstein, J.; Hinnah, K.; Trauner, D.; Merk, D. A Photohormone for Light-Dependent Control of PPARα in Live Cells. J. Med. Chem. 2021 , 64 , 10393–10402. [ Google Scholar ] [ CrossRef ]
• Kharbanda, C.; Alam, M.S.; Hamid, H.; Ali, Y.; Nazreen, S.; Dhulap, A.; Alam, P.; Pasha, M.A.Q. In Silico Designing, in Vitro and in Vivo Evaluation of Potential PPAR-γ Agonists Derived from Aryl Propionic Acid Scaffold. Bioorganic Chem. 2021 , 106 , 104458. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Christofides, A.; Konstantinidou, E.; Jani, C.; Boussiotis, V.A. The role of peroxisome proliferator-activated receptors (PPAR) in immune responses. Metabolism 2021 , 114 , 154338. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rayner, M.L.D.; Healy, J.; Phillips, J.B. Repurposing Small Molecules to Target PPAR-γ as New Therapies for Peripheral Nerve Injuries. Biomolecules 2021 , 11 , 1301. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Stark, J.M.; Coquet, J.M.; Tibbitt, C.A. The Role of PPAR-γ in Allergic Disease. Curr. Allergy Asthma Rep. 2021 , 21 , 45. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hasegawa, S.; Yoneda, M.; Kurita, Y.; Nogami, A.; Honda, Y.; Hosono, K.; Nakajima, A. Cholestatic Liver Disease: Current Treatment Strategies and New Therapeutic Agents. Drugs 2021 , 81 , 1181–1192. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Mukherjee, A.G.; Wanjari, U.R.; Gopalakrishnan, A.V.; Katturajan, R.; Kannampuzha, S.; Murali, R.; Namachivayamm, A.; Ganesan, R.; Renu, K.; Dey, A.; et al. Exploring the Regulatory Role of ncRNA in NAFLD: A Particular Focus on PPARs. Cells 2022 , 24 , 3959. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dandare, A.; Khan, M.J.; Naeem, A.; Liaquat, A. Clinical relevance of circulating non-coding RNAs in metabolic diseases: Emphasis on obesity, diabetes, cardiovascular diseases and metabolic syndrome. Genes Dis. 2022 , 10 , 2393–2413. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Chatzopoulou, F.; Kyritsis, K.A.; Papagiannopoulos, C.I.; Galatou, E.; Mittas, N.; Theodoroula, N.F.; Papazoglou, A.S.; Karagiannidis, E.; Chatzidimitriou, M.; Papa, A.; et al. Dissecting miRNA-Gene Networks to Map Clinical Utility Roads of Pharmacogenomics-Guided Therapeutic Decisions in Cardiovascular Precision Medicine. Cells 2022 , 11 , 607. [ Google Scholar ] [ CrossRef ]
• Kaltdorf, M.; Breitenbach, T.; Karl, S.; Fuchs, M.; Kessie, D.K.; Psota, E.; Prelog, M.; Sarukhanyan, E.; Ebert, R.; Jakob, F.; et al. Software JimenaE allows efficient dynamic simulations of Boolean networks, centrality and system state analysis. Sci. Rep. 2023 , 13 , 1855. [ Google Scholar ] [ CrossRef ]
• Tanaka, Y.; Minami, Y.; Endo, M. Ror1 promotes PPARα-mediated fatty acid metabolism in astrocytes. Genes Cells. 2023 , 28 , 307–318. [ Google Scholar ] [ CrossRef ]
• Ibrahim, M.A.A.; Abdeljawaad, K.A.A.; Roshdy, E.; Mohamed, D.E.M.; Ali, T.F.S.; Gabr, G.A.; Jaragh-Alhadad, L.A.; Mekhemer, G.A.H.; Shawky, A.M.; Sidhom, P.A.; et al. In Silico Drug Discovery of SIRT2 Inhibitors from Natural Source as Anticancer Agents. Sci. Rep. 2023 , 13 , 2146. [ Google Scholar ] [ CrossRef ]
• Yang, W.; Ling, X.; He, S.; Cui, H.; Yang, Z.; An, H.; Wang, L.; Zou, P.; Chen, Q.; Liu, J.; et al. PPARα/ACOX1 as a novel target for hepatic lipid metabolism disorders induced by per- and polyfluoroalkyl substances: An integrated approach. Environ. Int. 2023 , 178 , 108138. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Zhou, B.; Zhao, G.; Li, H.; Zhao, Q.; Liu, D. FNDC5/PPARa Pathway Alleviates THP-1-derived Macrophage Pyroptosis and Its Mechanism. Altern. Ther. Health Med. 2023 , 29 , 32–42. [ Google Scholar ] [ PubMed ]
• Páscoa, I.; Biltes, R.; Sousa, J.; Preto, M.A.C.; Vasconcelos, V.; Castro, L.F.; Ruivo, R.; Cunha, I. A Multiplex Molecular Cell-Based Sensor to Detect Ligands of PPARs: An Optimized Tool for Drug Discovery in Cyanobacteria. Sensors 2023 , 23 , 1338. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kim, G.; Chen, Z.; Li, J.; Luo, J.; Castro-Martinez, F.; Wisniewski, J.; Cui, K.; Wang, Y.; Sun, J.; Ren, X.; et al. Gut-liver axis calibrates intestinal stem cell fitness. Cell. 2024 , 187 , 914–930.e20. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Liu, P.; Li, Q.; Zhu, G.; Zhang, T.; Tu, D.; Zhang, F.; Finel, M.; He, Y.; Ge, G. Characterization of the Glucuronidating Pathway of Pectolinarigenin, the Major Active Constituent of the Chinese Medicine Daji, in Humans and Its Influence on Biological Activities. J. Ethnopharmacol. 2024 , 319 , 117280. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Cheng, P.; Wei, H.-Z.; Chen, H.-W.; Wang, Z.-Q.; Mao, P.; Zhang, H.-H. DNMT3a-Mediated Methylation of PPARγ Promote Intervertebral Disc Degeneration by Regulating the NF-κB Pathway. J. Cell. Mol. Med. 2024 , 28 , e18048. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Shyni, G.L.; Kavitha, S.; Indu, S.; Arya, A.D.; Anusree, S.S.; Vineetha, V.P.; Vandana, S.; Sundaresan, A.; Raghu, K.G. Chebulagic acid from Terminalia chebula enhances insulin mediated glucose uptake in 3T3-L1 adipocytes via PPARγ signaling pathway. Biofactors 2014 , 40 , 646–657. [ Google Scholar ] [ CrossRef ]
• Zhang, D.; Wei, G. Green tea and the prevention of breast cancer: A case-control study in Southeast China. Carcinogenesis 2009 , 30 , 1351–1356. [ Google Scholar ] [ CrossRef ]
• Tang, J.; Zheng, J.S.; Fang, L.; Jin, Y. Catechins and their therapeutic benefits to inflammatory bowel disease. Molecules 2009 , 14 , 5004–5015. [ Google Scholar ]
• Chen, Z.P.; Schell, J.B.; Ho, C.T.; Chen, K.Y.; Li, S. Green tea epigallocatechin gallate shows a pronounced growth inhibitory effect on cancerous cells but not on their normal counterparts. Cancer Lett. 2020 , 278 , 101–112. [ Google Scholar ] [ CrossRef ]
• Shao, M.; Guo, D.; Lu, W.; Chen, X.; Ma, L.; Wu, Y.; Zhang, X.; Wang, Q.; Wang, X.; Li, W.; et al. Identification of the active compounds and drug targets of Chinese medicine in heart failure based on the PPARs-RXRα pathway. J. Ethnopharmacol. 2020 , 257 , 112859. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Tang, G.; Li, S.; Zhang, C.; Chen, H.; Wang, N.; Feng, Y. Clinical efficacies, underlying mechanisms and molecular targets of Chinese medicines for diabetic nephropathy treatment and management. Acta Pharm. Sin B. 2021 , 11 , 2749–2767. [ Google Scholar ] [ CrossRef ]
• Xu, R.; Zhang, J.; Hu, X.; Xu, P.; Huang, S.; Cui, S.; Guo, Y.; Yang, H.; Chen, X.; Jiang, C. Yi-shen-hua-shi granules modulate immune and inflammatory damage via the ALG3/PPARγ/NF-κB pathway in the treatment of immunoglobulin a nephropathy. J. Ethnopharmacol. 2024 , 319 , 117204. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yuan, Z.; Qiao, H.; Wang, Z.; Wang, H.; Han, M.; Zhang, W.; Zhou, Y.; Hassan, H.M.; Zhao, W.; Qin, T. Taohe Chengqi decoction alleviated metabolic-associated fatty liver disease by boosting branched chain amino acids catabolism in the skeletal muscles of type 2 diabetes mellitus. Phytomedicine 2024 , 126 , 155315. [ Google Scholar ] [ CrossRef ]
• Kuttan, R.; Bhanumathy, P.; Nirmala, K.; George, M.C.; Maliakel, B. Potential anticancer activity of turmeric (Curcuma longa). Cancer Lett. 2009 , 136 , 11–16. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aggarwal, B.B.; Sung, B. Pharmacological basis for the role of curcumin in chronic diseases: An age-old spice with modern targets. Trends Pharmacol. Sci. 2009 , 30 , 85–94. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Anandharajan, R.; Jaiganesh, S.; Shankernarayanan, N.P.; Viswakarma, R.A.; Balakrishnan, A. In vitro glucose uptake activity of Aegles marmelos and Syzygium cumini by activation of Glut-4, PI3 kinase and PPARgamma in L6 myotubes. Phytomedicine 2006 , 13 , 434–441. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Khosropoor, S.; Alavi, M.S.; Etemad, L.; Roohbakhsh, A. Cannabidiol goes nuclear: The role of PPARγ. Phytomedicine 2023 , 114 , 154771. [ Google Scholar ] [ CrossRef ]
• Burstein, S. PPAR-gamma: A nuclear receptor with affinity for cannabinoids. Life Sci. 2005 , 77 , 1674–1684. [ Google Scholar ] [ CrossRef ]
• Mechoulam, R.; Parker, L.A.; Gallily, R. Cannabidiol: An overview of some pharmacological aspects. J. Clin. Pharmacol. 2002 , 42 (Suppl. S11), 11S–19S. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Robson, P. Human studies of cannabinoids and medicinal cannabis. Handb. Exp. Pharmacol. 2005 , 168 , 719–756. [ Google Scholar ] [ CrossRef ]
• Sun, Y.; Alexander, S.P.; Kendall, D.A.; Bennett, A.J. Cannabinoids and PPARalpha signalling. Biochem. Soc. Trans. 2006 , 34 , 1095–1097. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Brown, I.; Cascio, M.G.; Rotondo, D.; Pertwee, R.G.; Heys, S.D.; Wahle, K.W. Cannabinoids and omega-3/6 endocannabinoids as cell death and anticancer modulators. Prog. Lipid Res. 2013 , 52 , 80–109. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Blüher, M.; Lübben, G.; Paschke, R. Analysis of the relationship between the Pro12Ala variant in the PPAR-gamma2 gene and the response rate to therapy with pioglitazone in patients with type 2 diabetes. Diabetes Care 2003 , 26 , 825–831. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Blüher, M.; Klemm, T.; Gerike, T.; Krankenberg, H.; Schuler, G.; Paschke, R. Lack of association between peroxisome proliferator-activated receptor-gamma-2 gene variants and the occurrence of coronary heart disease in patients with diabetes mellitus. Eur. J. Endocrinol. 2002 , 146 , 545–551. [ Google Scholar ] [ CrossRef ]
• Usuda, D.; Kanda, T. Peroxisome proliferator-activated receptors for hypertension. World J. Cardiol. 2014 , 6 , 744–754. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Berger, J.; Leibowitz, M.D.; Doebber, T.W.; Elbrecht, A.; Zhang, B.; Zhou, G.; Biswas, C.; Cullinan, C.A.; Hayes, N.S.; Li, Y.; et al. Novel peroxisome proliferator-activated receptor (PPAR) gamma and PPARdelta ligands produce distinct biological effects. J. Biol. Chem. 1999 , 274 , 6718–6725. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bidzińska, B.; Demissie, M.; Tworowska, U.; Milewicz, A. Receptory aktywowane przez proliferatory peroksysomów a gospodarka lipidowa i węglowodanowa—rola fizjologiczna i znaczenie kliniczne. Diabetol. Pol. 2000 , 7 , 258–264. (In Polish) [ Google Scholar ]
• Houseknecht, K.L.; Cole, B.M.; Steele, P.J. Peroxisome proliferator-activated receptor gamma (PPARgamma) and its ligands: A review. Domest. Anim. Endocrinol. 2002 , 22 , 1–23. [ Google Scholar ] [ CrossRef ]
• Lindi, V.I.; Uusitupa, M.I.; Lindström, J.; Louheranta, A.; Eriksson, J.G.; Valle, T.T.; Hämäläinen, H.; Ilanne-Parikka, P.; Keinänen-Kiukaanniemi, S.; Laakso, M.; et al. Finnish Diabetes Prevention Study. Association of the Pro12Ala polymorphism in the PPAR-gamma2 gene with 3-year incidence of type 2 diabetes and body weight change in the Finnish Diabetes Prevention Study. Diabetes 2002 , 51 , 2581–2586. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sanchez, J.L.G.; Rios, M.S.; Perez, C.F.; Laakso, M.; Larrad, M.T.M. Effect of the Pro12Ala polymorphism of the peroxisome proliferator-activated receptor g -2 gene on adiposity, insulin sensitivity and lipid profile in the Spanish population. Eur. J. Endocrinol. 2000 , 147 , 495–501. [ Google Scholar ]
• Demissie, M. Związek Polimorfizmu Genu Receptora Aktywowanego Proliferatorami Peroksysomów g 2 z Zaburzeniami Gospodarki Węglowodanowej i Lipidowej Oraz Profilem Hormonalnym u Osób z Należną Masą Ciała i Otyłych [Association of Peroxisome Proliferator-Activated Receptor Gene g 2 Polymorphism with Carbohydrate and Lipid Metabolism Disorders and Hormonal Profile in Normal-Weight and Obese Subjects]. Ph.D. Disertation, Wroclaw Medical Univerity, Wrocław, Poland, 2003. [ Google Scholar ]
• Douglas, J.A.; Erdos, M.R.; Watanabe, R.M.; Braun, A.; Johnston, C.L.; Oeth, P.; Mohlke, K.L.; Valle, T.T.; Ehnholm, C.; Buchanan, T.A.; et al. The peroxisome proliferator-activated receptor-gamma2 Pro12A1a variant: Association with type 2 diabetes and trait differences. Diabetes 2001 , 50 , 886–890. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ju, J.; Huang, Q.; Sun, J.; Zhao, X.; Guo, X.; Jin, Y.; Ma, W.; Wang, W. Correlation between PPAR-α methylation level in peripheral blood and atherosclerosis of NAFLD patients with DM. Exp. Ther. Med. 2018 , 15 , 2727–2730. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Wang, J.; Zhang, Y.; Zhuo, Q.; Tseng, Y.; Wang, J.; Ma, Y.; Zhang, J.; Liu, J. TET1 promotes fatty acid oxidation and inhibits NAFLD progression by hydroxymethylation of PPARα promoter. Nutr. Metab. 2020 , 17 , 46. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Theys, C.; Lauwers, D.; Perez-Novo, C.; Vanden Berghe, W. PPARα in the Epigenetic Driver Seat of NAFLD: New Therapeutic Opportunities for Epigenetic Drugs? Biomedicines 2022 , 10 , 3041. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yideng, J.; Zhihong, L.; Jiantuan, X.; Jun, C.; Guizhong, L.; Shuren, W. Homocysteine-Mediated PPARα,γ DNA Methylation and Its Potential Pathogenic Mechanism in Monocytes. DNA Cell Biol. 2008 , 27 , 143–150. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Castellano-Castillo, D.; Moreno-Indias, I.; Sanchez-Alcoholado, L.; Ramos-Molina, B.; Alcaide-Torres, J.; Morcillo, S.; Ocaña-Wilhelmi, L.; Tinahones, F.; Queipo-Ortuño, M.I.; Cardona, F. Altered Adipose Tissue DNA Methylation Status in Metabolic Syndrome: Relationships Between Global DNA Methylation and Specific Methylation at Adipogenic, Lipid Metabolism and Inflammatory Candidate Genes and Metabolic Variables. J. Clin. Med. 2019 , 8 , 87. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hong, F.; Xu, P.; Zhai, Y. The Opportunities and Challenges of Peroxisome Proliferator-Activated Receptors Ligands in Clinical Drug Discovery and Development. Int. J. Mol. Sci. 2018 , 19 , 2189. [ Google Scholar ] [ CrossRef ]
• Kahn, B.B.; McGraw, T.E. Rosiglitazone, PPARγ, and Type 2 Diabetes. N. Engl. J. Med. 2010 , 363 , 2667–2669. [ Google Scholar ] [ CrossRef ]
• Mitka, M. Panel Recommends Easing Restrictions on Rosiglitazone Despite Concerns About Cardiovascular Safety. JAMA 2013 , 310 , 246–247. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Levin, D.; Bell, S.; Sund, R.; Hartikainen, S.A.; Tuomilehto, J.; Pukkala, E.; Keskimäki, I.; Badrick, E.; Renehan, A.G.; Buchan, I.E.; et al. Pioglitazone and Bladder Cancer Risk: A Multipopulation Pooled, Cumulative Exposure Analysis. Diabetologia 2015 , 58 , 493–504. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kim, S.H.; Kim, S.G.; Kim, D.M.; Woo, J.-T.; Jang, H.C.; Chung, C.H.; Ko, K.S.; Park, J.H.; Park, Y.S.; Kim, S.J.; et al. Safety and Efficacy of Lobeglitazone Monotherapy in Patients with Type 2 Diabetes Mellitus over 52 Weeks: An Open-Label Extension Study. Diabetes Res. Clin. Pract. 2015 , 110 , e27–e30. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Shin, D.; Kim, T.-E.; Yoon, S.H.; Cho, J.-Y.; Shin, S.-G.; Jang, I.-J.; Yu, K.-S. Assessment of the Pharmacokinetics of Co-Administered Metformin and Lobeglitazone, a Thiazolidinedione Antihyperglycemic Agent, in Healthy Subjects. Curr. Med. Res. Opin. 2012 , 28 , 1213–1220. [ Google Scholar ] [ CrossRef ]
• Priya, S.S.; Sankaran, R.; Ramalingam, S.; Sairam, T.; Somasundaram, L.S. Genotype Phenotype Correlation of Genetic Polymorphism of PPAR Gamma Gene and Therapeutic Response to Pioglitazone in Type 2 Diabetes Mellitus- A Pilot Study. J. Clin. Diagn. Res. JCDR 2016 , 10 , FC11–FC14. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Stumvoll, M.; Häring, H. Reduced Lipolysis as Possible Cause for Greater Weight Gain in Subjects with the Pro12Ala Polymorphism in PPARgamma2? Diabetologia 2002 , 45 , 152–153. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Stumvoll, M.; Wahl, H.G.; Löblein, K.; Becker, R.; Machicao, F.; Jacob, S.; Häring, H. Pro12Ala Polymorphism in the Peroxisome Proliferator-Activated Receptor-Gamma2 Gene Is Associated with Increased Antilipolytic Insulin Sensitivity. Diabetes 2001 , 50 , 876–881. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jang, E.J.; Lee, D.H.; Im, S.-S.; Yee, J.; Gwak, H.S. Correlation between PPARG Pro12Ala Polymorphism and Therapeutic Responses to Thiazolidinediones in Patients with Type 2 Diabetes: A Meta-Analysis. Pharmaceutics 2023 , 15 , 1778. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ji, J.D.; Cheon, H.; Jun, J.B.; Choi, S.J.; Kim, Y.R.; Lee, Y.H.; Kim, T.H.; Chae, I.J.; Song, G.G.; Yoo, G.H.; et al. Effects of Peroxisome Proliferator-activated Receptor-γ (PPAR-γ) on the Expression of Inflammatory Cytokines and Apoptosis Induction in Rheumatoid Synovial Fibroblasts and Monocytes. J. Autoimmun. 2001 , 17 , 215–221. [ Google Scholar ] [ CrossRef ]
• Ganeb, S.S.; El-Brashy, A.E.-W.S.; Baraka, E.A.; Aboelazm, A.A.; Shaza, A.; Abdul Basset, S.A.A. Peroxisome proliferator-activated receptor gamma expression in peripheral monocytes from rheumatoid arthritis patients. Egypt. Rheumatol. 2016 , 38 , 141–146. [ Google Scholar ] [ CrossRef ]
• Li, X.F.; Sun, Y.Y.; Bao, J.; Chen, X.; Li, Y.H.; Yang, Y.; Zhang, L.; Huang, C.; Wu, B.-M.; Meng, X.-M.; et al. Functional role of PPAR-γ on the proliferation and migration of fibroblast-like synoviocytes in rheumatoid arthritis. Sci. Rep. 2017 , 7 , 1–13. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Rousseaux, C.; Lefebvre, B.; Dubuquoy, L.; Lefebvre, P.; Romano, O.; Auwerx, J.; Metzger, D.; Wahli, W.; Desvergne, B.; Naccari, G.C.; et al. Intestinal anti-inflammatory effect of 5-aminosalicylic acid is dependent on peroxisome proliferator-activated receptor-γ. J. Exp. Med. 2005 , 201 , 1205–1215. [ Google Scholar ] [ CrossRef ]
• Dubuquoy, L.; Rousseaux, C.; Thuru, X.; Peyrin-Biroulet, L.; Romano, O.; Chavatte, P.; Chamaillard, M.; Desreumaux, P. PPARgamma as a new therapeutic target in inflammatory bowel diseases. Gut 2006 , 55 , 1341–1349. [ Google Scholar ] [ CrossRef ]
• Annese, V.; Rogai, F.; Settesoldi, A.; Bagnoli, S. PPARγ in Inflammatory Bowel Disease. PPAR Res. 2011 , 2012 , 620839. [ Google Scholar ] [ CrossRef ]
• da Rocha, G.H.O.; de Paula-Silva, M.; Broering, M.F.; Scharf, P.R.D.S.; Matsuyama, L.S.A.S.; Maria-Engler, S.S.; Farsky, S.H.P. Pioglitazone-Mediated Attenuation of Experimental Colitis Relies on Cleaving of Annexin A1 Released by Macrophages. Front. Pharmacol. 2020 , 11 , 591561. [ Google Scholar ] [ CrossRef ]
• Li, D.; Feng, Y.; Tian, M.; Ji, J.; Hu, X.; Chen, F. Gut microbiota-derived inosine from dietary barley leaf supplementation attenuates colitis through PPARγ signaling activation. Microbiome 2021 , 9 , 83. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Liu, Y.; Wang, J.; Luo, S.; Zhan, Y.; Lu, Q. The roles of PPARγ and its agonists in autoimmune diseases: A comprehensive review. J. Autoimmun. 2020 , 113 , 102510. [ Google Scholar ] [ CrossRef ]
• Li, X.F.; Yin, S.Q.; Li, H.; Yang, Y.L.; Chen, X.; Song, B.; Wu, S.; Wu, Y.Y.; Wang, H.; Li, J. PPAR-γ alleviates the inflammatory response in TNF-α-induced fibroblast-like synoviocytes by binding to p53 in rheumatoid arthritis. Acta Pharmacol Sin. 2023 , 44 , 454–464. [ Google Scholar ] [ CrossRef ]
• Lewis, J.D.; Lichtenstein, G.R.; Stein, R.B.; Deren, J.J.; Judge, T.A.; Fogt, F.; Furth, E.E.; Demissie, E.J.; Hurd, L.B.; Su, C.G.; et al. An open-label trial of the PPAR-gamma ligand rosiglitazone for active ulcerative colitis. Am. J. Gastroenterol. 2001 , 96 , 3323–3328. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Liang, H.L.; Ouyang, Q. A clinical trial of rosiglitazone and 5-aminosalicylate combination for ulcerative colitis. Zhonghua Nei ke Za Zhi 2006 , 45 , 548–551. [ Google Scholar ]
• Bassaganya-Riera, J.; Rynolds, K.; Martino-Catt, S.; Cui, Y.; Hennighausen, L.; Gonzalez, F.; Rohrer, J.; Benninghoff, A.U.; Hontecillas, R. Activation of PPAR γ and δ by conjugated linoleic acid mediates protection from experimental inflammatory bowel disease. Gastroenterology 2004 , 127 , 777–791. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Qian, Y.; Li, P.; Zhang, J.; Shi, Y.; Chen, K.; Yang, J.; Wu, Y.; Ye, X. Association between peroxisome proliferator-activated receptor-alpha, delta, and gamma polymorphisms and risk of coronary heart disease: A case-control study and meta-analysis. Medicine 2016 , 95 , e4299. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Yilmaz-Aydogan, H.; Kurnaz, O.; Kucukhuseyin, O.; Akadam-Teker, B.; Kurt, O.; Eronat, A.P.; Tekeli, A.; Bugra, Z.; Ozturk, O. Different effects of PPARA, PPARG and ApoE SNPs on serum lipids in patients with coronary heart disease based on the presence of diabetes. Gene 2013 , 523 , 20–26. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Skoczynska, A.; Dobosz, T.; Poreba, R.; Turczyn, B.; Derkacz, A.; Zoledziewska, M.; Jonkisz, A.; Lebioda, A. The dependence of serum interleukin-6 level on PPAR-alpha polymorphism in men with coronary atherosclerosis. Eur. J. Intern. Med. 2005 , 16 , 501–506. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gouni-Berthold, I.; Giannakidou, E.; Müller-Wieland, D.; Faust, M.; Kotzka, J.; Berthold, H.K.; Krone, W. Association between the PPARalpha L162V polymorphism, plasma lipoprotein levels, and atherosclerotic disease in patients with diabetes mellitus type 2 and in nondiabetic controls. Am. Heart J. 2004 , 147 , 1117–1124. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dong, C.; Zhou, H.; Shen, C.; Yu, L.G.; Ding, Y.; Zhang, Y.H.; Guo, Z.R. Role of peroxisome proliferator-activated receptors gene polymorphisms in type 2 diabetes and metabolic syndrome. World J. Diabetes 2015 , 6 , 654–661. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Visseren, F.L.J.; Mach, F.; Smulders, Y.M.; Carballo, D.; Koskinas, K.C.; Bäck, M.; Benetos, A.; Biffi, A.; Boavida, J.-M.; Capodanno, D.; et al. ESC National Cardiac Societies, ESC Scientific Document Group. 2021 ESC Guidelines on cardiovascular disease prevention in clinical practice. Eur. Heart J. 2021 , 42 , 3227–3237. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dobrowolski, P.; Prejbisz, A.; Kuryłowicz, A.; Baska, A.; Burchardt, P.; Chlebus, K.; Dzida, G.; Jankowski, P.; Jaroszewicz, J.; Jaworski, P.; et al. Metabolic syndrome—A new definition and management guidelines: A joint position paper by the Polish Society of Hypertension, Polish Society for the Treatment of Obesity, Polish Lipid Association, Polish Association for Study of Liver, Polish Society of Family Medicine, Polish Society of Lifestyle Medicine, Division of Prevention and Epidemiology Polish Cardiac Society, “Club 30” Polish Cardiac Society, and Division of Metabolic and Bariatric Surgery Society of Polish Surgeons. Arch. Med. Sci. 2022 , 18 , 1133–1156. [ Google Scholar ] [ CrossRef ]
• Cheng, H.S.; Tan, W.R.; Low, Z.S.; Marvalim, C.; Lee, J.Y.H.; Tan, N.S. Exploration and Development of PPAR Modulators in Health and Disease: An Update of Clinical Evidence. Int. J. Mol. Sci. 2019 , 20 , 5055. [ Google Scholar ] [ CrossRef ]
• Colapietro, F.; Gershwin, M.E.; Lleo, A. PPAR agonists for the treatment of primary biliary cholangitis: Old and new tales. J. Transl. Autoimmun. 2023 , 6 , 100188. [ Google Scholar ] [ CrossRef ]
• Xi, Y.; Zhang, Y.; Zhu, S.; Luo, Y.; Xu, P.; Huang, Z. PPAR-Mediated Toxicology and Applied Pharmacology. Cells 2020 , 9 , 352. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Okopień, B.; Bułdak, Ł.; Bołdys, A. Benefits and risks of the treatment with fibrates––A comprehensive summary. Expert Rev. Clin. Pharmacol. 2018 , 11 , 1099–1112. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kersten, S.; Wahli, W. Peroxisome proliferator-activated receptor agonists. Exp.-Suppl. Only 2000 , 89 , 141–152. [ Google Scholar ]

Click here to enlarge figure

Share and Cite

Skoczyńska, A.; Ołdakowska, M.; Dobosz, A.; Adamiec, R.; Gritskevich, S.; Jonkisz, A.; Lebioda, A.; Adamiec-Mroczek, J.; Małodobra-Mazur, M.; Dobosz, T. PPARs in Clinical Experimental Medicine after 35 Years of Worldwide Scientific Investigations and Medical Experiments. Biomolecules 2024 , 14 , 786. https://doi.org/10.3390/biom14070786

Skoczyńska A, Ołdakowska M, Dobosz A, Adamiec R, Gritskevich S, Jonkisz A, Lebioda A, Adamiec-Mroczek J, Małodobra-Mazur M, Dobosz T. PPARs in Clinical Experimental Medicine after 35 Years of Worldwide Scientific Investigations and Medical Experiments. Biomolecules . 2024; 14(7):786. https://doi.org/10.3390/biom14070786

Skoczyńska, Anna, Monika Ołdakowska, Agnieszka Dobosz, Rajmund Adamiec, Sofya Gritskevich, Anna Jonkisz, Arleta Lebioda, Joanna Adamiec-Mroczek, Małgorzata Małodobra-Mazur, and Tadeusz Dobosz. 2024. "PPARs in Clinical Experimental Medicine after 35 Years of Worldwide Scientific Investigations and Medical Experiments" Biomolecules 14, no. 7: 786. https://doi.org/10.3390/biom14070786

Article Metrics

Further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

Loading metrics

Open Access

Peer-reviewed

Research Article

Experimental Zika virus infection of Jamaican fruit bats ( Artibeus jamaicensis ) and possible entry of virus into brain via activated microglial cells

Roles Conceptualization, Formal analysis, Investigation, Methodology, Project administration, Supervision, Writing – original draft, Writing – review & editing

Affiliation Arthropod-Borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

Roles Methodology

Affiliation Department of Environmental and Radiological Health Sciences, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, United States of America

Roles Formal analysis, Investigation, Writing – review & editing

Affiliation Veterinary Diagnostic Laboratories, Department of Microbiology, Immunology and Pathology, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, Colorado, United States of America

Roles Investigation, Methodology

Roles Investigation

Roles Formal analysis

Roles Formal analysis, Supervision

Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Writing – review & editing

* E-mail: [email protected]

• Ashley Malmlov, 
• Collin Bantle, 
• Tawfik Aboellail, 
• Kaitlyn Wagner, 
• Corey L. Campbell, 
• Miles Eckley, 
• Nunya Chotiwan, 
• Rebekah C. Gullberg, 
• Rushika Perera, 

• Published: February 4, 2019
• https://doi.org/10.1371/journal.pntd.0007071
• Reader Comments

The emergence of Zika virus (ZIKV) in the New World has led to more than 200,000 human infections. Perinatal infection can cause severe neurological complications, including fetal and neonatal microcephaly, and in adults there is an association with Guillain-Barré syndrome (GBS). ZIKV is transmitted to humans by Aedes sp. mosquitoes, yet little is known about its enzootic cycle in which transmission is thought to occur between arboreal Aedes sp. mosquitos and non-human primates. In the 1950s and ‘60s, several bat species were shown to be naturally and experimentally susceptible to ZIKV with acute viremia and seroconversion, and some developed neurological disease with viral antigen detected in the brain. Because of ZIKV emergence in the Americas, we sought to determine susceptibility of Jamaican fruit bats ( Artibeus jamaicensis ), one of the most common bats in the New World. Bats were inoculated with ZIKV PRVABC59 but did not show signs of disease. Bats held to 28 days post-inoculation (PI) had detectable antibody by ELISA and viral RNA was detected by qRT-PCR in the brain, saliva and urine in some of the bats. Immunoreactivity using polyclonal anti-ZIKV antibody was detected in testes, brain, lung and salivary glands plus scrotal skin. Tropism for mononuclear cells, including macrophages/microglia and fibroblasts, was seen in the aforementioned organs in addition to testicular Leydig cells. The virus likely localized to the brain via infection of Iba1 + macrophage/microglial cells. Jamaican fruit bats, therefore, may be a useful animal model for the study of ZIKV infection. This work also raises the possibility that bats may have a role in Zika virus ecology in endemic regions, and that ZIKV may pose a wildlife disease threat to bat populations.

Author summary

The rapid spread of Zika virus through a naïve population in the Americas resulted in novel and severe disease manifestations, including fetal and neonatal microcephaly, and GBS. These disease complications make understanding the pathology and ecology of ZIKV a priority. Captive Jamaican fruit bats were challenged with ZIKV to determine their susceptibility, to assess whether bats may play a role in virus ecology, and if they might serve as an animal model to better understand ZIKV pathophysiology. The bats became acutely infected and mounted an antibody response. Three terminally euthanized inoculated bats had antibody titers of 3200, 28 days PI. Evidence of virus replication and associated pathologies were found in the brain, testes, lungs and salivary glands of some of the inoculated bats. The virus showed predilection for mononuclear cells, including resident Iba1 + macrophage/microglial cells, and Leydig cells.

With no discernible disruption to the blood brain barrier nor distribution of viral antigen indicative of circumeventricular neuroinvasion, microglia cells may be a possible route of entry of ZIKV into brains of bats. Further investigations are needed to determine the mechanisms of neuroinvasion of ZIKV in bats, further determine feasibility of bats as an alternative animal-model for congenital Zika syndrome, and what role bats might play in ZIKV viral ecology.

Citation: Malmlov A, Bantle C, Aboellail T, Wagner K, Campbell CL, Eckley M, et al. (2019) Experimental Zika virus infection of Jamaican fruit bats ( Artibeus jamaicensis ) and possible entry of virus into brain via activated microglial cells. PLoS Negl Trop Dis 13(2): e0007071. https://doi.org/10.1371/journal.pntd.0007071

Editor: Amy T. Gilbert, US Department of Agriculture, UNITED STATES

Received: August 9, 2018; Accepted: December 11, 2018; Published: February 4, 2019

Copyright: © 2019 Malmlov et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: This work was supported by startup funds from the Department of Microbiology, Immunology and Pathology and the College of Veterinary Medicine and Biomedical Sciences, and the Vice President for Research at Colorado State University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Zika virus (ZIKV) was first isolated from a sentinel rhesus macaque in Uganda in 1947 and subsequently from Aedes africanus mosquitoes in the same location [ 1 ]. The first human cases were identified in 1954 in Nigeria and serosurveys found evidence of a broad geographic distribution for ZIKV throughout Africa and Asia with sporadic cases in humans [ 2 , 3 ]. The first recognized ZIKV epidemic occurred in Yap State, Federated State of Micronesia in 2007. An estimated 73% of residents were infected, and of those 18% presented with clinical disease [ 4 ]. In 2013, a second epidemic occurred in French Polynesia with 28,000 cases reported. During the latter outbreak, the incidence rate of Guillain-Barré syndrome (GBS) increased 20-fold and first indication of a connection between ZIKV infection and GBS was established [ 5 ]. The virus spread to Brazil in 2015 [ 6 , 7 ] and has since disseminated throughout much of tropical South America, Central America, the Caribbean, and the southern United States, with more than 200,000 confirmed cases [ 8 ]. ZIKV can also cause congenital Zika syndrome (CZS) in naïve populations and is therefore a virus of high concern [ 3 ].

Zika virus is maintained in an urban cycle, transmitted between an Aedes mosquito vector and humans thereby maintaining endemicity [ 9 ]. It is generally accepted that the virus transmits between non-human primates and vectors in a sylvatic cycle; however, the sylvatic cycle has not been well characterized in the Old World and little is known about a New World sylvatic cycle [ 9 , 10 ]. Molecular analysis of ZIKV to better understand viral phylogenetics suggests that animal hosts affected viral evolution and therefore may play an important role in viral ecology [ 11 ].

In the 1950s and ‘60s, the susceptibility of bats to ZIKV was investigated. Shepherd and Williams [ 12 ] screened 172 wild bats from 12 different species in Uganda for antibodies against ZIKV and found 16/44 little free-tail bats ( Tadarida pumila ) and 26/36 Angolan free-tail bats ( T . condylura ) were seropositive by hemagglutination inhibition assay. Additionally, two Angolan free-tail bats were experimentally inoculated with ZIKV and serially bled to test for viremia. Both animals were viremic on days 2, 4 and 6 as determined by paralysis in mice inoculated with the sera from those two bats [ 12 ]. Simpson and O’Sullivan [ 13 ] experimentally inoculated three straw-colored fruit bats ( Eidolon helvum ), three Egyptian fruit bats ( Rousettus aegyptiacusi ), and five Angolan free-tail bats. Two of the straw-colored fruit bats were viremic and had seroconverted. One of the Egyptian fruit bats was viremic and two had seroconverted. The Angolan free-tail bats were euthanized on days 1, 3, 5, 7 and 10 days post inoculation and screened for viral tropism. At one day post infection, a kidney was trace positive [ 13 ]. Finally, Reagan et al. [ 14 ] inoculated 20 New World little brown bats ( Myotis lucifigus ) by 5 different routes: intracranial, intraperitoneal, intradermal, intrarectal and intranasal. Bats in all groups, with the exception of the intranasal group, developed fatal neurological disease 4–7 days post inoculation. Brain tissue was virus-positive in all animals with clinical disease, determined by inoculation of mice with brain homogenate suspension [ 14 ].

Considering the evidence that African bats are naturally susceptible to ZIKV and that little brown bats develop disease, the question emerged: could bats serve as a natural reservoir host for ZIKV in the New World? To test this hypothesis, we inoculated Jamaican fruit bats ( Artibeus jamaicensis ), among the most abundant bats in the Caribbean, Central America and Mexico, with ZIKV to examine virology, immunology and pathology of the infection. Although virus was detected in several organs, including the testes and brains, no overt clinical signs were detected, and substantial viremia or viruria was not evident. These results suggest that Jamaican fruit bats are unlikely to serve as amplification hosts but that ZIKV infection may constitute a wildlife disease threat to bats.

Experimental infections

Bats for this project were obtained from the Colorado State University breeding colony approved by the Institutional Animal Care and Use Committee (protocol 16-6512A). Two experimental infections were conducted; a pilot study and a time course study. In the pilot-study, three male bats (AJ-z7, AJ-z8, AJ-z9) were intradermally inoculated with 7.5x10 5 plaque forming units (pfu) ZIKV, strain PRVABC59; a high dose to assess susceptibility. No signs of disease were apparent during this 28 day experiment; however, all three bats had antibody titers of 3200 on day 28 ( Table 1 ). After demonstration of susceptibility in the pilot study, a time course study was conducted. Six male bats (AJ-z1 through AJ-z6) were identically inoculated and two were euthanized at 2, 5 and 10 days post inoculation (dpi). No conspicuous signs of disease were observed in any of the inoculated bats. Necropsies immediately followed euthanasia and no significant gross pathology was evident.

• PPT PowerPoint slide
• PNG larger image
• TIFF original image

https://doi.org/10.1371/journal.pntd.0007071.t001

Detection of viral RNA in urine and brain

Quantitative probe-based reverse transcription PCR (qRT-PCR) was performed on serum-inoculated Vero cell supernatants, serum, brain, lung, liver, spleen, kidney, urinary bladder, prostate and testes from bats from both studies. In addition, urine collected during the time course study was similarly assayed. Urine from bats AJ-z6 at 3 dpi and AJ-z7 at 5 dpi had low levels of vRNA whereas bat AJ-z1, euthanized at 2 dpi, had low levels of vRNA in its brain ( Fig 1 ). All other samples were negative. Sera from AJ-z2 at 2 dpi, and AJ-z3 and AJ-z4 at 5 dpi were negative by ELISA. Sera were blind passaged on Vero E6 cells in an attempt to isolate ZIKV and all were negative for cpe and PCR.

Viral RNA was detected in the brain one bat (AJ-z1) euthanized on day 2 and in the urine collected from two other bats (AJ-z6, AJ-z5) on days 3 and 5 post infection.

https://doi.org/10.1371/journal.pntd.0007071.g001

Histopathology

Hematoxylin and eosin stain (h&e)..

Heart, lung, liver, kidney, testes, prostate, urinary bladder, and brain were collected from all 9 animals as well as salivary glands from 3/9 bats. All samples were blindly read by one pathologist. A summary of the consistent histopathology findings is listed in Table 2 .

https://doi.org/10.1371/journal.pntd.0007071.t002

For the time course study, AJ-z1 at 2 dpi showed mild pulmonary congestion with multifocal areas of interstitial pneumonia, mild intra-alveolar hemorrhage and mild atelectasis. Terminal airways had slightly increased amounts of mucus. Kidneys had multifocal interstitial infiltrates of small numbers of lymphocytes. All other tissues were within normal limits. In AJ-z2 at 2 dpi, lungs showed milder pathology than AJ-z1 with minimal interstitial to perivascular infiltrates predominately lymphocytes and macrophages with a band of collapsed air spaces subjacent to the pleural surface. There were focal lesions in the left ventricle of the heart where there was individual cell loss or else fragmentation of the sarcoplasm of scattered cardiomyocytes. Degenerate/necrotic cardiomyocytes were accompanied by infiltrations of small numbers of macrophages, lymphocytes and satellite cells. All other tissues were within normal limits.

Lungs from AJ-z3 at 5 dpi had minimal focal interstitial histiocytic pneumonia with atelectasis. Kidneys showed multifocal chronic lymphohistiocytic pyelitis with a few degenerate and detached epithelial cells accumulating in the renal pelvis and infiltration of pelvic stroma by small numbers of mixed inflammatory cells. Mandibular salivary gland showed focal moderate cellular infiltrates of periductular lymphocytes and macrophages. Affected salivary ducts contained detached and degenerate epithelial cells and leukocytes. Occasional ducts were encircled by granulation tissue and a few heterophils. Rare apoptosis was evident in the lining epithelium of such ducts. All other tissues were within normal limits. AJ-z4 at 5 dpi had lungs with minimal alveolar septal infiltrates scattered within collapsed lung parenchyma along with multifocal microscopic hemorrhages. Kidneys had multifocal areas of mineralization. In the outer medulla and at the cortico-medullary junction were rare perivascular infiltrates of lymphoplasmacytes. Esophagus and lymphoid tissue associated with palatine salivary gland showed focal mild lymphoplasmacytic inflammation. Moderate numbers of lymphocytes and plasma cells were arranged in columns parallel to the respiratory mucosal epithelium of the nasophayrnx. The lumen contained increased amounts of mucus and a few inflammatory cells, mainly heterophils and lymphocytes. In the testicles, there was focal testicular degeneration manifested by presence of giant spermatids in the lumina of affected seminiferous tubules and accumulation of a small numbers of interstitial lymphocytes and macrophages. All other tissues were within normal limits.

Lungs from AJ-z5 at 10 dpi had minimal interstitial to perivascular infiltrates with multifocal atelectasis and microscopic hemorrhages. The left papillary muscle of the heart showed rare multifocal cardiomyocyte necrosis characterized by rounding up of individual cardiomyocytes. Necrotic cardiomyocytes appeared with hypereosinophilic cytoplasm, devoid of cross striations or fragmented and rarely vacuolated. Minimal interstitial hypercellularity due to increased activity of satellite cells and infiltration of small numbers of lymphocytes was observed in the vicinity of degenerate/necrotic cardiac muscle fibers. Kidneys had an area of focal lymphoplasmactyic pyelitis. Additionally, there was a focal area of mineralization and inflammation in the inner medulla. All other tissues were within normal limits. AJ-z6 at 10 dpi had occasional focal inflammation and cardiomyocyte degeneration in the left ventricle and interventricular septum. Area CA3 of the hippocampus in the brain showed focal pyrimidal neuronal necrosis with a focal area of mineralization around a vessel in the cerebral cortex along with focal gliosis and individual neuronal necrosis ( Fig 2 ). All other tissues were within normal limits. Testicular, neural and salivary glands’ lesions are believed to be associated with ZIKV infection as they were not seen with other viral infections.

(A) AJ-z6, 10 dpi area CA3 of the hippocampus with focal pyrimidal neuronal necrosis, circled. (B) AJ-z6, 10 dpi 400x magnification of lesion from figure A demonstrating angular, pyknotic nuclei, and hypereosinophilic cytoplasm of necrotic neuronal cell bodies. (C) Negative control bat hippocampus showing even and homogenous pyrimidal neuronal populations in all layers of hippocampus.

https://doi.org/10.1371/journal.pntd.0007071.g002

In the pilot study bats, AJ-z7 at 28 dpi had more prominent interstitial pneumonia with congestion of the lungs compared to earlier time points. The heart had minimal cardiomyocyte degeneration and necrosis with hypercellular interstitium and increased amounts of mature fibrous connective tissue. The kidney had focal interstitial infiltrates of the cortical and outer medullary interstitium. The brain showed degenerate neurons in area A3 of the hippocampus. All other tissues were within normal limits. AJ-z8 had minimal focal testicular degeneration ( Fig 3 ). All other tissues were normal. AJ-z9 had perivascular lymphocyte pulmonary infiltrates and atelectasis. Heart demonstrated locally extensive lymphocytic and histiocytic pericarditis. Kidneys showed multifocal interstitial lymphocytic infiltrates. Brain had focal, perivascular infiltrates of small numbers of lymphocytes at the subfornical commissure. The reticular formation showed multifocal neuronal degeneration/necrosis.

(A) Focal testicular degeneration. Seminefrous tubules are disorganized with no mature sperm in lumen and and multifocal accumulation of luminal giant spermatids. (B) Negative control bat normal testes.

https://doi.org/10.1371/journal.pntd.0007071.g003

Immunohistochemistry and immunofluorescence.

Tissues were stained with a polyclonal antibody for ZIKV (CDC, Fort Collins). AJz-3 at 5 dpi with inflammation of the mandibular salivary gland had moderate immunoreactivity in the lumen of affected ducts ( Fig 4 ). AJ-z5 at 10 dpi had immunoreactive cells in the brain and mononuclear cell immunoreactivity in the testes ( Fig 5 ). Additionally, AJ-z5 demonstrated immunoreactivity in purkinje cells of the cerebellum ( Fig 6A ). AJ-z8 at 28 dpi had immunoreactive cells around the pulmonary arteries in the lungs ( Fig 7A ). AJ-z8 also had immunoreactivity perivascullarly in the tunica albuginea of the testes ( Fig 8A ). Scrotal skin had focal lymphocytic dermatitis with immunoreactive mononuclear cells ( Fig 8D ). Cell morphology consistently identified mononuclear cells compatible with macrophages and fibroblasts as the primary cell types showing immunoreactivity against ZIKV antigen.

Luminal immunoreactivity of the salivary gland showing multifocal periducular inflammation and accumulation of viral antigen in degenerate ductular epithelium and/or leukocytes.

https://doi.org/10.1371/journal.pntd.0007071.g004

Mononuclear cell immunoreactivity, arrows highlighting mononuclear cells consistent with macrophages and Leydig cells.

https://doi.org/10.1371/journal.pntd.0007071.g005

(A) Multifocal Purkinje cell immunoreactivity in AJ-z5. (B) Negative control cerebrellum showing no immunoreactivity in Purkinje cells.

https://doi.org/10.1371/journal.pntd.0007071.g006

(A) Hilum of the lung shows immunoreactivity in mononuclear cells consistent with macrophages and fibroblasts around the pulmonary artery. PA, pulmonary artery. PV, pulmonary vein. BW, bronchiolar wall. (B) Negative control without immunoreactivity.

https://doi.org/10.1371/journal.pntd.0007071.g007

(A) Tunica albuginea perivascular immunoreactivity mostly in macrophages and fibroblasts of AJ-z8. (B) Negative control without immunoreactivity. (C) Interstitial immunoreactive mononuclear cells consistent with macrophages (black long arrows) and Leydig cells (short red arrows) in AJ-z8. (D) Focal lymphocytic dermatitis and immunoreactive mononuclear cells in AJ-z8.

https://doi.org/10.1371/journal.pntd.0007071.g008

Brain and testicular tissues stained with both goat polyclonal goat anti-Iba1 (green) and monoclonal 4G-2 flavivirus E specific antibodies (red) showed co-localization (yellow) of ZIKV antigen in cytoplasm of activated microglial cells with their characteristic morphology in the cerebral cortex of infected bats 10 dpi in the time course study and 28 day dpi in the pilot study ( Fig 9 ). Increased microgliosis was noted in the vicinity of co-localization sites. The gliosis was also prominent in the cerebellum and hippocampus especially around dead neurons. In the testicles, occasional macrophages showed similar co-localization similar to that noted in the brain in the testicular interstitium, inner layer of tunica albuginea and scrotum. Cells consistent in morphology with Leydig cells were similarly highlighted by ZIKA viral antigen only showing strong immunoreactivity using polyclonal anti-ZIKV antibody.

A confocal Z-stack merged image depicting Iba-labeled microglial cell (green) with its characteristic processes and intracytoplasmic ZIKAV antigen co-localization (yellow).

https://doi.org/10.1371/journal.pntd.0007071.g009

Two bat infection experiments were conducted in this investigation; 1) a pilot study to determine susceptibility of Jamaican fruit bats to ZIKV infection, and 2) a time course study to better understand pathophysiology and chronology of events pertaining to the dynamics of viremia, viral tropism, replication and shedding of the virus in a New World bat species. The goal was to determine whether bats can be used as an animal model for ZIKV pathogenesis and to assess the possible role of bats in ZIKV ecology in the New World.

In the pilot experiment, no signs of disease were apparent during the 28-day study. Sera collected at euthanasia indicated modest antibody titers of 3200 for each bat by ELISA ( Table 1 ), whereas the human -convalescent control serum titer was ≥12,800. Bats typically have low to modest antibody titers, perhaps due to limited somatic hypermutation and affinity maturation [ 15 – 22 ].

Concerning viremia, cell-serum supernatants, blind passage supernatants, and neat serum results were all negative. Although serum is routinely used for ZIKV diagnostics in humans, it may not be the most suitable sample [ 23 – 27 ]. In one investigation ZIKV patient had negative serum sample for the duration of the study, whereas whole blood yielded positive qRT-PCR results from days 9 to 101 [ 27 ]. One possible explanation for the phenomenon of negative serum in human patients is that the virus during acute infection disseminates via a cell-associated viremia or as novel findings suggest that the virus gets phagocytized in neutrophils and therefore whole blood is a more sensitive diagnostic sample than serum.

Viruria is commonly detected in ZIKV-infected humans [ 26 ]; therefore, urine may be an equally important diagnostic sample with higher viral load in early infection when compared to blood in humans and other primates [ 23 – 26 ]. Although urine collection from bats was challenging, we collected urine from some of the inoculated bats in the time course study. AJ-z6 exhibited viruria only at 3 dpi, and AJ-z7 was equivocal only at 5 dpi, corroborating the findings in other mammals that urine may be a route of viral shedding early in infection. Urine from one human patient was positive from the first time point (6 dpi) through 14 dpi and again on day 56. Similarly, saliva from that same patient was positive from day nine through day 14 and again on day 49 [ 27 ]. Another investigation compared diagnostic samples of 80 infected patients and showed that urine was positive in 50 of them, whereas serum was only positive in 19 patients by qRT-PCR. The study concluded that viral loads in urine were ten-fold higher compared to serum and that uremia lasted longer [ 25 ]. These data corroborated the first study that identified ZIKV shed in urine in which there was a higher viral load in urine for longer duration compared to serum [ 26 ]. ZIKV RNA in plasma was detected in the bats by qRT-PCR between 2 and 6 dpi, but between 2 to 17 dpi in urine [ 26 ]. The lack of detectable viremia in the serum of bats is congruent with some of the human and NHP investigations in that viremia is low and short-lived. Detached renal pelvic urothelial cells and degenerate salivary gland ductular epithelium as seen in the current study will make urine and saliva equally important fluids to collect in order to maximize detection of ZIKV in the acute and established stages of infections.

For this experiment, all male bats were used because female bats are prioritized for colony expansion. ZIKV exhibited tropism for the testes with strong immunoreactivity in reproductive organs (Figs 4 & 7 ). Histologically, minimal focal testicular degeneration in two bats ( Fig 2 ) suggests viral related pathology may be minimal. In humans it has yet to be completely elucidated what reproductive organs harbor ZIKV, it has been determined that semen contains ZIKV both in both vasectomized and unvasectomized men [ 27 , 28 ]. This suggests that ZIKV is sequestered in the testes and/or accessory sex glands. Mouse models have demonstrated ZIKV infection and associated pathology in the testes [ 29 – 31 ] of humanized BLT mouse model with infection primarily targeting macrophages and Leydig cells [ 32 ]. Limited investigation has been done relating to infection of accessory sex glands in mouse models, but one study that assessed the prostate found no virus, possibly due to differential expression of the receptor candidate in the testes but not in the prostate [ 29 ]. For this experiment the finding of viral antigen and viral RNA in the testes but not in the prostate is consistent with published animal models and may suggest the potential for bats to serve as another animal model.

Three bats had histopathological alterations in the hippocampus at later time points and one bat had viral nucleic acid present in the brain as determined by qRT-PCR demonstrating tropism for the CNS, a tissue predilection also documented in humans and animal models. ZIKV has a predilection for nervous tissue in animal studies and disease manifestation in humans. As a neurological teratogen, ZIKV has been detected in the brain mononuclear cells in human newborns with fatal microcephaly and fetal miscarriages. Histological lesions are varied but may include parenchymal calcification, microglial nodules, gliosis, cell degeneration, mononuclear infiltration and necrosis [ 33 – 35 ]. In non-human animal models, evidence for viral tropism has been found in brain and/or peripheral nervous tissue [ 36 – 39 ]. In immunocompromised mouse models, the virus has a predilection for the brain but with the mice engineered for specific immune traits it is difficult to know to what extent this recapitulates natural ZIKV pathophysiology [ 40 ]. In the bats used in this experiment, evidence of ZIKV-induced pathology in the brain is consistent with what has been seen in human newborns and fetuses.

The novel finding of co-localizing ZIKV antigen in bat Iba1 + microglial/macrophage cells lends support to the earlier evidence of microglial cell infection via Axl ligand bridging ZIKV particles to glial cells [ 41 ]. Iba1 (aka, allograft inflammatory factor 1, Aif1) is a microglia/macrophage-specific calcium-binding protein, which has actin-bundling activity that participates in membrane ruffling and phagocytic activity of activated microglia. Activated microglial cells appeared with increased ability of cell migration and phagocytosis, which is controlled by remodeling of membrane cytoskeleton [ 42 ]. The morphology of cells with co-localization in the brain of infected bats is consistent with activated microglia depicting prominent branched processes. Recent primate models in rhesus and cynomolgus macaques demonstrated similar viral distribution of ZIKV antigen to that in bats, described herein. High-level of ZIKV was evident in cerebellar neurons and the same studies documented involvement of Iba1 positive microglial cells in CNS infections. In primate models there is increasing evidence that ZIKV antigen was detected in individuals with the highest peak plasma viremia, which in part implies that ZIKV may initially seed the CNS by a passive spillover from circulating monocytes to resident microglial cells. This is further substantiated in all of human and animal studies, which did not show any evidence of disruption to BBB or viral distribution reminiscent of circumventricular distribution seen in alphavirus animal models [ 43 ].

In addition to brain and testes immunoreactivity, scrotal skin and mandibular salivary gland also harbored viral antigen. Distribution of viral antigen in bat tissues suggests that infection in this species recapitulates human infection, which is thought to start with infection of epidermal and dermal cells with subsequent dissemination to multiple organs including salivary glands as viral RNA can be detected in human saliva [ 44 , 45 ]. The histopathology for AJ-z5, 5 dpi showed sialoadenitis and the presence ZIKV antigen by IHC ( Fig 3 ). This suggests ZIKV may be shed in the saliva, although additional animal experiments need to be performed to confirm such a route of shedding. The results presented here suggest that Jamaican fruit bats may be a suitable animal model for examining ZIKV infection to elucidate its pathogenesis. Jamaican fruit bats may also serve as a model to ascertain sexual transmission, in utero transmission, teratogenesis and neurological pathophysiology. It may be that ZIKV is a wildlife disease threat for bats that could lead to infertility in some males, which could impact bat populations.

ZIKV is thought to be maintained in two different distinct cycles: sylvatic—cycling between non-human primates (NHP) and mosquito species, and urban—cycling between humans and mosquito species [ 3 ]. While there are limited data on what mosquito species feed on Jamaican fruit bats, evidence for natural flavivirus infection has been identified in wild New World bats. Dengue virus (DENV) RNA and antibodies to DENV were detected in multiple species of bats, including Jamaican fruit bats, in Mexico [ 46 ]. Additionally, antibodies to DENV were detected in multiple bat species including those of the Artibeus genus in Costa Rica and Ecuador [ 47 , 48 ]. These data indirectly provide evidence for mosquito-bat interactions in the wild; either through consumption of bat-blood meals taken by mosquitoes or bat consumption of infected mosquitoes.

As it pertains to a wildlife reservoir, wild NHPs have antibody to ZIKV including several monkey species trapped near Ziika Forest [ 10 ], and wild and semi-captive orangutans in Borneo [ 49 ]. Not only have NHP been found to be seropositive, but also many other mammals, including rodents, horses, cows, and goats [ 50 , 51 ]. Furthermore, experimental inoculation of various North American species resulted in seroconversion (cottontail rabbits, boar goats, pigs, and leopard frogs) and demonstrated viremia (nine-banded armadillo and leopard frogs) [ 52 ]. Molecular epidemiology suggests animals play an important role in an enzootic cycle [ 11 ]. Much about the enzootic cycle of ZIKV has yet to be understood but it stands to reason that bats may be capable of maintaining the virus in nature. Jamaican fruit bats are found in northern South America, Central America, and the Caribbean—areas that now have ZIKV potentially exposing bat populations to the virus [ 8 , 53 ]. However, the data presented here suggest it is unlikely that Jamaican fruit bats can serve as amplification hosts of ZIKV, unless virus sequesters in some as-yet unidentified way that could lead to periodic shedding of virus. It may also be that some bats become persistently infected and can transmit sexually to maintain virus within populations of bats. Further experimental and field studies will be necessary to fully understand the ecological role of bats in ZIKV maintenance.

Materials and methods

Ethics statement.

All animal procedures were approved by the Colorado State University (CSU) Institutional Animal Care and Use Committee (protocol 16-6512A) and were in compliance with U.S. Animal Welfare Act.

CSU has a captive colony of Jamaican fruit bats ( Artibeus jamaicensis ), a neotropical fruit bat indigenous to much of South America, Central America and the Caribbean [ 53 ]. Colony bats are kept in a free flight room measuring 19’w x 10’l x 9’h. Roosting baskets are hung from the ceiling throughout the room and drapes of different cloth material are positioned for hanging and roosting. Ambient temperature is maintained between 20°C and 25°C, with humidity between 50% and 70%, and a 12 hour light/12 hour dark light cycle via a computer-controlled system. Diets consist of a combination of fruits (Shamrock Foods, Fort Collins, CO), Tekald primate diet (Envigo, Huntington, UK), molasses, nonfat dry milk and cherry gelatin that are placed in multiple feeding trays around the room once a day. Fresh water is provided. In addition, fruit is hung around the room to stimulate foraging behavior and serve as enrichment.

For infection experiments, bats were trapped using a butterfly net and placed in an 20”d x 12”w x 18”h cage for 24 hours prior to inoculations to allow for acclimation. Hanging clothes were provided for roosting and coverage. Food and water are placed in open trays in the bottom of the cage and changed daily. Tray liners were changed every two days, and cages and hanging clothes are changed every two weeks. Due to the social nature of these bats, minimums of two bats were kept in cages at all times to mitigate potential stress.

Experimental inoculations

Two sets of experiments were performed; a pilot study and a time course study. Zika virus strain PRVABC59. PRVABC59 was isolated in 2015 by Centers for Disease Control and Prevention (Fort Collins, CO) from an infected individual who traveled to Puerto Rico (GenBank accession no. HQ234499). The virus stock titer is 3x10 7 plaque forming units (pfu) per ml of media, and the fourth passage was used for both studies.

For the pilot study, three male bats were anesthetized with 1% to 3% isoflurane to effect with an oxygen flow rate of 1.5 L/min, administered with a gas mask. Animals were placed on a heating pad to maintain body temperature and respirations continuously monitored. The dorsum of each animal was disinfected with 70% ethanol and 25ul containing 7.5x10 5 p.f.u of virus was administered subcutaneously (sc) at the level of the scapula with a sterile hypodermic 25 gauge needle in a biosafety cabinet. When procedures were finished, bats were removed from isoflurane and placed back in the cage in ventral recumbency. Respirations were monitored until animal was fully awake and ambulated normally. Bats were identified as AJ-z7, AJ-z8 and AJ-z9. Animals were euthanized at 28 days post-inoculation (dpi).

For the time course study, six male bats were anesthetized under the same protocol as the pilot study. Animals were placed in ventral recumbency. After disinfecting the dorsum of each animal with 70% ethanol, 0.15mls of 1% lidocaine was administered sc at the level of the last rib with a 25 gauge sterile hypodermic needle as a local anesthetic. IPTT300 transponders (BioMedic Data Systems, Inc., Seaford, DE) were inserted sc at the level of the caudal edge of the scapula. Twenty-five microliters containing 7.5x10 5 p.f.u of virus was administered sc at the level of the cranial edge of the scapula. Recovery followed the same protocol as for the pilot study bats. Animals were identified as AJ-z1 through AJ-z6. AJ-z1 and AJ-z2 were euthanized at two dpi. AJ-z3 and AJ-z4 were euthanized at 5 dpi. AJ-z5 and AJ-z6 were euthanized at 10 dpi.

Female bats were excluded from the study because they are prioritized for breeding to sustain and expand upon the colony.

For the pilot study, bats were visually monitored twice daily for fourteen days, and then monitored once a day for an additional fourteen days. For the time course study, bats were monitored twice a day throughout the experiment. For both studies, energy levels, behavior, ability to ambulate, respirations, presence of oral or nasal discharge, and fecal consistency were all assessed.

Urine collection

During the time course study urine was collected at 2, 3, 5 and 10 dpi from as many bats as possible. Urine was collected by allowing bats to grasp screen cloth with their feet and then the bat was placed in a clear solo cup (Dart Container, Lake Forest, IL) with the screen covering the top of the cup as a lid, and kept in place with a rubber band. This allowed the bats to hang in a clear container. Bats were monitored for 45 minutes. If they urinated, bats were removed from the collection contraption and placed back in the cage without disrupting the urine. Urine collection was attempted on all remaining bats at each time point, but not all bats would urinate at each collection attempt. Urine was successfully collected as follows: two dpi from AJ-z3 and AJ-z4; three dpi from AJ-z3, AJ-z5 and AJ-z6; five dpi from AJ-z3, AJ-z4, AJ-z5 and AJ-z6; and ten dpi from AJ-z5 and AJ-z6. Urine was pipetted off the surface of the cup with a sterile pipette tip and put in a 1.5 ml microcentrifuge tube and stored at -80°C for future use. Urine volume ranged between 5 ul and 15 ul.

Euthanasia, blood collection and necropsy

Bats were deeply anesthetized and maintained with 3% isoflurane and an oxygen flow rate of 1.5 L/min. Deep pain was assessed by firmly pinching skin and toes with forceps and assessed for any response. A thoracotomy was then performed with sterile standard scissors to puncture through the skin, muscle and diaphragm just caudal to the sternum and cut through the wall of the chest cavity caudally to cranially—removing and preventing negative pressure from building in the thorax.

Cardiac blood was collected with a 21 gauge sterile needle inserted into the apex of the heart. A maximum blood volume of between 1 and 1.5mls is collected in a syringe and transferred to a red top tube (RTT). RTTs sat at room temperature for one hour to allow a clot to form and then centrifuged at 1000 x g for 10 min at room temperature. Serum was removed from the clot, placed in a new microcentrifuge tube and stored at -20°C.

Serum from bats at 2 and 5 dpi were used to assess for viremia. Serum from 10 dpi and the 28 dpi pilot study bats were used to determine antibody titers. Because blood draws yield a small volume of blood (50 μl whole blood for a non-terminal blood draw, 500 μl whole blood for terminal blood draw) it was necessary to prioritize samples to optimize data retrieved. In order to assay the serum for viral RNA and perform serology, earlier time points were used to assess for viremia and later time points for seroconversion. Along with sample partitioning for data maximization, the small blood volume led to concerns that there would be an undetectably small viral load. To circumvent this issue, neat serum and 1:10 diluted serum were inoculated onto Vero cells to amplify any virus that may have been present at low levels. One blind passage on Vero cells was done and cell supernatants assayed by qRT-PCR. The remaining serum from three of the four bats was assayed directly for ZIKV RNA.

Necropsies were performed immediately after euthanasia. Bats were assessed for gross pathology. The following tissues were collected for both experiments: heart, lung, liver, spleen, kidney, urinary bladder, prostate, testes, and brain. A portion of tissues were collected and kept at -80°C for RNA extraction, and a portion placed in 10% buffered formalin for histology at a 1:10 weight to volume ratio for histology.

For a negative control animal a male bat was trapped from the colony and euthanized under the same protocol as the experimental infection bats.

Vero E6 cells (ATCC) were propagated to 60% confluency in a 96-well tissue culture plate and infected with ZIKV strain PRVABC at an m.o.i. of 0.1. After a one hour incubation period, unbound virus was removed and replaced with 2% FBS-DMEM and incubated for a maximum of three days. Media was then replaced with 85% acetone for 20 minutes at -20°C to fix virus-infected cells to plate and serve as an antigen for enzyme-linked-immunosorbent assay (ELISA). Plates were stored at 4°C until use and used within two weeks. Plates were washed 5x with 0.05% Tween 20-PBS and blocked with SuperBlock T20 (TBS) Blocking Buffer (Thermo Fisher Scientific, Waltham, MA) for one hour at room temperature. Serum from an uninfected bat was used for a negative control. A convalescent human serum sample (kindly provided by B. Foy, CSU) was used as a positive control. A two-fold serial dilution was used starting at 1:100 to 1:12800. Diluted serum was placed in wells and incubated for two hours at room temperature. Serum was removed and plates washed. HRP-conjugated protein A/G (Thermo Fisher Scientific, Waltham, MA) was added at a concentration of 2 μg/ml to each well, and incubated for 30 minutes at room temperature. HRP-conjugated protein A/G was used in place of a secondary antibody as it targets the Fc portion of an antibody, which is highly conserved and therefore can be used for multiple animal species [ 54 ]. Plates were washed and 150 μl of ABTS Peroxidase Substrate (2 component) (KPL, Gaithersburg, MD) added according to manufacturers’ instructions, incubated at room temperature for 30 minutes, and then 150 μl of ABTS Peroxidase Stop solution (KPL, Gaithersburg, MD) added. Plates were read on an EMax Plus Microplate Reader (Cambridge Scientific, Watertown, MA). Absorbance was measured at 405 nm and the limit of detectable response was set at three standard deviation values above mean negative control serum.

RNA extraction

TRIzol Reagent was used for RNA extraction from serum-cell supernatants, serum, urine and tissues according to Ambion, Life Technologies protocol. For tissues, approximately 50 mg of tissue was homogenized with one mL of TRIzol Reagent. A 5mm stainless steel bead (Qiagen, Valencia, CA) was used with a TissueLyser LT (Qiagen, Valencia, CA) at 50 Hz for 5 minutes. One ml of TRIzol was added to urine to 5 to 15 μl of urine. One ml of TRIzol was added to 160 μl of serum from AJ-z2, AJ-z3, and AJ-z4. Two-hundred microliters of serum-cell supernatants were added to one ml of TRIzol. Samples were then incubated at room temperature for 5 minutes. Chloroform (Thermo Fisher Scientific, Waltham, MA) was added, samples were mixed, incubated for 3 minutes at room temperature and centrifuged at 12,000 x g for 15 minutes at 4°C. The aqueous phase was removed, 4 μg of glycogen (Thermo Fisher Scientific, Waltham, MA) and 100% molecular grade isopropanol added (Thermo Fisher Scientific, Waltham, MA). Samples were incubated at room temperature for 10 minutes and then centrifuged at 12,000 x g for 10 minutes at 4°C. Supernatant was removed and 75% molecular grade ethanol (Thermo Fisher Scientific, Waltham, MA) was added to RNA pellet. Samples were vortexed and centrifuged at 7500 x g for 5 minutes at 4°C. Wash was removed and air-dried. RNA was resuspended in RNase-free water and stored at -80°C for future use.

Viral RNA detection in serum samples

Vero cells were grown to 70 to 80% confluency in a 48-well tissue culture plate with 10% FBS-DMEM. Media was removed and 100 ul of bat serum from 2 dpi bats and 5 dpi bats was inoculated onto cells. Additionally, serum from each bat was diluted 10-fold in 2% FBS (Millipore Sigma) PBS supplemented with 1% calcium and magnesium, and inoculated onto cells. Samples were incubated for one hour at 37°C. Inoculum was removed and cells washed twice in sterile PBS. Two-percent FBS-DMEM was added to wells and plates were incubated at 37°C, 5% CO 2 . Cells were assessed daily for cytopathology (CPE) through day 7 but none was observed. Two-hundred microliters of the supernatant was removed on day 7 and used for RNA extractions. An additional 100 μl of supernatant was blind passaged onto Vero cells at 70 to 80% confluency. Cells were incubated for one hour at 37°C, washed twice with sterile PBS and 2% FBS-DMEM added. On day seven, supernatant was removed and TRIzol extractions performed for RNA recovery. Serum was treated as such in an attempt to amplify viral load and increase assay sensitivity serum may not be the most sensitive diagnostic sample [ 23 – 26 ].

If any serum was remaining it was directly used for TRIzol RNA extractions. Serum samples remained from AJ-z2 at 2 dpi, and AJ-z3 and AJ-z4 at 5 dpi. No serum remained from AJ-z1.

Reverse transcription probe based real time PCR

Roche Real Time Ready RNA Virus Master Kit (Roche, Indianapolis, IN) was used on RNA extracted from serum-cell supernatants, serum, urine and tissue to assay for ZIKV RNA according to manufacturers’ instructions. Primers used were ZIKV 1086 (CCGCTGCCCAACACAAG) and ZIKV 1162c (CCACTAACGTTCTTTTGCAGACAT). Probe was ZIKV 1107-FAM (AGCCTACCTTGACAAGCAGTCAGACACTCAA) [ 55 ]. Two-hundred nanograms of sample RNA was added to each reaction. Reactions were performed in duplicate. Standards were a non-infectious clone of full length ZIKV strain PRVABC59 by which concentration was determined through optical density. Molecular weight of the genome sequence was used to calculate copy number [ 56 ]. A log 10 dilution series of the standard was made and linear regression used to determine copy number equivalents of positive samples. Amplification was performed according to manufacturers’ protocol for Roche Real Time Ready RNA Virus Master Kit (Roche Diagnostics Corporation, Indianapolis, IN) with PCR conditions as follows: 8 min at 50°C, 30 s at 95°C, and 45 cycles of 10 s at 95°C, 20 s at 60°C and 10 s at 72°C.

Tissues fixed in 10%-buffered formalin were cut in and submitted to Colorado State University Veterinary Diagnostic Laboratory (CSU VDL, Fort Collins, CO) for paraffin embedding, sectioning and staining with hematoxylin and eosin, as well as immunohistochemistry (IHC). Tissues cut in on bats to assess for histology included: heart, lung, liver, kidney, testes, prostate, urinary bladder and brain. Additionally, for AJ-z3 and AJ-z5 mandibular salivary gland was cut in. AJ-z4 had esophagus and lymphoid tissue that included palatine salivary gland cut in. Antibody for IHC was a polyclonal rabbit antibody that targets preM and E proteins of ZIKV and was provided by CSU VDL’s pathology department. The Bond-III automated instrument (Leica Biosystems, Wetzlar, Germany) was used for IHC staining. All slides were blindly read by a diplomat of the American College of Veterinary Pathologists.

Tissue preparation for immunohistochemistry and immunofluorescence

Brain tissues was prepared for immunohistochemical and immunofluorescence staining as previously reported [ 57 ]. Tissue was dehydrated by using a graded ethanol series of 70% ethanol for 2 h, 80% overnight, 90% for 2 h and 100% for 2 h. Brain tissues were then post-fixed in dimethylbenzene for 30 min and embedded in dimethylbenzene-paraffin at 60°C for 2 h, after which samples were embedded in a metal frame. Sagittal sections were collected at 5um thick. All dewaxing, antigen retrieval and immunofluorescence staining was automated using a Leica Bond RXM. In short, sections were dewaxed using ethanol and then boiled in antigen retrieval solution for 10 minutes. The cooled sections were incubated in 3% H2O2 for 15 min at room temperature and then blocked with 2% donkey and goat serum (Millipore Sigma) for 1 hour. Rabbit anti-Iba1 (Wako Chemicals USA, Irvine, CA) and 4G-2 Flavivirus E specific monoclonal antibodies (CDC, Fort Collins) were diluted in TBS to final concentrations of 1:250 and 1:50, respectively. Sections were incubated in primary antibodies concurrently at room temperature for one hour. Following removal of unbound primary antibodies by washing, goat anti-rabbit secondary (AlexaFluor-555) and donkey anti-mouse secondary (AlexaFluor-647) was added and incubated for 1 hour at room temperature. Finally, DAPI counterstain (Vector Laboratories, Burlingame, CA) was applied and sections were washed with TBS prior to cover slipping for imaging.

Confocal microscopy

Stained sections were imaged on a Ziess LSM 800 with Airyscan laser-scanning confocal microscope (Ziess, Oberkochen, Germany) using a 63× oil immersion objective. Each field of view was imaged as a z -stack (8–10 planes, .5- μ m step size) transformed into a single maximum projection image using the Ziess Zen (blue) imaging software.

Acknowledgments

The authors would like to than Brent Davis, CDC, Fort Collins, CO for supplying anti-ZIKV polyclonal and specific monoclonal antibodies.

• View Article
• Google Scholar
• PubMed/NCBI
• 8. Zika cases and congenital syndrome associated with Zika virus reported by countries and territories in the Americas, 2015–2017. Pan American Health Organization, World Health Organization; 2017 April 13, 2017.