mycorrhizal fungi experiment

Open Access is an initiative that aims to make scientific research freely available to all. To date our community has made over 100 million downloads. It’s based on principles of collaboration, unobstructed discovery, and, most importantly, scientific progression. As PhD students, we found it difficult to access the research we needed, so we decided to create a new Open Access publisher that levels the playing field for scientists across the world. How? By making research easy to access, and puts the academic needs of the researchers before the business interests of publishers.

We are a community of more than 103,000 authors and editors from 3,291 institutions spanning 160 countries, including Nobel Prize winners and some of the world’s most-cited researchers. Publishing on IntechOpen allows authors to earn citations and find new collaborators, meaning more people see your work not only from your own field of study, but from other related fields too.

Brief introduction to this section that descibes Open Access especially from an IntechOpen perspective

Want to get in touch? Contact our London head office or media team here

Our team is growing all the time, so we’re always on the lookout for smart people who want to help us reshape the world of scientific publishing.

Home > Books > Unveiling the Mycorrhizal World

Introductory Chapter: The Importance of Mycorrhiza Fungi to Sustainable Food Production

Published: 28 August 2024

DOI: 10.5772/intechopen.115286

Cite this chapter

There are two ways to cite this chapter:

From the Edited Volume

Unveiling the Mycorrhizal World

Edited by Everlon Cid Rigobelo

To purchase hard copies of this book, please contact the representative in India: CBS Publishers & Distributors Pvt. Ltd. www.cbspd.com | [email protected]

Chapter metrics overview

Impact of this chapter

Total Chapter Downloads on intechopen.com

Author Information

Everlon cid rigobelo *.

• Plant Production Department, Universidade Estadual Paulista – Campus de Jaboticabal, Jaboticabal, São Paulo, Brazil

*Address all correspondence to: [email protected]

1. Introduction

Fungi are eukaryotic microorganisms that possess a structure similar to plant roots, known as hyphae, which are responsible for absorbing water and nutrients from the soil and providing support to the fungi. Unicellular fungi that do not produce hyphae are referred to as yeasts [ 1 ].

Fungi exhibit a vast range of metabolic and physiological capabilities, allowing them to produce an extensive array of secondary metabolites, as well as a variety of enzymes that play critical roles in the soil’s biochemical cycles. Additionally, these organisms play a crucial role in increasing the availability of essential nutrients in the soil [ 2 ].

Some saprotrophic fungi, possessing the ability to decompose organic matter and release nutrients trapped within their components, have evolved to develop the capacity to interact with the roots of plants, which are called mycorrhiza fungi. This interaction necessitates several physiological and morphological adaptations in both fungi and plants. The ability of saprotrophic fungi to thrive in living plants is hindered by their inability to suppress the immune systems of plants. Consequently, these fungi were confined to the decomposition of organic matter. Notably, some fungi have lost their capacity for saprotrophic growth and now rely entirely on plants for their survival [ 3 ].

Fungi engage in a mutually beneficial partnership with the host plant, providing the latter with various advantages, while simultaneously obtaining carbohydrates and energy-rich molecules from the host [ 4 ]. Fungi are categorized into various types of mycorrhiza, based on their level of interaction with plants. One of these is Arbuscular Mycorrhizal Fungi (AMF), which establishes intricate branching structures called arbuscules within the root cells of plants, facilitating the transfer of nutrients and water from the soil to the plants through hyphae and the recycling of energy and carbohydrates from the host plant. The consequence of this interaction is increased plant growth [ 5 ] .

In contrast, another type of mycorrhizal fungi is less intimate with the plant host Ectomycorrhiza Fungi (EMF). This type of mycorrhiza forms a structure known as ectosclerotium within the roots. EMF provides nutrients such as phosphorus, nitrogen, and water to plants. The relationship between plants and EMF is not totally integrated, and EMF does not colonize the entire root system [ 6 ].

Mycoheterotrophic mycorrhizae are a significant type of mycorrhizal fungi that include non-photosynthetic plant species, such as Indian or ghost pipes, and fungi. In this type of mycorrhizal association, the plant obtains nutrients solely from the fungus, which leads to a complex network of roots and fungi [ 7 ]. Another type of mycorrhizal fungus is ericoid mycorrhiza. This type of mycorrhizae is primarily associated with ericaceous plants, such as heathers and blueberries, and shares similarities with arbuscular mycorrhizae but exhibits distinct interactions with its host [ 1 ].

Orchid mycorrhizae, another type of mycorrhizae, is essential for seed germination and the early growth of many orchid species. The fungus forms dense coils around the roots of the orchid, which are crucial for its survival [ 8 ]. The existence of monotropoid mycorrhizae, a type of mycorrhizal fungus, is noteworthy. This type of mycorrhizae is unique because it is found in plants that lack chlorophyll, such as in ghost pipes. Plants rely entirely on fungi for their nutritional needs, resulting in the development of a complex root-fungus network [ 3 ].

Mycorrhizal fungi are unique in that they are influenced by different types of plants, making them a distinct type of fungus that colonizes soils worldwide. Approximately 250 species of mycorrhizal fungi are found in various families and genera. These fungi are obligate symbionts, meaning that they rely on plants to obtain energy and carbohydrate for survival. At the same time, they are essential participants in several nutrient cycles that are important for all living organisms, including nutrients such as phosphorus, nitrogen, and potassium [ 6 ].

It is widely believed that the relationship between land plants and mycorrhizal fungi has existed since the dawn of the former, which stretches back hundreds of millions of years. Among the various mutually beneficial interactions that exist between plants and microorganisms, arbuscular mycorrhizal symbiosis (AMF) is the most prevalent. Research indicates that AMF play a pivotal role in the nutrition and growth of plants, particularly under stress conditions, and help to maintain several crucial ecosystem processes. This association benefits both parties, as fungi assist plants in absorbing essential nutrients while receiving carbohydrates from them. In addition to decomposing dead organic matter, ectomycorrhizal fungi also form partnerships with forest trees and contribute to the storage of soil carbon [ 9 ].

Mycorrhizal fungi are crucial for the proper functioning of soils, element cycling, and the development of sustainable soil and land-use practices [ 10 ]. These fungi contribute significantly to sustainable agriculture by improving the soil structure, enhancing nutrient acquisition, and reducing biotic and abiotic stress, leading to increased plant growth and productivity. They form mutualistic relationships with plant roots, facilitating the efficient absorption of essential mineral nutrients, such as nitrogen, phosphorus, and potassium, and reducing dependence on chemical fertilizers. Additionally, mycorrhizal fungi can help manage plant diseases by antagonizing pathogens and can assist plants in enduring abiotic stresses, such as drought, salinity, and heavy metal toxicity. They also enhance soil quality and stability by increasing soil structure through the secretion of glomalin. The integration of mycorrhizal fungi into agricultural production offers a viable alternative for addressing the challenges faced by conventional agricultural systems. By promoting plant growth, decreasing dependence on chemical inputs, and enhancing soil health, this approach provides a sustainable solution for agriculture [ 11 ].

2. Mycorrhizal fungi and nitrogen

Nitrogen (N) is a crucial macronutrient for plants and plays a vital role in several physiological processes. The significance of nitrogen is highlighted by the fact that it is an essential component of amino acids, which are the building blocks of proteins. Proteins are vital to the structure and function of plant cells. Nitrogen is a part of chlorophyll, the pigment responsible for photosynthesis in plants, and its deficiency can result in chlorosis and yellowing of leaves due to reduced chlorophyll synthesis. Nitrogen is also a component of nucleic acids (DNA and RNA) that provides genetic instructions for plant growth and development. Several coenzymes and adenosine triphosphate (ATP), the main cellular energy sources, also contain nitrogen [ 12 ]. It is important to note that plants require substantial amounts of nitrogen for growth; however, a significant portion of the nitrogen present in the biosphere is unavailable to them and other microorganisms. Only nitrogenase carriers, a select group of bacteria, can obtain nitrogen from the air and make it accessible to several organisms. An adequate amount of nitrogen is crucial for the vigorous vegetative growth of plants, leading to faster growth, larger leaves, and more intense green coloration. Nitrogen deficiency usually results in stunted growth, small pale leaves, and low productivity [ 13 ]. It is not possible to measure the amount of nitrogen through soil fertility analysis because of its instability. Consequently, the appropriate amount of nitrogen for crop production must be determined by considering the crop species and estimated productivity. This amount of nitrogen must be applied through mineral fertilization, and its application must be divided many times throughout crop production to reduce nitrogen loss [ 14 ].

Although mycorrhizal fungi cannot obtain atmospheric nitrogen and convert it into a form accessible to plants, they can release nitrogen that is trapped in organic matter, rendering it available to plants, thereby facilitating plant growth. Mycorrhizal fungi offer a promising alternative for sustainably supplying nitrogen to plants, as they are an effective means of addressing the increasing demand for nitrogen in agricultural production [ 15 ].

3. Mycorrhizal fungi and phosphorus

Phosphorus (P) is an indispensable element for all living organisms, as it plays a vital role in energy transfer and cell structures. Unlike nitrogen, which has a gaseous phase, phosphorus mainly exists in a solid form, making its cycle distinct. Phosphorus (P) is a crucial macronutrient for plants and is central to several physiological processes. The significance of phosphorus in plants is demonstrated by the following points: Phosphorus is a key component of adenosine triphosphate (ATP) molecules, which serve as the primary “energy currency” of cells. ATP is essential for many biochemical reactions and provides energy for various cellular functions [ 16 ].

Phosphorus is a vital component of nucleic acids, DNA and RNA, and carries the genetic information of plants. Many coenzymes and related molecules essential for many biochemical reactions contain phosphorus in their composition [ 17 ]. Phosphorus is crucial for photosynthesis and respiration processes, as well as the synthesis and breakdown of carbohydrates. Phosphorus is essential for proper root development, especially for primary roots that grow deeper into the soil. Adequate amounts of phosphorus are vital for the formation of flowers and fruits and directly affect plant production. Phosphorus aids the proper maturation of plants and seeds [ 18 , 19 ].

Plants with an adequate supply of phosphorus generally exhibit enhanced resistance to diseases and various forms of abiotic stress. Conversely, phosphorus deficiency in plants may result in stunted growth and leaves that are dark in color with a bronze or purple tinge. This is attributable to the accumulation of anthocyanins and a concurrent reduction in seed and fruit production [ 20 ]. The mobility of phosphorus in the soil is limited, which means that it does not readily migrate to the roots of plants, particularly in alkaline or extremely acidic soils. Consequently, even when phosphorus is present in the soil, its availability to plants maybe diminished [ 21 ].

Arbuscular mycorrhizal fungi (AMF) are important for the uptake of phosphorus (P) by plants, as they form symbiotic relationships with plant roots, providing essential nutrients such as phosphorus and nitrogen, while obtaining carbon from the plant root system. Soils with increased levels of available phosphorus can have detrimental effects on both the diversity of microorganisms and interactions between mycorrhizae and their plant hosts. This is because high levels of available phosphorus decrease the need for plants to rely on beneficial fungi. Consequently, when there is excess available phosphorus, plants may allocate less carbon to mycorrhizae, leading to a reduction in the diversity and abundance of mycorrhizae. This decrease in AMF diversity and abundance suggested a less symbiotic relationship. On the other hand, when the soil is phosphorus deficient, the use of arbuscular mycorrhizal fungi (AMF) to provide phosphorus to the plant is a great alternative. AMF can supply phosphorus even in soils with phosphorus deficiency, thereby promoting good crop yield [ 22 ].

4. Conclusion

Mycorrhizal fungi are widespread organisms found in various regions across the globe and are closely related to a broad range of root plant species, including agricultural crops. These fungi exhibit multiple traits that promote plant growth, and numerous studies have demonstrated their ability to increase plant growth by improving the efficiency of nutrient and water uptake from the soil as well as their availability. Specifically, mycorrhizal fungi have been shown to increase the availability of nitrogen and phosphorus in plants. While these fungi cannot fix nitrogen from the atmosphere, they are capable of mineralizing organic matter, releasing nitrogen that is trapped in molecules and cellular organelles. In addition, arbuscular mycorrhizal fungi (AMF) can increase phosphorus availability in plants. However, high levels of phosphorus in the soil can decrease the interactions between the fungus and the host plant. Some studies have shown that mycorrhizal fungi can enhance plant tolerance to environmental stress. In summary, mycorrhizal fungi can be used to promote plant growth, improve nutrient utilization efficiency, reduce environmental impacts and production costs, and enhance plant tolerance to cope with stress conditions. The use of AMF is an excellent strategy to achieve sustainable production.

• 1. Parniske M. Arbuscular mycorrhiza: The mother of plant root endosymbioses. Nature Reviews Microbiology. 2008; 6 (10):763-775. DOI: 10.1038/NRMICRO1987
• 2. Wang B, Qiu YL. Phylogenetic distribution and evolution of mycorrhizas in land plants. Mycorrhiza. 2006; 16 (5):299-363. DOI: 10.1007/S00572-005-0033-6
• 3. Marks GC. Causal morphology and evolution of mycorrhizas. Agriculture, Ecosystems & Environment. 1991; 35 (2-3):89-104
• 4. Rooney DC, Killham K, Bending GD, Baggs E, Weih M, Hodge A. Mycorrhizas and biomass crops: Opportunities for future sustainable development. Trends in Plant Science. 2009; 14 (10):542-549. DOI: 10.1016/j.tplants.2009.08.004
• 5. Smith SE, Smith FA. Roles of arbuscular mycorrhizas in plant nutrition and growth: New paradigms from cellular to ecosystem scales. Annual Review of Plant Biology. 2011; 62 :227-250. DOI: 10.1146/ANNUREV-ARPLANT-042110-103846
• 6. Messa VR, Savioli MR. Improving sustainable agriculture with arbuscular mycorrhizae. Rhizosphere. 2021; 19 :1-3, 100412
• 7. Pozo MJ, Azcón-Aguilar C. Unraveling mycorrhiza-induced resistance. Current Opinion in Plant Biology. 2007; 10 (4):393-398. DOI: 10.1016/j.pbi.2007.05.004
• 8. Sawers RJH, Gutjahr C, Paszkowski U. Cereal mycorrhiza: An ancient symbiosis in modern agriculture. Trends in Plant Science. 2008; 13 (2):93-97. DOI: 10.1016/j.tplants.2007.11.006
• 9. Cavagnaro TR, Bender SF, Asghari HR, van der Heijden MGA. The role of arbuscular mycorrhizas in reducing soil nutrient loss. Trends in Plant Science. 2015; 20 (5):283-290. DOI: 10.1016/j.tplants.2015.03.004
• 10. Keymer A, Gutjahr C. Cross-kingdom lipid transfer in arbuscular mycorrhiza symbiosis and beyond. Current Opinion in Plant Biology. 2018; 44 :137-144. DOI: 10.1016/j.pbi.2018.04.005
• 11. Cameron DD, Neal AL, van Wees SCM, Ton J. Mycorrhiza-induced resistance: More than the sum of its parts? Trends in Plant Science. 2013; 18 (10):539-545. DOI: 10.1016/j.tplants.2013.06.004
• 12. Novoa R, Loomis RS. Nitrogen and plant production. Plant and Soil. 1981; 58 (1-3):177-204. DOI: 10.1007/BF02180053/METRICS
• 13. Sheoran S, Kumar S, Kumar P, Meena RS, Rakshit S. Nitrogen fixation in maize: Breeding opportunities. Theoretical and Applied Genetics. 2021; 134 (5):1263-1280. DOI: 10.1007/S00122-021-03791-5
• 14. Hedin LO, Brookshire ENJ, Menge DNL, Barron AR. The nitrogen paradox in tropical forest ecosystems. Annual Review of Ecology, Evolution, and Systematics. 2009; 40 :613-635. DOI: 10.1146/ANNUREV.ECOLSYS.37.091305.110246
• 15. Jansa J, Forczek ST, Rozmoš M, Püschel D, Bukovská P, Hršelová H. Arbuscular mycorrhiza and soil organic nitrogen: Network of players and interactions. Chemical and Biological Technologies in Agriculture. 2019; 6 (1):1-10
• 16. Adnan M, Fahad S, Zamin M, Shah S, Mian IA, Danish S, et al. Coupling phosphate-solubilizing bacteria with phosphorus supplements improve maize phosphorus acquisition and growth under lime induced salinity stress. Plants. 2020; 9 (7):1-18. DOI: 10.3390/plants9070900
• 17. Bindraban PS, Dimkpa CO, Pandey R. Exploring phosphorus fertilizers and fertilization strategies for improved human and environmental health. Biology and Fertility of Soils. 2020; 56 (3):299-317. DOI: 10.1007/S00374-019-01430-2/FIGURES/4
• 18. Malhotra H, Vandana, Sharma S, Pandey R. Phosphorus nutrition: Plant growth in response to deficiency and excess. Plant Nutrients and Abiotic Stress Tolerance. 2018; 1 :171-190
• 19. Malhotra M, Srivastava S. Stress-responsive indole-3-acetic acid biosynthesis by Azospirillum brasilense SM and its ability to modulate plant growth. European Journal of Soil Biology. 2009; 45 (1):73-80. DOI: 10.1016/j.ejsobi.2008.05.006
• 20. Parvin S, Van Geel M, Yeasmin T, Verbruggen E, Honnay O. Effects of single and multiple species inocula of arbuscular mycorrhizal fungi on the salinity tolerance of a Bangladeshi rice (Oryza sativa L.) cultivar. Mycorrhiza. 2020; 30 (4):431-444. DOI: 10.1007/s00572-020-00957-9
• 21. Pereira NCM, Galindo FS, Gazola RPD, Dupas E, Rosa PAL, Mortinho ES, et al. Corn yield and phosphorus use efficiency response to phosphorus rates associated with plant growth promoting bacteria. Frontiers in Environmental Science. 2020; 8 (40):1-12
• 22. Ma J, Xie Y, Sun J, Zou P, Ma S, Yuan Y, et al. Co-application of chitooligosaccharides and arbuscular mycorrhiza fungi reduced greenhouse gas fluxes in saline soil by improving the rhizosphere microecology of soybean. Journal of Environmental Management. 2023; 345 :118836. DOI: 10.1016/j.jenvman.2023.118836

© 2024 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Continue reading from the same book

Edited by Everlon Rigobelo

By Ban Taha Mohammed

9 downloads

By Yunjian Xu and Fang Liu

31 downloads

By YingWu Shi, XinXiang Niu, Hongmei Yang, Ming Chu, ...

30 downloads

IntechOpen Author/Editor? To get your discount, log in .

Discounts available on purchase of multiple copies. View rates

Local taxes (VAT) are calculated in later steps, if applicable.

Support: [email protected]

Determine leaf manganese concentration to estimate rhizosheath carboxylates of mycorrhizal plants in forest ecosystems

• Published: 26 August 2024

Cite this article

• Yanliang Wang   ORCID: orcid.org/0000-0001-6095-8235 1 ,
• Meng Yang 1 , 2 &
• Fuqiang Yu 1  

42 Accesses

Explore all metrics

Root exudation of carboxylates is a key response to phosphorus (P) limitation for many plant species. However, sampling and quantitative and qualitative determination of root exudates under field conditions faces various challenges. Recently, multiple studies have demonstrated that manganese (Mn) concentration in mature leaves may serve as a proxy for rhizosheath carboxylate concentration. In this issue of Plant and Soil , the paper by Yan and co-authors shows that leaf Mn concentration ([Mn]) was higher in P-limited forests of southern China than in forests of northern China that exhibit higher soil [P]. This study revealed the potential relationships between rhizosheath carboxylates and leaf [Mn] in the studied Chinese flora, and indicates a potential common strategy (i.e. root carboxylate exudation) among plants, including many mycorrhizal plants, in P-limited forests. Despite the fact that there is great variation among plant species, and the molecular basis underlying the positive correlation between plant Mn uptake and root release of carboxylates remains largely unexplored, this study has paved the road for an easy and reliable way to assess rhizosheath carboxylates in forest ecosystems. In combination with the handheld X-ray fluorescence spectroscopy system that enables non-destructive analysis of [Mn] in dried mature leaves (e.g., herbarium specimens), researchers are now able to estimate the patterns of root-released carboxylates for a broad range of plant species under various environmental conditions, in an easy, rapid and low-costs way.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Subscribe and save.

• Get 10 units per month
• Download Article/Chapter or eBook
• 1 Unit = 1 Article or 1 Chapter
• Cancel anytime

Price includes VAT (Russian Federation)

Instant access to the full article PDF.

Rent this article via DeepDyve

Institutional subscriptions

Similar content being viewed by others

Root carboxylate release is common in phosphorus-limited forest ecosystems in China: using leaf manganese concentration as a proxy

Leaf manganese concentrations as a tool to assess belowground plant functioning in phosphorus-impoverished environments

Differences in root exudate inputs and rhizosphere effects on soil N transformation between deciduous and evergreen trees

Explore related subjects.

• Environmental Chemistry

Data availability

Not applicable.

Albornoz FE, Dixon KW, Lambers H (2021) Revisiting mycorrhizal dogmas: are mycorrhizas really functioning as they are widely believed to do? Soil Ecol Lett 3:73–82. https://doi.org/10.1007/s42832-020-0070-2

Article   CAS   Google Scholar  

Alejandro S, Holler S, Meier B, Peiter E (2020) Manganese in plants: from acquisition to subcellular allocation. Front Plant Sci 11:300. https://doi.org/10.3389/fpls.2020.00300

Article   PubMed   PubMed Central   Google Scholar  

Andrino A, Guggenberger G, Kernchen S, Mikutta R, Sauheitl L, Boy J (2021) Production of organic acids by arbuscular mycorrhizal fungi and their contribution in the mobilization of phosphorus bound to iron oxides. Front Plant Sci 12:661842. https://doi.org/10.3389/fpls.2021.661842

Badri DV, Vivanco JM (2009) Regulation and function of root exudates. Plant Cell Environ 32:666–681. https://doi.org/10.1111/j.1365-3040.2009.01926.x

Article   PubMed   CAS   Google Scholar  

Briccoli Bati C, Santilli E, Lombardo L (2015) Effect of arbuscular mycorrhizal fungi on growth and on micronutrient and macronutrient uptake and allocation in olive plantlets growing under high total Mn levels. Mycorrhiza 25:97–108. https://doi.org/10.1007/s00572-014-0589-0

De Oliveira VH, Montanha GS, Carvalho HWP, Mazzafera P, de Andrade SAL (2023) Mycorrhizal symbiosis alleviates Mn toxicity and downregulates Mn transporter genes in Eucalyptus tereticornis under contrasting soil phosphorus. Plant Soil 489:361–383. https://doi.org/10.1007/s11104-023-06024-4

Du E, Terrer C, McNulty SG, Jackson RB (2024) Nutrient limitation in global forests: current status and future trends. In: McNulty SG (ed) Future forests- mitigation and adaptation to climate change. Elsevier, Amsterdan, pp 65–74

Google Scholar  

Hashem AR (1995) The role of mycorrhizal infection in the resistance of Vaccinium macrocarpon to manganese. Mycorrhiza 5:289–291. https://doi.org/10.1007/BF00204964

Article   Google Scholar  

Hinsinger P, Plassard C, Tang C, Jaillard B (2003) Origins of root-mediated pH changes in the rhizosphere and their responses to environmental constraints: a review. Plant Soil 248:43–59. https://doi.org/10.1023/A:1022371130939

Hou E, Luo Y, Kuang Y, Chen C, Lu X, Jiang L, Luo X, Wen D (2020) Global meta-analysis shows pervasive phosphorus limitation of aboveground plant production in natural terrestrial ecosystems. Nat Commun 11:637. https://doi.org/10.1038/s41467-020-14492-w

Article   PubMed   PubMed Central   CAS   Google Scholar  

Huang G, Hayes PE, Ryan MH, Pang J, Lambers H (2017) Peppermint trees shift their phosphorus-acquisition strategy along a strong gradient of plant-available phosphorus by increasing their transpiration at very low phosphorus availability. Oecologia 185:387–400. https://doi.org/10.1007/s00442-017-3961-x

Article   PubMed   Google Scholar  

Igamberdiev AU, Eprintsev AT (2016) Organic acids: The pools of fixed carbon involved in redox regulation and energy balance in higher plants. Front Plant Sci 7. https://doi.org/10.3389/fpls.2016.01042

Jones DL (1998) Organic acids in the rhizosphere – a critical review. Plant Soil 205:25–44. https://doi.org/10.1023/A:1004356007312

Jones D, Dennis P, Owen A, Van Hees P (2003) Organic acid behavior in soils–misconceptions and knowledge gaps. Plant Soil 248:31–41. https://doi.org/10.1023/A:1022304332313

Lambers H (2022) Phosphorus acquisition and utilization in plants. Annu Rev Plant Biol 73:17–42. https://doi.org/10.1146/annurev-arplant-102720-125738

Lambers H, Hayes PE, Laliberte E, Oliveira RS, Turner BL (2015) Leaf manganese accumulation and phosphorus-acquisition efficiency. Trends Plant Sci 20:83–90. https://doi.org/10.1016/j.tplants.2014.10.007

Lambers H, Wright IJ, Guilherme Pereira C, Bellingham PJ, Bentley LP, Boonman A, Cernusak LA, Foulds W, Gleason SM, Gray EF, Hayes PE, Kooyman RM, Malhi Y, Richardson SJ, Shane MW, Staudinger C, Stock WD, Swarts ND, Turner BL, Turner J, Veneklaas EJ, Wasaki J, Westoby M, Xu Y (2021) Leaf manganese concentrations as a tool to assess belowground plant functioning in phosphorus-impoverished environments. Plant Soil 461:43–61. https://doi.org/10.1007/s11104-020-04690-2

Muler AL, Oliveira RS, Lambers H, Veneklaas EJ (2014) Does cluster-root activity benefit nutrient uptake and growth of co-existing species? Oecologia 174:23–31. https://doi.org/10.1007/s00442-013-2747-z

Naraian R, Kumari S (2017) Microbial production of organic acids. In: Gupta VK, Treichel H, Shapaval VO, de Oliveira LA, Tuohy MG (eds) Microbial functional foods and nutraceuticals. Wiley, New York, pp 93–121

Chapter   Google Scholar  

Neumann G, George TS, Plassard C (2009) Strategies and methods for studying the rhizosphere- the plant science toolbox. Plant Soil 321:431–456. https://doi.org/10.1007/s11104-009-9953-9

Oburger E, Jones DL (2018) Sampling root exudates – Mission impossible? Rhizosphere 6:116–133. https://doi.org/10.1016/j.rhisph.2018.06.004

Pang J, Bansal R, Zhao H, Bohuon E, Lambers H, Ryan MH, Ranathunge K, Siddique KH (2018) The carboxylate-releasing phosphorus-mobilizing strategy can be proxied by foliar manganese concentration in a large set of chickpea germplasm under low phosphorus supply. New Phytol 219:518–529. https://doi.org/10.1111/nph.15200

Phillips RP, Erlitz Y, Bier R, Bernhardt ES (2008) New approach for capturing soluble root exudates in forest soils. Funct Ecol 22:990–999. https://doi.org/10.1111/j.1365-2435.2008.01495.x

Purwadi I, Erskine PD, Hutahaean BP, Wijaya TR, Nurtjahya E, van der Ent A (2024) Rare earth elements (REEs) in soils and plants of Bangka Island (Indonesia) focussing on (hyper)accumulation. Plant Soil. https://doi.org/10.1007/s11104-024-06735-2

Ray P, Adholeya A (2009) Correlation between organic acid exudation and metal uptake by ectomycorrhizal fungi grown on pond ash in vitro . Biometals 22:275–281. https://doi.org/10.1007/s10534-008-9163-6

Ryan MH, Tibbett M, Edmonds-Tibbett T, Suriyagoda LDB, Lambers H, Cawthray GR, Pang J (2012) Carbon trading for phosphorus gain: the balance between rhizosphere carboxylates and arbuscular mycorrhizal symbiosis in plant phosphorus acquisition. Plant Cell Environ 35:2170–2180. https://doi.org/10.1111/j.1365-3040.2012.02547.x

Smith SE, Smith FA, Jakobsen I (2003) Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth responses. Plant Physiol 133:16–20. https://doi.org/10.1104/pp.103.024380

Sun H, Zhang J, Deng T, Boufford DE (2017) Origins and evolution of plant diversity in the Hengduan Mountains, China. Plant Diversity 39:161–166. https://doi.org/10.1016/j.pld.2017.09.004

van der Ent A, Echevarria G, Pollard AJ, Erskine PD (2019) X-ray fluorescence Ionomics of herbarium collections. Sci Rep 9:4746. https://doi.org/10.1038/s41598-019-40050-6

van der Ent A, Casey LW, Purwadi I, Erskine PD (2023) Laboratory μ-X-ray fluorescence elemental mapping of herbarium specimens for hyperaccumulator studies. Plant Soil 493:663–671. https://doi.org/10.1007/s11104-023-06201-5

van Scholl L, Hoffland E, van Breemen N (2006) Organic anion exudation by ectomycorrhizal fungi and Pinus sylvestris in response to nutrient deficiencies. New Phytol 170:153–163. https://doi.org/10.1111/j.1469-8137.2006.01649.x

Wang Y, Lambers H (2020) Root-released organic anions in response to low phosphorus availability: recent progress, challenges and future perspectives. Plant Soil 447:135–156. https://doi.org/10.1007/s11104-019-03972-8

Wang Y, Lysoe E, Armarego-Marriott T, Erban A, Paruch L, van Eerde A, Bock R, Liu-Clarke J (2018) Transcriptome and metabolome analyses provide insights into root and root-released organic anion responses to phosphorus deficiency in oat. J Exp Bot 69:3759–3771. https://doi.org/10.1093/jxb/ery176

Wang Y, Wang R, Lu B, Guerin-Laguette A, He X, Yu F (2021) Mycorrhization of Quercus mongolica seedlings by Tuber melanosporum alters root carbon exudation and rhizosphere bacterial communities. Plant Soil 467:391–403. https://doi.org/10.1007/s11104-021-05112-7

Wang Y, He X, Yu F (2022) Non-host plants: are they mycorrhizal networks players? Plant Diversity 44:127–134. https://doi.org/10.1016/j.pld.2021.06.005

Wang L, Zhang L, George TS, Feng G (2023) A core microbiome in the hyphosphere of arbuscular mycorrhizal fungi has functional significance in organic phosphorus mineralization. New Phytol 238:14. https://doi.org/10.1111/nph.18642

Yan L, Tang D, Pang J, Lambers H (2024) Root carboxylate release is common in phosphorus-limited forest ecosystems in China: using leaf manganese concentration as a proxy. Plant Soil. https://doi.org/10.1007/s11104-024-06791-8

Yu RP, Su Y, Lambers H, van Ruijven J, An R, Yang H, Yin XT, Xing Y, Zhang WP, Li L (2023) A novel proxy to examine interspecific phosphorus facilitation between plant species. New Phytol 239:1637–1650. https://doi.org/10.1111/nph.19082

Yuan J, Yan R, Zhang X, Su K, Liu H, Wei X, Wang R, Huang L, Tang N, Wan S, Liu W, Lambers H, Zheng Y, He X, Yu F, Wang Y (2024) Soil organic phosphorus is mainly hydrolyzed via phosphatases from ectomycorrhiza-associated bacteria rather than ectomycorrhizal fungi. Plant Soil. https://doi.org/10.1007/s11104-024-06649-z

Zhou XM, Ranathunge K, Cambridge ML, Dixon KW, Hayes PE, Nikolic M, Shen Q, Zhong H, Lambers H (2022) A cool spot in a biodiversity hotspot: why do tall Eucalyptus forests in Southwest Australia exhibit low diversity? Plant Soil 476:669–688. https://doi.org/10.1007/s11104-022-05559-2

Zhou XM, Lambers H, Ranathunge K (2024) Carboxylate-releasing Eucalyptus patens in a low-diversity spot in a biodiversity hotspot in Southwest Australia is not a ‘Darwinian demon.’ Plant Soil 496:569–587. https://doi.org/10.1007/s11104-023-06382-z

Download references

Acknowledgements

We thank Yunnan High Level Talent Introduction Plans to YW, and the Yunnan Technology Innovation Program (202205AD160036) to FY. We also thank Prof. Hans Lambers for helpful comments.

Author information

Authors and affiliations.

The Germplasm Bank of Wild Species & Yunnan Key Laboratory for Fungal Diversity and Green Development, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201, Yunnan, China

Yanliang Wang, Meng Yang & Fuqiang Yu

University of Chinese Academy of Sciences, Beijing, 100049, China

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Yanliang Wang .

Ethics declarations

Conflict of interest.

The authors declare that they have no conflict of interest.

Additional information

Responsible Editor: Tim S. George.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.

Reprints and permissions

About this article

Wang, Y., Yang, M. & Yu, F. Determine leaf manganese concentration to estimate rhizosheath carboxylates of mycorrhizal plants in forest ecosystems. Plant Soil (2024). https://doi.org/10.1007/s11104-024-06929-8

Download citation

Received : 02 July 2024

Accepted : 20 August 2024

Published : 26 August 2024

DOI : https://doi.org/10.1007/s11104-024-06929-8

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Field conditions
• Carboxylate exudation
• Mycorrhizal symbiosis
• Phosphorus-acquisition strategy
• X-ray fluorescence spectroscopy
• Find a journal
• Publish with us
• Track your research

A Way To Garden

'horticultural how-to and woo-woo' | margaret roach, head gardener

feed the soil: my experiment with mycorrhizae

The tipping point had been meeting Graham and Layla Phillips, who had recently taken over Bio-Organics , founded in 1996 and one of the first companies to commercialize mycorrhizal agricultural products (disclosure: they have advertised on A Way to Garden).  We got to talking, and I pestered them with my usual endless questions–and then bought myself that jar of a blend of viable beneficial organisms from their online store.

I didn’t just take their word for how it all worked, however; I dug deeper. Extensive Texas A&M research over more than 25 years reports that the benefits of mycorrhizae include plants that are more vigorous, with increased drought and disease resistance and the ability take up more nutrients and water. They may also need less pesticides because of their overall better response to stress. (Mycorrhizae have even been used by Aggie researchers on Texas lignite coal-industry land to try to revitalize it after mining, but I’m hoping your garden isn’t in that condition!)

Even deeper background: Mycorrhizae weren’t “invented,” not by Bio-Organics or Texas A&M any other current commercial producer or research institution. They’re a group of naturally occurring soil organisms, one or more species of which most plants depend on to thrive (different plants, different preferred species).  The interaction is mutualistic, not just one-way: The fungi use the Carbon produced by the plants to support their own functions, in turn helping the plant to reach farther into the soil by creating an extensive network or web of fungal filaments–they look like root hairs–called hyphae.

When I first read about using mycorrhizae, it all sounded a little like pre-treating beans and peas with Nitrogen-fixing inoculant, or taking probiotics for a healthy gut—you know, natural, or holistic. But of course those examples are uses of friendly bacteria, not fungi like the mycorrhizae. (And you know how I’m fascinated by the power of fungi .)

Much of the commerce in mycorrhizae to date has been geared to agriculture and the nursery industry.  Grapes, for instance, are very dependent on mycorrhizae (as are roses, for another example), so vineyards are one industry that extolls their virtues. Spurred by Texas A&M findings, wholesale nurseries, including giants like Monrovia , have begun inoculating their potting soils, seeking potential benefits such as reduced transplant issues and faster establishment.

Such industries hadn’t initially come to mycorrhizae seeking a ”save the earth” solution, says Graham (read more about the Wharton law-and-business graduate in this “Philadelphia Inquirer” story ), but rather a better economic equation in crop production. For instance, they may harvest at a younger age (as with the grapes), or reduce fertilizer costs, or otherwise improve the bottom line.

Now other potential customers—including more gardeners—are coming asking about natural solutions to growing success.

Like me with my curiosity about fine-tuning my soil-feeding mantra. And so when the raised beds here can be worked in a couple of weeks, I’ll continue my experiment with mycorrhizae, by using the rest of my supply.

I’d love to hear if you’ve begun your own experiments with these fascinating microbes and what your experience has been.

mycorrhizae 101, the basics

I ASKED GRAHAM PHILLIPS a few key practical questions about using mycorrhizae, in this short Q&A:

Q. When do I apply mycorrhizae?  Do I re-apply every year?

A. Mycorrhizal products are often used by gardeners when sowing seeds, when transplanting, or to inoculate a bed before planting, working them into the top 4-6 inches. Inoculated soils will actually improve year after year, so it’s a sustainable product.

Q. Do I till in coming seasons?

A. We recommend no- or low-till practices, so the network of filaments, or hyphae, can develop and flourish year to year. Keep using your compost.

Q. Do I use fertilizer as well?

A. Many synthetic plant foods, especially fast-acting liquids, harm microbial activity in the soil and create fertilizer-dependent plants, so we don’t recommend using them. We say that the fungi are not an “add-on-” to a chemical-fertilizer routine, but best used “instead of.” We recommend ongoing use of compost, compost tea, cover crops, and if needed, small amounts of dry organic fertilizers that release slowly.

Q. Does mycorrhizae work on all plants?

A. There are a few plants that are said to be non-mycorrhizal, meaning they don’t form the mutualistic relationship with the microbes. These include blueberries and other ericaceous plants such as azaleas; brassicas (cabbage, broccoli, mustard, etc.); spinach and beets.

Q. Where do I store leftover product, or can I?

A. You can store it for two years, preferably in a cool, dry place, but it will last longer.  After two years the spores begin to degrade as time passes, but many will remain viable–you would just have to use a little more each subsequent year.

(Top illustration courtesy of Bio-Organics.)

i’m doing a lot of planting this spring and am eager to give this a trial. my concern is that i need to spray one of my beds with copper (some late blight last year), which would seem to destroy the fungi to begin with. any ideas?

I’ve asked Graham from Bio-Organics for some advice on this, Devra. Stay tuned.

I asked Graham and the founder of the company as well, and here’s what they say, Devra:

“We would recommend not spraying the bed but to rely on the natural protection of the mycorrhizal fungi instead. The mycorrhizal fungi will protect her plant roots from harmful fungi (one of the many benefits of introducing “friendly” fungi) and that there should never again be a need to try to kill off soil organisms. It is also very difficult to completely kill all harmful organisms. If she must do it, she would then inoculate afterwards but she could also destroy other helpful organisms in the process of spraying.”

So glad to find this conversation. There have been some articles about caring for the soil food web that have me wishing to know more about the soil microbes and their beneficial functions. The next step would seem to be to get my hands on Lowenthal’s book(s). I will be watching for any followup comments.

Glad you found us, Lillian. So many mysteries to delve into, even in a single shovelful of soil!

Beth asked in an earlier post about striking a balance in till/no till soil care. Digging or tilling in the fall appears to do the most damage to the microbes and critters that have taken up residence in your soil during the growing season. The current thinking seems to be that shallow cultivation of your garden soil in preparation for spring planting is the most beneficial for the soil and the gardener alike.

If your soil tends to become compacted, using a spading fork or broad fork to punch holes deeply into the soil works well to help get beneficial materials, air , and water to deeper levels This in turn encourages deeper rooting of your plants.

We have a lot of clay in our garden soil, so when I prepare the beds I use a broad fork to punch holes , then rock back just a few inches before removing the tines from the soil. I do this at 6 to 8 inch intervals throughout the beds. Do not lift and turn the soil. As you add amendments some falls to the bottom of the holes, and as the season wears on, water and your microherd carries more goodies downward improving porosity and structure in the proess.

This is just the advice I was after. I have a very reactive black clay soil and am looking for a way to improve the soil, without the “till” damage. What might you suggest for 5 acres of soil needing improving.? Thanks again. Paul

Get you some mycor plus from agusa or listen to Elaine Ingham microbiologist on utube u will get awesome soil results

I have an abundance of the fungi in my garden. I know this because I was concerned when I thought I had veins of mold where I grew my veggies. I took a sample of it in to WSU extension office (Washington State University) and they said it was good fungi. I have a TON of it, and I noticed lots in my compost pile that sat during the winter. My question is….Can there be too much mycorrhizae in the soil? Can this be harmful to breath in while working in the soil?

Hi, Marje. I don’t know (and think it was smart to ask WSU — good for you), but here’s my non-scientist approach to answering:

When I see too much of anything like that happening in the heap — a spot that’s too dry, too wet/slippery, anything that’s getting smelly, or fungi as you describe, I think it’s time to turn things and mix up the blend of ingredients. I believe that fungi are specific to particular materials (they develop on and break down one thing or another — not necessarily everything), so I have mostly had this happen when I got a load of wood chips, for instance, that were all one material…or a load of mulch that was too damp or I applied to thickly (or in a wet season). So I’d turn things to get air in there, add more “green” materials, and not worry.

Thank you for the good info. I intend to try the m. fungi on my Dahlias this year to get better show blooms. Wondering why some plants are more mutualistic than others?

I never heard an update on your experience? Are you still using Mycorrhizae? BTW, I loved you show today on weed ridding!

Thanks Scott re: the show. I’m not sure if there was any perceptible difference — but hmmm, hard to tell I bet, right? I guess I would have to do before/after soil analysis.

Do you ever make it up to the Common Ground Fair? Two years ago I attended a talk about a no till method that is used in Korea. It was fascinating. The mycellium was captured in a box of white rice that was in the wooded part of the property. When one found the Mycellium it would then be used to inoculate a bed that had been solarized. A top layer of mulch would then be used to keep weeds down and feed that mycellium. The farmer giving the talk had stopped using tractors- which is startling when one is talking about acres of crops. He has a higher yiels and it costs less to produce. I bought the book Mycelium Running because I was told it describes how to do this & it will be how I tackle my acre plus plantings this year.

I have the book, too — so interesting! Thanks for saying hello. Some year I must go to the fair in Maine.

where can i buy Bio-Organic products here in Massachusetts ?

Hi, Robert. I believe they sell it mail order via their website , or you can use the contact link there to ask them.

Can you apply mycorrhizae to the lawn with a hose end sprayer?

Hi, Marty. Yes, many versions can be applied that way. Normally each product gives instructions for dilution depending on application method, including that one.

We live on the edge of a river, where we have an long-established “swamp maple”. The tree is doing poorly. It seems to have responded positively to the rotted manure we spread beneath it mid-summer, but we are wondering if mycorrhizae can be part of the help this beautiful tree needs, and how/when to best get the fungi where it can help the tree. Thanks, C&M

What are your thoughts on native vs nonnative mycorrhizae? Could the commercialization of mycorrhizae be introducing invasive fungi into our soils with unintended consequences? This sort of thing has happened before in the nursery world.

I don’t know, Tyler. I did that interview above 10 years ago, and haven’t since that first exploration used any products. Thanks for reminding me of a topic worth investigating.

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Post Comment

This site uses Akismet to reduce spam. Learn how your comment data is processed .

Related Posts

Shopping for flower bulbs, with ken druse, secrets to holiday-cactus success, with matt mattus, coping with extreme weather, with cornell’s daniel weitoish, from the weekly podcast, rethinking the lawn, with dan wilder.

THE LECTURE that he’s been giving for a number of years is not-so-subtly called “Kill Your Lawn.” Ecological horticulturist Dan Jaffe Wilder knows that starting over and creating an entire native habitat instead of a lawn isn’t for everyone. But Dan just wants to grab our attention and get us to start to make some changes at least in the way we care for the turfgrass we do want in our landscapes. And maybe give up a little square footage of it to some other kind of more diverse planting, too, like the wild strawberries ( Fragaria virginiana , inset). Alternative, more eco-focused styles of lawn care, along with some lawn alternatives is what he and I talked about on the podcast. Dan is Director of Applied Ecology at Norcross Wildlife Foundation in Wales, Massachusetts, and its 8,000-acre sanctuary. He’s also co-author with Mark Richardson of the book “Native Plants for New England Gardens.”

(Stream it below,  read the illustrated transcript or subscribe free .)

Begin typing your search above and press return to search. Press Esc to cancel.

• Click here for info on the favorites above .

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• v.10(5); 2020 May

Mycorrhiza: a natural resource assists plant growth under varied soil conditions

Chew jia huey.

1 School of Bioprocess Engineering, Universiti Malaysia Perlis, 02600 Arau, Perlis Malaysia

Subash C. B. Gopinath

2 Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000 Kangar, Perlis Malaysia

M. N. A. Uda

Hanna ilyani zulhaimi, mahmad nor jaafar, farizul hafiz kasim.

3 Centre of Excellence for Biomass Utilization, School of Bioprocess Engineering, Universiti Malaysia Perlis, 02600 Arau, Perlis Malaysia

Ahmad Radi Wan Yaakub

In this overview, the authors have discussed the potential advantages of the association between mycorrhizae and plants, their mutual accelerated growth under favorable conditions and their role in nutrient supply. In addition, methods for isolating mycorrhizae are described and spore morphologies and their adaptation to various conditions are outlined. Further, the significant participation of controlled greenhouses and other supported physiological environments in propagating mycorrhizae is detailed. The reviewed information supports the lack of host- and niche-specificity by arbuscular mycorrhizae, indicating that these fungi are suitable for use in a wide range of ecological conditions and with propagules for direct reintroduction. Regarding their prospective uses, the extensive growth of endomycorrhizal fungi suggests it is suited for poor-quality and low-fertility soils.

Introduction

Recently, the looming food security problem has highlighted plant science as an emerging discipline and led to a commitment to devising new strategies to enhance crop productivity. Biotic and abiotic stresses, such as drought, salinity, flooding, plant pathogens, nutrient deficiency and toxicity, which limit global crop productivity, are reasons for food scarcity. Given the potential for food shortages, strategies should be adopted to achieve maximum productivity and economic crop returns (Ahmad et al. 2012 ). The application of fertilizer is one of the methods used to obtain optimum yields, although this may cause environmental issues. If chemical fertilizers are applied continuously, they may lead to the deterioration of soil characteristics and fertility, and heavy metals can accumulate in plant tissues; eventually, the nutrition value and edibility of fruits will be affected (Mosa et al. 2014 ). Instead of using chemical fertilizers, biological fertilizers, such as animal manure, the decaying remains of organic matter, domestic sewage, excess crops and microorganisms (e.g., bacteria and fungi), can be used as a more sustainable alternative. Furthermore, plant growth can be improved through microbial inoculation, including inoculation with plant growth promoting rhizobacteria (PGPR) and mycorrhizal fungi. These microbes play significant roles in the promotion of plant growth through the regulation of nutrition and hormonal balances, production of plant growth regulators, solubilization of nutrients and induction of resistance against plant pathogens. In addition, plant interactions with these microbes have shown synergistic as well as antagonistic interactions with other microbes in the rhizosphere. These interactions are important for sustainable agriculture because they maintain plant growth and development through biological processes rather than through agrochemicals.

Moreover, mycorrhizae can be found in all the soils where plants can grow, and these fungi facilitate the absorption of water and nutrients by plants. Plants send sugars from their leaves to fungi as food. Further, root surface area can be increased by mycorrhizae, allowing plants to uptake water and nutrients more efficiently from a large soil volume (Nadeem et al. 2014 ). In addition, it has been shown that different mycorrhizal species exhibit a variety of responses depending on the plant species with which they are associated (Ortas and Ustuner 2014 ). This is because there is a wide range of mycorrhizal fungal species that could change the strength of plant-plant interactions, and plant growth will vary. It is widely accepted that there are higher growth rates in plants inoculated with mycorrhizae than in control plants because of the increase in photosynthetic activities. Mycorrhizae also play an important role in the supply of essential nutrients to their associated plant; interestingly, fungicides or herbicides will not affect the growth of mycorrhizae.

Glomeromycota, referred to as arbuscular mycorrhizal fungi, are one of the most significant fungi because they form mutualistic relationships with the roots of almost 90% of plant species (Stajich et al. 2009 ). Arbuscular mycorrhizae can be seen in the belowground parts of the earliest plant fossils and facilitate nutrient acquisition by plants in exchange for photosynthate. They are also vital to plant fitness and may determine the compositions of plant communities. Arbuscular mycorrhizae are hyphal and produce highly branched haustoria, which promotes nutrient exchange with their host root cells.

Mycorrhizal fungi

According to the definition by Brundrett in 2002 , mutualistic relationships are formed between the modified absorptive organs of mycorrhizae, which mainly consist of plant roots (photobiont) and fungal hyphae (mycobiont). The main purpose of this relationship is to transfer nutrients between the organisms (Brundrett 2002 ). Mycorrhizal symbiosis plays an important role in ecosystems because mycorrhizae affect plant productivity and plant diversity. Usually, plant productivity is improved by mycorrhizal interactions, but this is not always the case; under different environmental conditions, symbiosis can span various species interactions, from mutualism to parasitism (Maherali 2014 ). Mycorrhizal fungi can even have parasitic interactions with plants when the net benefits of the symbiosis are lower than the net cost. Mycorrhizal associations are complex; thus, an understanding of the several parameters affecting the function of mycorrhizae, such as the morphology and physiology of both symbionts and biotic and abiotic factors at the rhizosphere, community and ecosystem levels, is required. In the commercial production of infected plants, several species of fungi are used, and seedling inoculation with either spores or mycelial cultures is usually the starting point (Grimm et al. 2005 ).

Information on fungi

Fungi are macroscopic and microscopic organisms, such as mushrooms, truffles, puffballs, and glomeromycetes (soil fungi that connect to roots); they are totally separate from the cell walls of plants and are capable of secreting a range of enzymes (Anbu et al. 2004 , 2005 , 2007 ; Gopinath et al. 2002 , 2003 , 2005 ; Kumarevel et al. 2005 ; Lee et al. 2015 ; Zaragoza 2017 ). Fungi can reproduce by both sexual and asexual reproduction and typically produce spores. Fungi are categorized into taxonomic ranks based mainly on morphologies that are described by their structure and phylogeny. They are further categorized by their genetic differences. However, the procedures to classify fungi according to genetic differences are complicated (Ellison et al. 2014 ; Grimm et al. 2005 ).

To understand fungi and simplify their identification, methods have been developed to isolate fungi, such as the pour plate and dilution-based spread plate techniques and spore isolation (Magnet et al. 2013 ). All isolated fungi must be obtained in pure cultures by using a standard technique (Rohilla and Salar 2011 ). Additionally, caution must be taken when performing isolation to avoid cross-contamination, which would significantly affect the final isolation results. Among mycorrhizal fungi, various types of spores have been found to occur (Fig.  1 ).

Various shapes and textures of mycorrhizal spores. Different types, which are widely distributed across a range of plants, are displayed

Wet sieving and decanting method

Wet sieving and decanting methods are simple spore isolation techniques introduced by Gerdemann and Nicolson to extract fungal spores from soil samples (Gerdemann and Nicolson 1963 ) (Fig.  2 ). This technique was used for sieving the coarse particles of the soil and retaining the fungal spores and organic particles on sieves of different sizes. Then, the spores are removed and collected for observation under a microscope. There are different types of spore isolation methods, such as the sucrose centrifugation method, adhesion flotation method, and capillary rise method. However, in the study of Shamini and Amutha, wet sieving and decanting methods were shown to obtain a large number of spores (Shamini and Amutha 2015 ).

Representation of wet sieving and decanting methods. The steps involved are shown. Both methods have been used in the past and have advantages for the separation of mycorrhizal spores. Wet sieving captures smaller spores

Analysis of fungal morphology

The analysis of fungal morphology is mainly based on fungal structures and sizes. Most fungi are composed of structures called mycelia (thread-like hyphae) and grow from the tips of fungi, similar to the binary branching of trees. Fungi can be differentiated because of their lack of a hyphal septum. Spores are the main characteristic used to identify the types of fungi. Particular representative fungi must be isolated, and then their morphologies must be observed (Tsuneo watanabe 2002 ). Generally, fungi are observed by using microscopes, such as stereomicroscopes, compound microscopes and scanning electron microscopes. Moreover, advances in image and particle analysis and micromechanical devices have improved morphological data (Krull et al. 2013 ), which means that the structures of microorganisms can be seen more clearly and in greater detail. In addition, the identification of fungi depends not only on morphology but also on fungal cultures, which can be obtained from single spore isolations (Choi et al. 1999 ).

Spore morphology

According to Levetin, the following characteristics can be used to identify fungi: the spore size and shape, the number of cells in the spore, the spore wall thickness, the spore color and surface ornamentation, and the attachment of scars. Compared with the sizes and shapes of spores, the spore wall characteristics are very useful for the identification of fungi. Additionally, spore walls can be smooth or consist of various ornamentations, which usually occur on the outermost surface and appear spore-like spiny, punctate, warted, striated, ridged, or reticulate (Fig.  1 ). Therefore, ornamentation can also be used for identification.

Types of mycorrhizae

Mycorrhizae are divided into two types based on the structure of their hyphae. The fungal hyphae that do not penetrate the individual cells within the roots are known as ectomycorrhizal fungi, while the hyphae of fungi that penetrate the cell wall and invaginate the cell membrane are called endomycorrhizal fungi (Szabo et al. 2014 ). In addition, according to Heijden and Martin, four main types of mycorrhizal fungi have been classified: arbuscular mycorrhizae, ectomycorrhizae, orchid mycorrhizae and ericoid mycorrhizae (van der Heijden et al. 2015 ). Furthermore, endomycorrhizae include the arbuscular, ericoid, and orchid mycorrhizae, while arbutoid mycorrhizae can be classified as ectomycorrhizae and monotropoid mycorrhizae form a special category.

Arbuscular mycorrhizae

Vesicular–arbuscular mycorrhizal fungi (VAM) and soil fungi are alternative terms for arbuscular mycorrhizal fungi (Vogelsang et al. 2004 ). These fungi belong to the Glomeromycota and are believed to have an asexual reproductive strategy. Plants depend heavily on these fungi to reach their optimal growth potential. Arbuscular mycorrhizal symbiosis is the most common non-pathogenic symbiosis in the soil and is found in 80% of vascular plant roots (Brundrett 2002 ). Additionally, arbuscular mycorrhizae only grow in association with appropriate host plants and plant species and vary by host. Arbuscules are fungal structures growing into individual plant cells (Fig.  3 ). Arbuscular mycorrhizal (AM) fungi can be found within almost all phyla in the Angiosperms (Duhoux et al. 2001 ). According to Miranda and Jennifer, AM fungi not only improve phosphorus nutrition to plants but also enhance the uptake of zinc, copper, nitrogen and iron (Hart and Forsythe 2012 ). They are also resistant to some root diseases and drought tolerant.

Growth pattern of arbuscular mycorrhizae. The formation of vesicles is shown. Arbuscular mycorrhizae are widely reported and commonly used. This is mainly due to their attraction to phosphorous sources. The arbuscules form a vesicle

Ectomycorrhizae (EM)

Ectomycorrhizae are a large group (Szabo et al. 2014 ) with a widespread distribution but only 3–4% of the vascular plant families are associated with these fungi (Brundrett 2004 ). Chiefly, EM are members of the phyla Ascomycota and Basidiomycota, and EM mutualism is thought to be independently derived multiple times from saprophytic lineages (Merckx 2012 ). Plant species that form EM mutualisms have been shown to have antimicrobial components that protect the plants from root pathogens. These fungi are characterized by their growth on the exterior surfaces of roots (Schnepf et al. 2008 ). Thus, roots are covered by fungal tissue, and the covering is known as a hyphal mantle (Fig.  4 ). Strands of mycelium, the fungal filaments, extend from the hyphal mantle into the soil and act as the roots of the plant, absorbing minerals and nutrients.

The growth pattern of endomycorrhizae. The structure of endomycorrhizae is different from that of ectomycorrhizae

Formation of mycorrhizae

Arbuscular mycorrhizal fungi go through several developmental stages in the formation of mycorrhizae (Fig.  5 ). During the symbiotic stage, spores are germinated and limited hyphal development by arbuscular mycorrhizal fungi has been found due to the absence of host plants. However, after germination, the spores enter the presymbiotic stage, which is characterized by extensive hyphal branching when root exudates are present (Kuo et al. 2014 ) . In addition, appressoria are formed once the fungus contacts a root surface and before the hyphae penetrate the root epidermis. This is followed by the symbiotic colonization of the root cortex tissue, which involves the formation of intracellular arbuscules (tree-like, heavily branched structures) or hyphal coils, and concomitantly, the production of a unique extraradical mycelium occurs. Host plants play a primary role in orchestrating the arbuscular mycorrhizal infection process, and it is tempting to speculate that similar changes occur during the colonization of the cortical cells. Overall, these developmental processes require molecular communication between the arbuscular mycorrhizae and the plant, including the exchange and perception of signals by the symbiotic partners.

Developmental stages of arbuscular mycorrhizae. The different stages are indicated. Generally, six stages are involved in the formation of a complete association

Mycorrhizal plant interactions

There are two nutrient uptake pathways for roots colonized by mycorrhizae: the plant uptake pathway (PP) and the mycorrhizal uptake pathway (MP) (Fig.  6 ). The PP involves the uptake of nutrients directly through the transporter and occurs in the root epidermis and root hairs. In the MP, nutrients are indirectly transferred via fungal transporters in the extraradical mycelium (ERM) of the fungus and transported to the hartig net in EM interactions or to the intraradical mycelium (IRM) in arbuscular mycorrhizal interactions (shown in the mycorrhizal interface). The uptake by mycorrhiza-inducible plant transporters occurs in the periarbuscular membrane from the interfacial apoplast. The displayed fungal structures indicate the colonization of one host root by multiple fungal species, which can differ in their efficiency. Through these processes, the fungi are able to obtain nutrients from the soil and transfer these nutrients to their hosts (Bucking et al. 2012 ).

Nutrient uptake pathways. The involvement of the plant uptake pathway and mycorrhizal uptake pathway is shown. The major nutrients are indicated, and the directions of the movements are displayed

The rapid uptake of nutrients, for example, ‘P’, by roots leads to the formation of a depletion zone, and fungal hyphae extend beyond the depletion zones to penetrate and exploit a larger volume of soil to uptake nutrients. From the uptake by the hyphae, nutrients are translocated within the hyphal network to the fungal sheath, intercellularly to the hartig net and with the exception of ectomycorrhizae and monotropoid mycorrhizae, intracellularly into plant cells. The fungal sheath is able to store nutrients, supporting the fungi by continuing to provide nutrients to the plant host when the soil nutrient levels decrease. When receiving extra nutrients, mycorrhizal plants lose between 10 and 20% of the photosynthates they produce; these photosynthates are used by the mycorrhizal fungi and their associated structures for development, maintenance and operation.

Nutrients are moved by the fungal ERM via P i , NO 3 − or NH 4 + transporters (blue); ‘N’ is assimilated into Arg through the anabolic arm of the urea cycle (this is shown only for arbuscular mycorrhizae); and P i is converted into polyP in the ERM. The polyP is then transported from the ERM to the IRM. The polyP is hydrolyzed and Arg and P i are released in the IRM. Arg breaks down to NH 4 + in the catabolic arm of the urea cycle (this is shown only for arbuscular mycorrhizae). This process is facilitated by P i , NH 4 + , and potential amino acid (AA, possibly only in the EM) efflux through the fungal plasma membrane (red) into the interfacial apoplast. The nutrients are taken up by the plant from the mycorrhizal interface through mycorrhiza-inducible P i or NH 4 + transporters. Photosynthesis is stimulated by the improved nutrient supply and is facilitated by the efflux of sucrose through the plant plasma membrane into the interfacial apoplast, sucrose hydrolysis in the interfacial apoplast via an apoplastic plant invertase, and the uptake of hexoses by the mycorrhizal fungi through the fungal monosaccharide transporters.

Phosphate uptake

Mycorrhizal symbioses are recognized for their importance in plant nutrition and ionic transport, particularly in phosphorus uptake (Fig.  7 ). To maintain crop yields, modern agricultural systems are highly dependent on the continual inputs of phosphate-based fertilizers. These fertilizers are processed from phosphate rock, which is a non-renewable natural resource. Therefore, the world could soon face a resource scarcity crisis that might affect global food security. Arbuscular mycorrhizae form a symbiosis with the roots of nearly all vascular plants and could play a key role in solving the phosphate shortage problem. Additionally, by improving the efficiency of nutrient uptake and by increasing plant resistance to pathogens and abiotic stresses, mycorrhizal symbiosis can enhance plant growth and therefore reduce the need for phosphate-based fertilizers. Herein, we provide an update of recent findings and reports on mycorrhizae as the cornerstone of a "second green revolution" and the types of mycorrhizae that enhance plant growth. Different types of mycorrhizae may be obtained from different plant growth materials.

Transport mechanisms in arbuscular and ectomycorrhizal interactions. The transports in the plants and soils are shown. The molecules and ions generally involved in transport are displayed

Plant growth under physiological conditions

Numerous parameters can be used to measure plant growth. The most common and simple measurements are the number of leaves, plant height, and plant color. These parameters may be seen by the naked eye or using tools for daily measurement. Most farmers evaluate the changes in these parameters to assess the growth of their plants because they are easy to observe. In addition, some complicated parameters, such as leaf dry matter content, stem specific density, and the pH of green leaves, can be used to evaluate plant growth (Pérez-Harguindeguy et al. 2013 ). The use of these parameters requires specific formulas and calculations.

Plant growth under greenhouse conditions

Plants are protected from adverse conditions and growers are able to control growth conditions when plants are grown in greenhouses (Fig.  8 a). A high yield, good quality, uniformity, and precise timing of delivery can be achieved with good control. A variety of crops are grown in greenhouses, the products of which include leaves, roots, bulbs, tubers, flowers, fruits, seeds, young plants, and mature plants (herbs, salad plants, bedding plants, potted plants, and garden plants). Technology is required to control the growing conditions in greenhouses, primarily for heating and venting and optionally for root-zone heating, cooling, fogging, misting, CO 2 enrichment, shading, assimilation light, day-length extension and black-out timing. Light, temperature, and humidity are three growth factors that have been identified (Nederhoff 2007 ). These factors influence plant growth and can be controlled in greenhouses.

a Mycorrhizal-associated plants grown in a greenhouse. (i) groundnut; (ii) onion; and (iii) chickpea. b Classifying symbiotic interactions. The classes include mutualism, parasitism, and commensalism. The mutualistic plant-fungus interaction is the midpoint of the continuum of interactions and the exploitation of a plant by a mycorrhizal fungus is the endpoint

Study lines with greenhouses

Greenhouse technology is used for sustainable crop production in regions with adverse climatic conditions. High summer temperatures are a major issue for successful greenhouse crop production throughout the year (Kumar et al. 2009 ). Greenhouse technology refers to the production of plants for economic use in a covered structure, which allows the rapid harvesting of solar radiation and the modification of agroclimatic conditions conducive to plant growth and development. This technology embraces infrastructure modeling, selection of plants for adaptation, production economics, agronomic management and commercial potential. Therefore, greenhouse crop productivity is largely independent of outdoor environmental conditions (Reddy 2016 ).

Enhanced mycorrhizal associations under controlled greenhouse conditions

The definition of symbiosis (two or more organisms living together) can be applied to all mycorrhizal associations (Brundrett 2004 ; Crops 2015 ). The term mutualism indicates mutual benefits in associations involving two or more living organisms. In a review by Brundrett, the terms ‘balanced’ and ‘exploitative’ are proposed for mutualistic and non-mutualistic mycorrhizal associations, respectively (Brundrett 2004 ). Most mycorrhizal associations, except mycoheterotrophic associations, are ‘balanced’ mutualistic associations, in which the fungus and plant benefit from the association. Mycoheterotrophic plants have an ‘exploitative’ mycorrhizal association that benefits only the plants. Thus, exploitative associations are symbiotic but are not mutualistic. In the research of Bronstein, it was proposed that rather than classifying symbiotic interactions into distinct categories (e.g., mutualism, parasitism, and commensalism), they should be viewed as dynamic points along a continuum (Merckx 2012 ). The mutualistic plant–fungus interaction is the midpoint, and the exploitation of a plant by a mycorrhizal fungus is the endpoint (Fig.  8 b). In mycoheterotrophic interactions, the mycorrhizal fungi are exploited by the plants to obtain carbon and other nutrients (Merckx 2012 ).

Creating a beneficial environment for endomycorrhizal (VAM) colonies requires a plant to have a symbiotic relationship with a VAM. First, the amount of inorganic phosphorus should be low in the soil solution; mycorrhizae will not grow or colonize roots when the phosphorus level is high. This is because the relationship between plants and fungi evolved to help the plants access low levels of phosphorus in the soil. Mycorrhizae cannot grow or establish when phosphorus levels are above 10 ppm in the soil. The mycorrhizae are not killed; they create an environment in which they do not germinate or grow and are rendered ineffective. When plant roots release sugars and hormones and form an association with mycorrhizal spores, the spores start to germinate. This trigger allows the spores to stay dormant, suspended in the soil, until plants actively grow. Thus, the shelf life of mycorrhizae is typically longer (up to two years) than that of other biological additives. As far as it is known, the typical lime addition rates and moderate pH levels of professional growing medium products do not have a significant positive or negative effect on the growth and colonization of mycorrhizae. Mycorrhizae can be used with other bioproducts. There are other helper bacteria or fungi that are often added to mycorrhizal blends, which stimulate and support the growth of the mycorrhizal colonies. In addition, at the beginning of production, chemical fungicides should be avoided until time has passed to allow root colonization (Miller 2012 ). Although there is a long history of mycorrhizal research, it is still continuing due to the potential of mycorrhizae to benefit humans and society and boost economies (Bauer et al. 2020 ; Quiroga et al. 2020 ; Wulantuya et al. 2020 ).

Prospective uses

In the agricultural field, there are several variables when growing plants outdoors, including weather, watering, fertilization and soil quality. These variables can introduce the potential for greater plant stress and therefore highly benefit from endomycorrhizal fungi. Endomycorrhizae can be incorporated directly into the soil, but if plants are grown in a growth medium, their roots will continue to be colonized even after transplanting into the soil. The benefits are the same as those potentially seen by the grower and include resistance to transplant shock and increased numbers of fruits and flowers. Unlike roots, endomycorrhizal fungi establish quickly in new soil environments. Therefore, they can ease transplant shock by providing water and nutrients for the plant and serve as a buffer to help the plant adjust to its new soil environment. Plants reach their optimum growth rate with endomycorrhizae as a result of reduced stress; therefore, edible plants have the ability and resources to produce more vegetables/fruits and larger vegetables/fruits per plant and flowering plants often produce more flowers. Plants such as beech, willow, birch, pine, fir, oak, and spruce receive many benefits from mycorrhizal associations, and the association of legume and cereal plants with mycorrhizae increases the benefits of these plants to humans. Overall, plants are often larger when grown with endomycorrhizal fungi, especially if plants are grown in poor-quality and low-fertility soils.

Acknowledgements

The author would like to acknowledge the support from Malaysia Fundamental Research Grant Scheme (FRGS) to H.I.Z. (Grant number 9003-00750) and Short Term Grant by Universiti Malaysia Perlis to S.C.B.G. (Grant number 9001-00558).

Author contributions

All the authors contributed to the preparation of the manuscript and discussion. Both authors read and approved the final manuscript.

Compliance with ethical standards

On behalf of all the authors, the corresponding author states that there is no conflict of interest.

• Ahmad P, Kumar A, Gupta A, Hu X, Hakeem R, Azooz MM, Sharma S. Crop production for agricultural improvement. Crop Prod Agric Improv. 2012 doi: 10.1007/978-94-007-4116-4. [ CrossRef ] [ Google Scholar ]
• Anbu P, Hilda A, Gopinath SCB. Keratinophilic fungi of poultry farm and feather dumping soil in Tamil Nadu, India. Mycopathologia. 2004; 158 :303–309. doi: 10.1007/s11046-004-3465-1. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Anbu P, Gopinath SCB, Hilda A, Lakshmi T, Annadurai G. Purification of keratinase from poultry farm isolate- Scopulariopsis brevicaulis and statistical optimization of enzyme activity. Enzyme Microb Tech. 2005; 36 :639–647. doi: 10.1016/j.enzmictec.2004.07.019. [ CrossRef ] [ Google Scholar ]
• Anbu P, Gopinath SCB, Hilda A, Lakshmipriya T, Annadurai G. Optimization of extracellular keratinase production by poultry farm isolate Scopulariopsis brevicaulis . Bioresour Technol. 2007; 98 :1298–1303. doi: 10.1016/j.biortech.2006.05.047. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Bauer JT, Koziol L, Bever JD. Local adaptation of mycorrhizae communities changes plant community composition and increases aboveground productivity. Oecologia. 2020 doi: 10.1007/s00442-020-04598-9. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Brundrett MC. Coevolution of roots and mycorrhizas of land plants. New Phytol. 2002; 154 :275–304. doi: 10.1046/j.1469-8137.2002.00397.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Brundrett M. Diversity and classification of mycorrhizal associations. Biol Rev Camb Philos Soc. 2004; 79 :473–495. doi: 10.1017/S1464793103006316. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Bucking H, Liepold E, Ambilwade P (2012) The role of the mycorrhizal symbiosis in nutrient uptake of plants and the regulatory mechanisms underlying these transport processes. World †TM s largest Science, Technology and Medicine Open Access book publisher. Intech Open
• Choi Y, Hyde KD, Ho WWH. Single spore isolation of fungi. Fungal Divers. 1999; 3 :29–38. [ Google Scholar ]
• Crops V. Effect of four mycorrhizal products on Fusarium root rot on different vegetable crops. Plant Pathol Microbiol. 2015; 6 :2–6. doi: 10.4172/2157-7471.1000255. [ CrossRef ] [ Google Scholar ]
• Duhoux E, Rinaudo G, Diem HG, Auguy F, Fernandez D, Bogusz D, Franche C, Dommergues Y, Huguenin B. Angiosperm Gymnostoma trees produce root nodules colonized by arbuscular mycorrhizal fungi related to Glomus. New Phytologist. 2001; 149 :115–125. doi: 10.1046/j.1469-8137.2001.00005.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Ellison CE, Kowbel D, Glass NL, Taylor JW, Brem RB. Discovering functions of unannotated genes from a transcriptome survey of wild fungal isolates. MBio. 2014; 5 :e01046–e1113. doi: 10.1128/mBio.01046-13. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Gerdemann JW, Nicolson TH. Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting. Trans Br Mycol Soc. 1963; 46 :235–244. doi: 10.1016/S0007-1536(63)80079-0. [ CrossRef ] [ Google Scholar ]
• Gopinath SCB, Hilda A, Priya TL, Annadurai G. Purification of lipase from Cunninghamella verticillata and optimization of enzyme activity using response surface methodology. World J Microbiol Biotechnol. 2002; 18 :449–458. doi: 10.1023/A:1015579121800. [ CrossRef ] [ Google Scholar ]
• Gopinath SCB, Hilda A, Lakshmi Priya T, Annadurai G, Anbu P. Purification of lipase from Geotrichum candidum : conditions optimized for enzyme production using Box-Behnken design. World J Microbiol Biotechnol. 2003; 19 :681–689. doi: 10.1023/A:1025119222925. [ CrossRef ] [ Google Scholar ]
• Gopinath SCB, Anbu P, Hilda A. Extracellular enzymatic activity profiles in fungi isolated from oil-rich environments. Mycoscience. 2005; 46 :119–126. doi: 10.1007/s10267-004-0221-9. [ CrossRef ] [ Google Scholar ]
• Grimm LH, Kelly S, Krull R, Hempel DC. Morphology and productivity of filamentous fungi. Appl Microbiol Biotechnol. 2005; 69 :375–384. doi: 10.1007/s00253-005-0213-5. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Hart MM, Forsythe JA. Scientia Horticulturae Using arbuscular mycorrhizal fungi to improve the nutrient quality of crops; nutritional benefits in addition to phosphorus. Sci Hortic (Amsterdam) 2012; 148 :206–214. doi: 10.1016/j.scienta.2012.09.018. [ CrossRef ] [ Google Scholar ]
• Krull R, Wucherpfennig T, Esfandabadi ME, Walisko R, Melzer G, Hempel DC, Kampen I, Kwade A, Wittmann C. Characterization and control of fungal morphology for improved production performance in biotechnology. J Biotechnol. 2013; 163 :112–123. doi: 10.1016/j.jbiotec.2012.06.024. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Kumarevel TS, Gopinath SCB, Hilda A, Gautham N, Ponnusamy MN. Purification of lipase from Cunninghamella verticillata by stepwise precipitation and optimized conditions for crystallization. World J Microbiol Biotechnol. 2005; 21 :23–26. doi: 10.1007/s11274-004-1005-2. [ CrossRef ] [ Google Scholar ]
• Kumar KS, Tiwari KN, Jha MK. Design and technology for greenhouse cooling in tropical and subtropical regions: a review. Energy Build. 2009; 41 :1269–1275. doi: 10.1016/j.enbuild.2009.08.003. [ CrossRef ] [ Google Scholar ]
• Kuo A, Kohler A, Martin FM, Grigoriev IV. Expanding genomics of mycorrhizal symbiosis. Front Microbiol. 2014; 5 :1–7. doi: 10.3389/fmicb.2014.00582. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Lee LP, Karbul HM, Citartan M, Gopinath SCB, Lakshmipriya T, Tang TH. Lipase-secreting Bacillus species in an oil-contaminated habitat : promising strains to alleviate oil pollution. BioMed Res Int. 2015; 2015 :820575. [ PMC free article ] [ PubMed ] [ Google Scholar ]
• Magnet MH, Sarkar D, Ahmed Z. Samples Of different industry side in Dhaka city, Bangladesh. Int J Innov Res Dev. 2013; 2 :338–339. [ Google Scholar ]
• Maherali H. Is there an association between root architecture and mycorrhizal growth response? New Phytol. 2014; 204 :192–200. doi: 10.1111/nph.12927. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Merckx VSFT. Mycoheterotrophy: the biology of plants living on fungi. Mycoheterotrophy Biol Plants Living Fungi. 2012 doi: 10.1007/978-1-4614-5209-6. [ CrossRef ] [ Google Scholar ]
• Miller BM (2012) Using mycorrhizae in a professional mix.
• Mosa W, Paszt L, EL-Megeed N. The role of bio-fertilization in improving fruits productivity-a review. Adv Microbiol. 2014; 4 :1057–1064. doi: 10.4236/aim.2015.51003. [ CrossRef ] [ Google Scholar ]
• Nadeem SM, Ahmad M, Zahir ZA, Javaid A, Ashraf M. The role of mycorrhizae and plant growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnol Adv. 2014; 32 :429–448. doi: 10.1016/j.biotechadv.2013.12.005. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Nederhoff EM (2007) Using a greenhouse for controlling plant growth© 57: 126–133.
• Ortas I, Ustuner O. Determination of different growth media and various mycorrhizae species on citrus growth and nutrient uptake. Sci Hortic (Amsterdam) 2014; 166 :84–90. doi: 10.1016/j.scienta.2013.12.014. [ CrossRef ] [ Google Scholar ]
• Pérez-Harguindeguy N, Díaz S, Garnier E, et al. New handbook for standardised measurement of plant functional traits worldwide. Aust J Bot. 2013; 61 :167–234. doi: 10.1071/BT12225. [ CrossRef ] [ Google Scholar ]
• Quiroga G, Erice G, Aroca R, Delgado-Huertas A, Ruiz-Lozano JM. Elucidating the possible involvement of maize aquaporins and arbuscular mycorrhizal symbiosis in the plant ammonium and urea transport under drought stress conditions. Plants (Basel) 2020; 9 :E148. doi: 10.3390/plants9020148. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Reddy PP. Sustainable crop protection under protected cultivation. Sustain Crop Prot under Prot Cultiv. 2016 doi: 10.1007/978-981-287-952-3. [ CrossRef ] [ Google Scholar ]
• Rohilla SK, Salar RK. Isolation and characterization of various fungal strains from agricultural soil contaminated with pesticides. Res J Recent Sci. 2011; 1 :297–303. doi: 10.1016/j.scienta.2009.07.019. [ CrossRef ] [ Google Scholar ]
• Schnepf A, Roose T, Schweiger P. Growth model for arbuscular mycorrhizal fungi. J R Soc Interface. 2008; 5 :773–784. doi: 10.1098/rsif.2007.1250. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Shamini S, Amutha K (2015) Techniques for extraction. Int J Front Sci Technol pp 0–6
• Stajich J, Berbee ML, Blackwell M, et al. The fungi. Curr Biol. 2009; 19 :R840–R845. doi: 10.1016/j.cub.2009.07.004. [ PMC free article ] [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Szabo K, Böll S, Erős-Honti ZS. Applying artificial mycorrhizae in planting urban trees. Appl Ecol. 2014; 12 :835–853. doi: 10.15666/aeer/1204. [ CrossRef ] [ Google Scholar ]
• Tsuneo W. Pictorial atlas of soil and seed fungi: morphologies of cultured fungi and key to species. 2. Boca Raton: CRC Press; 2002. [ Google Scholar ]
• van der Heijden MGA, Martin FM, Selosse MA, Sanders IR. Mycorrhizal ecology and evolution: the past, the present, and the future. New Phytol. 2015; 205 :1406–1423. doi: 10.1111/nph.13288. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Vogelsang KM, Bever JD, Griswold M, Schultz PA (2004) The use of mycorrhizal fungi in erosion control applications. Contract 1–150.
• Wulantuya MK, Bayandala FY, Matsukura K, Seiwa K. Gap creation alters the mode of conspecific distance-dependent seedling establishment via changes in the relative influence of pathogens and mycorrhizae. Oecologia. 2020; 192 :449–462. doi: 10.1007/s00442-020-04596-x. [ PubMed ] [ CrossRef ] [ Google Scholar ]
• Zaragoza O. Mycology. Ref Modul Life Sci. 2017 doi: 10.1016/B978-0-12-809633-8.12378-7. [ CrossRef ] [ Google Scholar ]

• Open access
• Published: 19 January 2024

A tripartite bacterial-fungal-plant symbiosis in the mycorrhiza-shaped microbiome drives plant growth and mycorrhization

• Changfeng Zhang 1 , 2 ,
• Marcel G. A. van der Heijden 1 , 2 , 3 ,
• Bethany K. Dodds 1 ,
• Thi Bich Nguyen 1 ,
• Jelle Spooren 1 ,
• Alain Valzano-Held 2 ,
• Marco Cosme 4 , 5 &
• Roeland L. Berendsen 1  

Microbiome volume  12 , Article number:  13 ( 2024 ) Cite this article

10k Accesses

5 Citations

61 Altmetric

Metrics details

A Correction to this article was published on 19 February 2024

This article has been updated

Plant microbiomes play crucial roles in nutrient cycling and plant growth, and are shaped by a complex interplay between plants, microbes, and the environment. The role of bacteria as mediators of the 400-million-year-old partnership between the majority of land plants and, arbuscular mycorrhizal (AM) fungi is still poorly understood. Here, we test whether AM hyphae-associated bacteria influence the success of the AM symbiosis.

Using partitioned microcosms containing field soil, we discovered that AM hyphae and roots selectively assemble their own microbiome from the surrounding soil. In two independent experiments, we identified several bacterial genera, including Devosia , that are consistently enriched on AM hyphae. Subsequently, we isolated 144 pure bacterial isolates from a mycorrhiza-rich sample of extraradical hyphae and isolated Devosia sp. ZB163 as root and hyphal colonizer. We show that this AM-associated bacterium synergistically acts with mycorrhiza on the plant root to strongly promote plant growth, nitrogen uptake, and mycorrhization.

Conclusions

Our results highlight that AM fungi do not function in  isolation and that the plant-mycorrhiza symbiont can recruit beneficial bacteria that support the symbiosis.

Video Abstract

The evolution of the mycorrhizal symbiosis is thought to have been an essential step that enabled the development of land plants 400 million years ago [ 1 ]. Arbuscular mycorrhizal (AM) fungi live in symbiosis with 80% of terrestrial plants [ 2 ] and help plants to access distant water and nutrient sources [ 3 , 4 , 5 , 6 , 7 , 8 , 9 ], facilitating plant adaptation to environmental change [ 10 ]. AM extraradical hyphae extend from plant roots and enlarge the host plant’s area of nutrient uptake. Plants, however, simultaneously interact with many microbes in addition to AM fungi, especially on the roots where the plant microbiome is dense and diverse [ 11 , 12 ].

Also non-mycorrhizal members of the plant microbiome can strongly affect plant growth [ 11 ]. Some detrimental microbes invade the plant and cause disease. Others promote plant growth, either directly, e.g., by providing nutrients, or indirectly by protecting the plants from pathogens and other detrimental microbes [ 13 ]. Plants, therefore, foster and shape a microbiome to their benefit by exuding a mixture of microbe stimulatory and inhibitory compounds [ 14 , 15 ]. As a result, the rhizosphere, the zone of soil surrounding roots that is influenced by these exudates, typically constitutes a dense microbial community that is distinct from that of the surrounding bulk soil and is selectively assembled by the plant [ 11 ].

Similar to plants, AM fungi have been shown to interact with their surrounding microbes [ 16 ]. For instance, the soluble exudates of the AM fungus Rhizophagus irregularis can have either antagonistic or stimulatory effects on individual fungal and bacterial isolates [ 17 ]. Interestingly, there is even a symbiotic footprint of the plant microbiome as plants hosting AM fungi harbor a different microbiome compared to non-mycorrhizal plants [ 18 ]. It has therefore been argued that AM hyphae extend the rhizosphere with a hyphosphere in which they similarly selectively assemble a microbiome [ 19 ].

Interactions between AM fungi and the microbes have primarily been studied by in vitro experiments, and have, e.g., revealed that bacteria can have different affinity for mycorrhizal hyphae [ 20 , 21 ]. In recent years, some in situ experiments have been also conducted where soil with AM hyphae was compared to soil from which AM fungi were restricted. Through amplicon sequencing, these studies have shown that the bacterial community in soil with AM hyphae differed significantly from that of the bulk soil [ 22 , 23 ]. A high throughput stable isotope probing research found that specific bacterial phyla attached to AM hyphae assimilated the most AM fungi-derived carbon [ 24 ]. Moreover, a recent study revealed that mycorrhiza-mediated recruitment of complete denitrifying Pseudomonas bacteria reduces N 2 O emissions from soil [ 25 ]. These findings suggest that the interactions between bacteria and AM fungi play a crucial role in shaping the hyphosphere microbiome.

The interactions between AM fungi and bacteria do not only have an impact on the bacterial community but also greatly influence the performance of the AM fungi. The functioning of the mycorrhizal symbiosis depends on microbial communities in soil and some soils have been characterized as mycorrhiza suppressive soils due to inhibitory effects of specific microbes [ 26 ]. Nonetheless, mycorrhiza helper bacteria of diverse taxonomy were found to promote germination of AM fungal spores, AM fungi establishment and subsequent colonization of plant roots [ 12 , 27 , 28 , 29 ]. Moreover, phosphate-solubilizing bacteria have been shown to mineralize organic phosphorus (P) so that inorganic P can subsequently be absorbed by the AM mycelium [ 8 , 30 ]. These findings suggest that specific components of the soil microbiome might benefit AM fungi and promote their growth and functioning.

Excessive fertilizer and pesticide use in conventional agriculture cause pollution and biodiversity loss [ 31 , 32 ], while organic farming avoids these practices [ 33 ] and promotes soil biodiversity, with mycorrhizal fungal species identified as keystone taxa [ 34 , 35 ]. Although organic farming typically results in lower crop yields than conventional practices, understanding the soil microbiome and key players like AM fungi and its associated microbiome can improve sustainable agricultural practices and close this yield gap.

We therefore investigated the role of AM fungi in shaping soil microbiomes. In a first set of experiments, we grew plants in compartmentalized microcosms using soil from a long-term field experiment with conventionally and organically managed agricultural plots. We sampled root, hyphae, and soil from distinct compartments of the microcosms, and isolated hyphae-adhering bacteria. Using ITS and 16S amplicon sequencing, we identified and isolated specific bacterial genera that are consistently enriched in hyphal samples. In a next set of experiments, we tested the effect of the AM fungi-associated bacterial isolates on plant performance. We discovered that Devosia sp., an AM fungi-associated bacterium, stimulated AM fungi colonization but also directly promoted plant growth by enhancing plant nitrogen (N) uptake.

Experiment I: AM fungi-associated microbes on extraradical hyphae in a sterilized soil substrate

To understand the role of mycorrhizal hyphae in shaping the soil microbiome, we started by growing Prunella vulgaris (henceforth: Prunella) plants from a long-term farming system and tillage (FAST) experiment at Reckenholz (Switzerland) that had either been managed with organic or conventional cultivation practices since the summer of 2009. Prunella is a common grassland plant in Switzerland, grows at the FAST trial location, and is regularly used as a model plant that strongly associates with, and responds to AM symbionts [ 31 , 32 , 33 , 34 , 35 , 36 ]. The plants were grown in the middle compartment of a 5-compartment microcosm (Fig.  1 A). This middle compartment (COMP3) contained either organic or conventional soil (OS or CS) substrate, whereas the other compartments were filled with soil substrate to promote colonization of these compartments by extraradical AM hyphae. The compartments were separated by a 30-μm nylon filter that restrained the growth of roots inside the COMP3 but allowed extraradical hyphae to pass through and exit COMP3 into the compartments 4 and 5 (COMP4 and COMP5; Fig.  1 A).

AM fungi-rich hyphal samples host a bacterial microbiome that is distinct from root and soil samples. A Schematic representation of 5-compartment microcosm in Experiment I. Compartment (COMP3) is filled with 30% of either organic (OS) or conventional (CS) soil, whereas COMP1, 2, 4, and 5 are filled with sterilized substrate. Roots are contained in COMP3 by filter mesh with 30-µm pores (white dashed lines), whereas extraradical AM hyphae are restricted from entering COMP1 by filter mesh with 1-µm pores (green dashed line). B PCoA of fungal communities using Bray–Curtis distances in root, soil and hyphal samples of plants growing in either CS (open symbols) or OS (closed symbols). C PCoA of bacterial communities in root, soil and hyphal samples of plants growing in either CS or OS. Colors in ( B ) and ( C ) indicate different sample types. Shapes depict the compartments of microcosm. D Relative abundance of fungal phyla in root and soil samples from COMP3 and hyphal samples from COMP5. Colors represent the distinct phyla as indicated in the legend. Phyla with relative abundance below 1% were aggregated and categorized as low abundant. E Relative abundance of Glomeromycota spp. in root, soil and hyphal samples in Experiment I. Colors represent the distinct AM fungal species as indicated in the legend

We cultivated the plants for 3 months, after which we found that extraradical hyphae had reached COMP5. We isolated DNA from these samples and subsequently analyzed the composition of fungal and bacterial communities by sequencing ITS and 16S amplicons, respectively.

Soil, roots and hyphal samples represent distinct microbial communities

Principal coordinate analysis (PCoA) of the fungal communities showed a clear separation of soil samples from root samples and hyphal samples (Fig.  1 B). Sample type explained a significant proportion (42.9%) of the variation within the fungal community, as determined by permutational multivariate analysis of variance (PERMANOVA; R 2  = 0.429, F  = 12.416, p  < 0.001) and each of the sample types was significantly distinct from the two other sample types (Table S 1 ). This shows that there is a significant rhizosphere effect shaping the fungal community on the root and that the hyphal samples consist of a fungal community that is slightly different from the root samples. In the 16S amplicon data, we observed a clear separation of bacterial communities between all sample types in the PCoA plot (Fig.  1 C). Almost half (49.6%) of the variation is explained by sample type (PERMANOVA; R 2  = 0.496, F  = 18.751, p  < 0.001) and a pairwise PERMANOVA test shows that all sample types (root, soil and hyphal) are significantly different from each other (Table S 1 ). This shows that the hyphae picked from COMP5 harbor a bacterial community distinct from those in the root and soil samples. We hypothesized that the hyphal samples include the microbes that live around and attached to the mycorrhizal fungi, whereas the root samples additionally include those microbes that are promoted by the roots themselves.

Glomeromycota abundantly present in hyphal and root samples

Glomeromycota , the fungal phylum to which all AM fungi belong, were detected at 71% average relative abundance (RA) of the root fungal community, while on average 51% of the fungal reads in the hyphal samples of COMP 5 were annotated as Glomeromycota . Glomeromycota is thus the dominant fungal phylum in both the root and hyphal samples. In soil samples from COMP3, which were dominated by plant roots, however, this phylum was below 1% in 12 out of 14 samples (Fig.  1 D). This shows that even in the FAST soil close to Prunella roots, AM fungi are lowly abundant, but that over the course of the experiment, AM fungi had colonized Prunella roots and had become very abundant on the roots. Moreover, AM hyphae had grown and extended from the roots in COMP3 to COMP5, where we were able to collect these hyphae using a modified wet sieving protocol. Within the Glomeromycota , we found sequences belonging to two prevalent AM species. Rhizophagus irregularis (average RA: 42% in root and 36% in hyphal samples, respectively) and Septoglomus viscosum (average RA: 25% in root and 14% in hyphal samples, respectively) were the most abundant species in the fungal community. In addition to Glomeromycota , Chytridiomycota also take up a considerable percentage of the reads in some of our hyphal and soil samples but were hardly detected on the roots. Hyphae of Glomeromycota cannot easily be distinguished from those of various other fungi, and consequently, a part of the collected hyphal samples belonged to non-mycorrhizal fungal species.

Effects of field management practices on soil microbiome negated on hyphae and roots

Previous work demonstrated that the soil microbiome is affected by soil management practices [ 35 , 36 ]. The long-term FAST experiment contains plots that have been managed using either conventional or organic cultivation practices for over a decade. We filled microcosms with either FAST OS or CS soil to study the influence of management practices on the rhizosphere and hyphosphere microbiome composition. At the end of 3 months of Prunella cultivation in the greenhouse, the soil in COMP3 was still significantly influenced by preceding management practices of the FAST experiment. This is evidenced by a significant difference in the fungal and bacterial communities’ composition between OS and CS samples collected from the field (Fig. S 1 A, S 1 C; Table S 2 ). We found that 4 fungal genera and 5 classes of bacteria were more abundant in OS, while 6 fungal genera and 2 bacterial classes were more abundant in CS (Fig. S 1 B, S 1 D). Remarkably, we did not find significant effects of soil management on the microbiome composition in the root or hyphal samples of our Experiment I (Table S 2 ). This suggests that the signature of soil management type on soil microbiome disappears while root and hyphae selectively assemble their microbiomes, even though the distinction of microbial communities between OS and CS can still be observed in the soil in between roots in COMP3 (Fig. S 2 ). Moreover, the microbial difference between OS and CS soil affected neither mycorrhizal colonization nor plant performance (Fig. S 3 ).

Experiment II: extraradical hyphae-associated microbes in non-sterilized soil substrate

In the experiment described above, we found that fungal hyphae from COMP5 harbor a microbial community that is distinct from the soil microbiome in COMP1 and the root microbiome in COMP3, the later containing the Prunella roots. However, these hyphae were collected from the sterilized soil substrate of COMP5 that was distinct from the soil substrate in COMP3. We followed up on this experiment by planting 2-week-old Prunella seedlings in the middle compartment (COMP3) of 5-compartment microcosms, but now we filled all compartments with the same non-sterilized OS substrate. Again, the roots were restrained to COMP3 by filters with 30-µm pore size that did allow extraradical growth of fungal hyphae to COMP4 and 5. Differently from Experiment I, we used in Experiment II filters with 1-µm pore size to prevent the growth of hyphae not only into COMP1 but also into COMP2 (Fig.  2 A). We thus hoped to create compartments in each microcosm where the soil microbiome was shaped by the combination of root, hyphae, and their combined exudates (COMP3), by plant-associated hyphae alone (COMP5), or by neither roots nor hyphae (COMP1). We hypothesized that in addition to root COMP3, only buffer COMP2 and 4 would be affected by root exudates, of which COMP4 would additionally be shaped by the plant-associated hyphae that pass through them. After 3 months of Prunella cultivation, we sample soil from each of the compartments and in addition root samples from COMP3 and COMP5 hyphal samples. As we were unable to pick hyphae from unplanted microcosms, we were unable to obtain hyphal samples from unplanted microcosms, and we have to assume that most picked hyphae in the microcosms with Prunella plants belong to plant-associated fungi.

Mycorrhiza-rich hyphal samples host a bacterial microbiome that is distinct from their surrounding soil. A Schematic representation of the 5-compartment microcosm in Experiment II. All compartments were filled with 30% non-sterilized organic soil (OS), mixed with Oil-Dri and sand. Roots are contained in COMP3 by 30-µm filters (white dashed lines), whereas extraradical AM hyphae are restricted from COMP1 and 2 by 1-µm filters (green dashed line). B PCoA of fungal communities using Bray–Curtis distances in root, soil and hyphal samples of plants growing in OS. C PCoA of bacterial communities in root, soil, and hyphal samples of plants growing in OS. Colors in ( B ) and ( C ) indicate different sample types. Shapes in ( B ) and ( C ) depict different compartments. D Relative abundance of fungal phyla in root (COMP3), soil (COMP1 to 5) and hyphal samples (COMP5) in Experiment II. Colors represent the distinct phyla. Phyla with relative abundance below 1% were aggregated and categorized as lowly abundant. E Relative abundance of Glomeromycota spp. in root, soil and hyphal samples in Experiment II. Colors represents the distinct AM fungal species

In contrast to our expectations, we did not find a strong influence of plant growth on the soil microbiome. The soil fungal and bacterial communities of the 5 distinct compartments in the microcosms with plants were not significantly different from each other (PERMANOVA; Fungi, R 2  = 0.077, F  = 1.052, p  = 0.257; Bacteria, R 2  = 0.087, F  = 1.095, p  = 0.101), whereas all soil samples group together and away from the root and hyphal samples in PCoA (Fig.  2 B, C). Nonetheless, both the bacterial and fungal communities in the root-containing COMP3 (Fig. S 2 ) differed significantly from COMP3 soil communities of unplanted microcosms (Table S 3 ). Moreover, the fungal community of COMP4 and the bacterial community in COMP2 were significantly affected by the presence of Prunella roots in the adjacent COMP3 and differed significantly from the same compartments in the unplanted microcosms (Table S 3 ). This shows that roots do affect the soil microbial community of COMP3 and that root exudates can, to a lesser extent, also reach and affect the microbial communities of the adjacent COMP2 and 4. The roots however do not affect the outer COMP1 and 5. We were able to isolate hyphae from COMP5, and these hyphal samples are enriched with Glomeromycota . These hyphal samples also contain bacterial communities that are distinct from the surrounding soil (Fig.  2 C), in line with observations made in Experiment I (Fig.  1 C). Sample type (root, hyphal, or soil) explained 40.8% of the variation in fungal communities and 18% of the bacterial communities over all compartments, while the presence of Prunella roots explained only 2% of the difference between unplanted and planted microcosms for fungal communities and 1.7% of the difference for bacterial communities (Table S 3 ).

Glomeromycota again dominated the fungal community of both root and hyphal samples (RA of 61% and 40%, respectively; Fig.  2 D). In addition to Rhizophagus irregularis and Septoglomus viscosum (the Glomeromycota spp. that were found abundantly in our Experiment I), we found Funneliformis mosseae to be also abundantly present in the root and hyphal samples of our Experiment II (Fig.  2 E). Here, we found that the hyphal samples consisted of fungal and bacterial communities that were significantly different from the soil microbial communities in COMP5, which reflects the original soil from which these microbes were initially acquired (Fig.  2 B, C, Table S 4 ).

Bacteria on hyphae derive from soil and root

We subsequently focused on the bacterial communities to better understand the hyphal microbiome assembly. In both Experiments I and II, we observed that the bacterial community occurring on hyphae is different from those on soil and root samples. In Experiment I, we detected a total of 5139 bacterial amplicon sequence variants (ASVs), of which 289 ASVs occurred in root, soil as well as hyphal samples (Fig.  3 A). These shared ASVs account for 33.1% of RA in hyphal samples, and 35.1% of RA in root samples, but make up only 10% of RA in soil samples. Root and soil samples uniquely share each an additional 241 and 186 bacterial ASVs with the hyphal samples, respectively. The 241 ASVs shared between roots and hyphae account for 28.6% of RA in hyphal samples, whereas they represent only 5.6% of RA in root samples. Similarly, the 186 ASVs uniquely shared between soil and hyphae represent 11.2% of RA in the hyphal samples, but only 2.2% of RA in soil samples.

The abundance of hyphal ASVs shared with root and soil samples. A Venn diagram of unique and shared bacterial ASVs in root, hyphal, and soil samples of Experiment I. Number of ASVs are indicated for each compartment. Colors indicate bacterial ASVs shared between hyphae and soil (orange), root (gray), or both (purple). B Sankey plot of hyphal samples shared ASVs’ RA in each sample type. Colors depict the hyphal ASVs that are either shared with soil (orange), root (gray), or both soil and root (purple). C Bar plot of phylum-level abundance of ASVs shared between soil, root, and hyphal samples. Vertical color bars on the left indicate the hyphal phyla either shared with soil, root or both soil and root. Colors of the stack bars depict the bacterial phyla. Phyla with relative abundance below 0.1% were aggregated and categorized as lowly abundant. D Venn diagram of unique and shared ASVs in root, hyphal, and soil samples of experiment II. E Sankey plot of hyphal samples shared ASVs’ RA in each sample types. F Bar plot of phylum-level abundance of ASV shared between soil, root, and hyphal samples. Only ASVs present in > 3 samples are considered here

In total, more than 70% of RA in hyphal samples are taken up by the shared ASVs from either soil, roots or both (Fig.  3 B). This suggests that most bacteria on hyphae, that were isolated from the sterilized substrate in COMP5 in Experiment I, originated from the root and soil in COMP3, and likely traveled over, within, or with the hyphae into COMP5. Proteobacteria was the most abundant phylum on hyphal samples of the ASVs that were shared with soil or root samples (Fig.  3 C).

In Experiment II, however, all compartments were filled with the same non-sterilized soil substrate. Here, 515 out of a total of 3684 bacterial ASVs were found to be shared by root, hyphal, and soil samples (Fig. 3 D). These ASVs account on average for 64.2% of RA in hyphal samples and 67.1% of RA in soil samples, but only 35.3% of RA in root samples. Proteobacteria (19.5% in hyphal samples), Actinobacteria (19.1% in hyphal samples), and Planctomycetes (8.0% in hyphal samples) were the most abundant phyla among the ASV that were shared between all sample types (Fig.  3 F). The hyphal samples uniquely shared 934 ASVs with soil samples, accounting for 26.4% of RA, while representing 20.7% of RA in soil samples. In total, the ASVs that together represented more than 90% of the reads in hyphal samples are also detected in soil samples (Fig.  3 E). In contrast, the hyphal samples uniquely share only 102 ASVs with the root samples. That account for only 2.7% of RA in hyphal samples, while representing 11.1% of RA in root samples. Thus, in the more natural situation of experiment II, the microbial community on hyphae is more similar to that of the surrounding soil, and only a small minority has likely traveled from the root compartment. In both cases, however, the hyphal samples constitute a microbial community that is distinct from the community observed in the soil and roots.

Specific bacterial taxa are consistently enriched on hyphal samples

We then examined which bacterial taxa were consistently enriched in the hyphal samples to identify bacteria that strongly associate with the AM hyphae. We identified 81 bacterial genera that occurred in the hyphal samples of both experiments (Fig.  4 A). These consistently present bacterial genera are more abundant in hyphal samples then soil samples, and comprise a large part of the bacterial microbiome in the hyphae of both experiments (Fig.  4 B). These consistently present bacterial genera together increase from 19.9% and 16.2% in soil to 42.9% and 27.6% in the hyphal samples of Experiments I and II, respectively . Of those 81 genera, 13 genera were significantly more abundant in hyphal samples than in soil samples in both experiments (Fig.  4 C), of which Haliangium , Massillia , Pseudomonas , genus SWB02, and Devosia were the most abundant. In contrast, these 13 consistently enriched bacterial genera comprise only 1.5% and 0.3% of RA in the soil samples of Experiments I and II, but represented 24.6% and 5.8% of RA in the hyphal samples of both experiments, respectively. These genera are thus consistently and specifically enriched in mycorrhiza-rich hyphal samples. Interestingly, in both experiments, Haliangium is by far the most abundant bacterial genus on the hyphae, taking up 6.4% and 3% of RA in Experiments I and II, respectively.

Specific bacterial genera and ASVs are consistently enriched on hyphae in both experiments. A Venn diagram showing the occurrence of bacterial genera on hyphal and soil samples across 2 experiments. Genera with relative abundance below 0.1% were aggregated and categorized as lowly abundant that are not present here. B Relative abundance of bacterial genera that are consistently occurring on hyphal samples (outline of bars) and of genera that are consistently significantly enriched in hyphal samples (filled with purple color) of Experiments I and II compared to the abundance of these same genera in soil samples (filled with orange color). C Relative abundance of genera that are consistently significantly enriched in hyphal samples across the two experiments (Wilcox-test; * p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001, ns: p  > 0.05). ANPR*: Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium. D Bar plots showing the mean relative abundance of six bacterial ASVs that are consistently enriched in hyphal compared to soil samples in both Experiments I and II. Significance levels for the ASVs exhibiting positive correlations with hyphal samples, as determined by Indicspecies, are denoted by asterisks (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001). Bacterial ASVs are labeled with a unique 4-letter ASV identifier and the lowest available taxonomic annotation. Colors indicate sample types; shapes of symbols indicate the microcosms of samples from which they are derived

These results encourage us to analyze further our data at a higher taxonomic resolution. We used Indicspecies [ 37 ] to calculate the point-biserial correlation coefficient of an ASV that is positively associated with hyphal, root, or soil samples. Only six bacterial ASVs were positively associated with the hyphal samples of both experiments (Fig.  4 D). These ASVs are all Proteobacteria and belong to the genera Pseudomonas , Devosia , Sulfurifustis , Cellvibrio , and uncultured Myxococcales.

In summary, certain bacterial genera appear to be consistently enriched in our hyphal samples, comprising a considerable portion of the bacterial abundance. The genus of Halangium represents the most strongly enriched genus and dominated the hyphal samples of our two independent experiments. Moreover, the genus Pseudomonas , Devosia , and Sulfurifustis stand out as they are not only consistently enriched on hyphal samples of both experiments, but each also comprises a specific ASV that is consistently associated with AM hyphae.

Isolation of hyphosphere bacteria

To functionally characterize hyphae-associated bacteria, we isolated bacteria from mycorrhiza-rich hyphal samples collected from COMP5 in microcosms with Prunella plants of Experiment I. We either placed single hyphal strands on an agar-solidified growth medium and streaked individual bacterial colonies that appeared alongside these hyphae (Fig. S 5 ). Alternatively, we washed hyphal samples in sterile 0.9% saline water and isolated bacteria through dilution plating.

In total, we isolated 144 bacteria and determined the taxonomy of the isolates by sequencing the 16S rRNA gene (Additional file 1 ). The 144 isolates belong to 3 bacterial phyla and mainly represent Actinobacteria (72.7%), Proteobacteria (17.5%), and Firmicutes (9.8%). Of the 13 bacterial genera that were consistently enriched in hyphal samples, we isolated representatives of the genus Pseudomonas and Devosia only. Remarkably, the most abundant bacterial genus in the hyphal samples, Haliangium , was not represented, indicating that the Haliangium bacteria on the hyphae were not able to grow on the media used for isolation.

We further examined our isolate collection by matching the 16S rRNA gene of the bacterial isolates to the ASVs enriched in sequencing data of hyphal samples of the above-described Experiments I and II. We isolated three Devosia spp. from our mycorrhiza-rich hyphal samples. These isolates have identical 16S sequences and share 99.5% nucleotide identity with Devosia ASV aaa0, which was consistently enriched on hyphal samples in both Experiments I and II. Interestingly, however, the isolates share 100% nucleotide identity with Devosia ASV e5d2, an ASV that was consistently significantly enriched on roots of Prunella plants, but not in the hyphal samples (Fig.  5 A).

Devosia sp. ZB163 is isolated from fungal hyphae but thrives on the root and promotes plant growth. A Relative abundance of the selected ASVs in the root, hyphal, and soil samples in Experiment I. Sample types were indicated by color. Each selected ASVs ID was labeled together with a selected corresponding bacterial isolate with matching sequence. The significance levels, as determined by Indicspecies , for the ASVs exhibiting positive correlations with hyphal (ASV aaa0, A066,0,7a7, 63b4 and 86c0) root (e5d2), or soil (c1d8 and 254f) samples are denoted by asterisks (* p  < 0.05, ** p  < 0.01, *** p  < 0.001, **** p  < 0.0001). B Shoot dry weight of 9-week-old Prunella plants ( C ) AM fungi colonization percentage comparison between bacterial treatments. Significant differences of ( B ) and ( C ) are indicated with letters (ANOVA and Tukey’s Honest HSD test)

The 16S sequence of the single Pseudomonas sp. ZB042 did neither match very well with the consistently enriched Pseudomonas ASV 5518 (95% NI) nor any other ASV in the data set with more than 99% NI. We therefore expanded our search to identify ASVs with a shared NI of more than 99% with an ASV that was significantly enriched in hyphal samples of experiment I.

In this way, we ultimately selected 5 hyphosphere bacteria (HB) from our collection of isolates that respectively represent Devosia ASV e5d2, Bosea ASV A066, Sphingopyxis ASV 07a7, Achromobacter ASV 63b4, and Microbacterium ASV 86c0 (Fig.  5 A). These HB were subsequently used to examine their influence on the AM symbiosis. In addition, we selected 2 bacterial isolates that matched with ASVs that were enriched in soil compared to hyphal samples, and here we also included the Pseudomonas sp. ZB042. These soil bacteria (SB) were incorporated as control bacteria that were not associated with AM fungi.

Devosia sp. ZB163 promotes plant growth in organic soil

We tested whether the selected bacterial isolates affected the symbiosis between P . vulgaris plants and AM fungi. To this end, we inoculated a soil-sand mixture with each of the 5 HB or the 3 SB at an initial density of 3 × 10 7 CFU/g. In addition, two treatments, either combining the 5 HBs or the 3 SBs as two separate synthetic communities (HB/SB SynCom), were applied to the soil-sand mixture with a cumulative initial abundance of 3 × 10 7 CFU/g. Finally, we transplanted 2-week-old Prunella plants to the inoculated pots. After 9 weeks of growth in a greenhouse, we harvested the shoots of these plants and found that only plants inoculated with either Devosia sp. ZB163 (hereafter: Devosia ) or the HB SynCom had significantly higher shoot dry weight than control plants (Fig.  5 B). This indicates that Devosia can promote plant growth. All control and treatment plants in this experiment were colonized by AM fungi and the mycorrhization at the end of the experiment was not significantly affected by the distinct bacterial treatments in this experiment (Fig.  5 C).

Devosia sp. ZB163 promotes plant growth and mycorrhization

To explore whether plant growth promotion by Devosia sp. ZB163 relies on the presence of AM fungi, we depleted the indigenous microbiome by autoclaving the soil-sand mixture and again inoculated Devosia at an initial density of 3 × 10 7 CFU/g soil prior to transplantation of Prunella seedlings (hereafter: Devosia treatment). Subsequently, 100 monoxenic R . irregularis spores were injected near the seedling’s roots (hereafter: AM treatment). To ensure nutrient-poor conditions and stimulate AM fungi colonization, the plants in this experiment were not provided with nutrients in addition to what was present in the soil-sand mixture.

After 8 weeks of growth under controlled conditions in a climate chamber, plants inoculated with Devosia had a significantly higher shoot and root weight (Fig.  6 A, B), indicating that, even without AM fungi, Devosia sp. ZB163 can promote plant growth. Four out of the eleven plants that were inoculated with AM fungi were bigger than control plants and the leaves of these plants were more bright green (Fig.  6 F). These four plants were the only plants in which mycorrhiza had colonized the roots and, likely as a result of the mycorrhiza incidence, the average weight of roots and shoots was not affected by the AM treatment. However, plants that had been inoculated with the combination of AM and Devosia did have significantly higher shoot and root weights compared to the controls without AM and Devosia . Remarkably, 10 out of 11 plants that had received the combination of Devosia and AM were bright green and were colonized by mycorrhiza. This suggests that Devosia sp. ZB163 not only promoted plant growth directly but also improved AM establishment in this experiment. As Devosia neptuniae has previously been reported to fix N [ 38 ] and AM fungi are known to provide plants with both N and P [ 39 ], we measured leaf N and P content. We found that the leaves of all plants that were colonized by AM fungi contained more P (Fig.  6 E), while the plants that were inoculated with Devosia had higher N content (Fig.  6 D). This suggests that Devosia and AM promote plant growth by stimulating the uptake of respectively N and P in a complementary manner. We hypothesized that this did not result in even higher plant growth in the combination treatment as other mineral components of the nutrient-poor soil/sand mixture also constrained the growth of plants in these experiments.

Devosia promotes plant growth, mycorrhization, and N accumulation. Boxplots show A shoot dry weight, B root dry weight, C percentage of each root system colonized by AM fungi, D shoot N accumulation, and E shoot P accumulation of 8-week-old Prunella plants cultivated in autoclaved soil (Control) or inoculated with Devosia sp. ZB163 (Devosia), R . irregularis (AM), or both symbionts. In the 6th, 7th and 8th week, plants were watered with modified Hoagland solution without N and P. Significant differences are indicated with letters (ANOVA and Tukey’s Honest HSD test). F Photographs of the Prunella plants immediately before harvest. Red circles indicate plants that were later found to be colonized by AM fungi

Devosia sp. ZB163 and AM fungi synergistically promote plant growth

We subsequently repeated this experiment but now provided the plants with a modified Hoagland solution that included most micronutrients but was deficient in N and P (Table S 5 ). Again, Devosia promoted plant growth, but in this experiment also AM led to a significantly higher dry weight of both shoots and roots (Fig.  7 A, B). In this experiment, AM fungi established successfully in the roots of all plants to which they were inoculated, but the mycorrhizal colonization was higher on plants that were also inoculated with Devosia (Fig.  7 C). Notably, this combination treatment of AM and Devosia resulted in the significantly highest plant shoot weight among all treatments, showing that AM fungi and the Devosia ZB163 can synergistically promote plant growth (Fig.  7 A). In line with this, we found that accumulation of N was significantly increased in plants inoculated with Devosia (Fig.  7 D). Moreover, although accumulation of P increased in plant inoculated with AM only, the plants inoculated with both AM and Devosia accumulated significantly more N and P (Fig.  7 E).

Devosia sp. ZB163 and AM fungi can synergistically promote plant growth and plant N and P accumulation. Boxplots show A shoot dry weight, B root dry weight, C percentage of each root system colonized by AM fungi, D shoot N accumulation, or E shoot P accumulation of 8-week-old Prunella plants cultivated in autoclaved soil (Control) or inoculated with Devosia sp. ZB163 (Devosia), R . irregularis (AM), or both symbionts. Plants were regularly watered with modified Hoagland solution deficient in a source of N and P. Significance differences are indicated with letters (ANOVA and Tukey’s Honest HSD test). F Photographs of the Prunella plants immediately before harvest. Two AM-treated plants died shortly after transplantation and were not considered in panels ( A – E )

We subsequently quantified the absolute abundance of Devosia by sequencing 16S rRNA gene amplicons of DNA isolated from the roots of plants used in this experiment and spiked with a known amount of 14ng DNA [ 40 ]. We detected low amounts of Devosia on the roots of plants that were not inoculated with Devosia , indicating that some level of cross contamination occurred in our experiment (Fig.  8 A). Nonetheless, the numbers of Devosia were significantly higher on roots that were inoculated with Devosia .

Abundance of Devosia sp. ZB163 significantly correlates with plant weight, mycorrhization, and N and P accumulation. A Boxplot of the absolute abundance of Devosia DNA on roots of plants in sterilized soil inoculated with a mock solution (Control), Devosia sp. ZB163 ( Devosia ), R. irregularis (AM), or both symbionts. Letters indicate significant differences as determined by ANOVA with Tukey’s HSD test. B–E Scatter plots of the correlation between the absolute abundance of Devosia DNA and B total plant N accumulation, C shoot dry weight, D root dry weight, E hyphal colonization, and F total plant P accumulation. Correlations and probabilities thereof are determined using linear regression

We subsequently analyzed the correlation between absolute Devosia abundance and several parameters. We observed that, independent of AM presence, Devosia abundance positively correlates with plant N accumulation (Fig.  8 B), but also with shoot and root dry weight (Fig.  8 C, D). This, together with the observed causal effects, shows that Devosia sp . ZB163 can directly stimulate plant growth and N uptake. Moreover, the absolute abundance of Devosia significantly correlates with the percentage of AM fungi colonization (Fig.  8 E), suggesting further that Devosia indeed accelerates the colonization of plant roots by AM fungi. In line with this, we observed that Devosia abundance correlates significantly with increased P accumulation, but only in presence of AM (Fig.  8 F), and that the percentage of root length colonized by AM hyphae correlates with P accumulation (Fig. S 6 ). Together, these data show that Devosia can stimulate plant growth directly, likely by increasing N uptake, but also indirectly by promoting AM fungi colonization and corresponding P uptake.

Devosia sp. ZB163 lacks genes required for atmospheric N fixation

The genome of Devosia sp. ZB163 was subsequently sequenced using the Illumina Novoseq platform (Génome Québec, Canada) resulting in a sequenced genome of approximately 4.6 Mb that was predicted to have 4486 coding sequences (CDSs) and a GC content of 65.7%. As we found that Devosia sp. ZB163 promotes plant N uptake, we subsequently performed a reciprocal BLASTp to search for orthologues of known N-related genes (Table S 6 ). We first explored the Devosia genome for genes that are required for atmospheric N fixation. The nifADHK gene cluster typically encodes the molybdenum nitrogenase complex that is most commonly found in diazotrophs (Dixon and Kahn, 2004). However, we found orthologues of neither nifA , nifD , nifH nor nifK in the genome of ZB163 using translated amino acid sequence of these genes from Devosia neptuniae , Sinorhizobium meliloti , Bradyrhizobium japonicum , and Klebsiella pneumoniae [ 38 , 41 , 42 , 43 ]. Next, we blasted the Devosia sp. ZB163 genome to a nifH database that contains 34,420 nifH sequences, but again did not find a hit for nifH in the genome of ZB163. Finally, also the gene clusters vnfHDGK and anfHDGK encoding the less common nitrogenase complexes were not detected in the Devosia sp. ZB163 genome [ 44 ]. This strongly suggests that unlike other Devosia isolates, Devosia sp. ZB163 is not able to fixate atmospheric N.

However, bacteria can also increase the amount of N that is available to plants through the mineralization of organic N. The ammonification process in the soil mineralizes organic N to ammonia and the organic soil used in this study was previously reported to slowly-release urea [ 45 ]. Urea, as an organic N source, is subsequently catalyzed by urease to ammonia that can be subsequently supplied to plants. Using protein sequence from Devosia rhizoryzae , Devosia oryziradicis [ 46 ], we detected the presence of the gene clusters UreDFG and UrtABCDE that are required to catalyze the hydrolysis of urea, forming ammonia and carbon dioxide. Besides ammonia, plants can also take up nitrate. Nitrification bacteria catalyze ammonium to nitrate with amoA gene. Again, we did not detect any amoA orthologs in the Devosia genome using the translated amino acid sequences of these genes from Nitrosomonas europaea [ 47 ].

Plant root microbiomes are known to play important roles in plant growth and plant health [ 11 ]. Here, we investigated whether AM fungi, that are part of the plant root microbiome, are themselves also similarly able to interact with microbes. AM fungi do not only transfer mineral nutrients to the host plants, but also relocate 5–20% of photosynthates from the plant to the surrounding environment [ 48 , 49 ]. As such, the AM hyphae provide space and nutrients for microbes to grow on and have been shown that the AM hyphosphere microbiome is different from the bulk soil [ 22 , 23 ]. While some studies assessed bacterial communities associating with AM hyphae, so far, no studied isolated bacteria from AM hyphae and test the impact on plant growth and mycorrhization. To resolve this gap of knowledge, we conducted experiments in compartmentalized microcosms, and we sampled hyphae that grew from a compartment with plant roots into the outer compartment of the microcosms, from which roots were restricted. These hyphal samples were strongly enriched in Glomeromycota , the division of the obligate biotrophic fungi that form arbuscular mycorrhiza. Moreover, we were unable to isolate these hyphae from the same compartment of unplanted microcosms, which demonstrates that a large part of these hyphae is likely formed by extraradical hyphae of obligate fungal biotrophs that extend from the prunella roots in these microcosms. Nonetheless, although most bacterial isolates were likely isolated from AM fungi, it is possible that some were isolated from other fungi (e.g., Chitriodiomycota were also common in some microcosms).

We found that the bacterial communities in our hyphal samples are distinct from the surrounding soil. Although a select set of microbes appear to have traveled from the root compartment to the hyphal compartment, the majority of the microbes on hyphae are shared with the surrounding soil but changed in abundance on the hyphae. AM hyphae thus selectively assemble a bacterial hyphosphere microbiome and this confirms other studies [ 22 , 24 , 25 , 50 ]. In our first two experiments, Haliangium is the most abundant bacterial genus in our hyphal samples. Representatives of this genus have previously been isolated from soil samples and, as bacterivore Haliangium spp. have been found to prey on bacterial species, it has been hypothesized that Haliangium spp. shape the soil microbiome through bacterivory [ 51 , 52 , 53 , 54 ]. The abundance of Halangium spp. on AM-fungi-rich hyphae suggests they are important for AM fungi and hyphosphere communities. Unfortunately, we were unable to isolate Halangium spp. from AM-fungi-rich hyphae in this study using the conventional growth media, perhaps because these Halangium spp. are bacterivores that obtain energy and nutrients entirely from the consumption of bacteria. It will be interesting to explore their role in the AM hyphosphere in the future.

In addition to Haliangium , also the genera Pseudomonas and Devosia were consistently enriched in the hyphal samples of our experiments. Previously, Pseudomonas strains have been identified as mycorrhiza helper bacteria that promote the colonization of both ectomycorrhizae and arbuscular mycorrhizae in multiple studies [ 25 , 27 , 55 , 56 ]. A recent study even suggested that the recruitment of Pseudomonas strains reduces N 2 O emissions from soil [ 25 ]. Our results suggest that the beneficial effect of Pseudomonas bacteria on AM fungi is reciprocated by the AM fungi, who can also specifically promote the growth Pseudomonas spp.

Devosia spp. have not previously been found in association with AM fungi, but we found this genus to be consistently enriched in mycorrhiza-rich hyphal samples. We were able to isolate Devosia sp. ZB163 from the mycorrhiza-rich hyphal sample, but the 16S rRNA gene sequence Devosia sp. ZB163 was a perfect match to a Devosia ASV that was especially abundant in root samples. Although this might suggests that Devosia sp. ZB163 operates largely on the roots of Prunella plants, Devosia sp. ZB163 is nonetheless also present on hyphal samples. As fungal hyphae are recognized as highways of bacterial movement [ 57 ], it will be interesting to investigate the role of mycorrhizal hyphae in transport of this bacterium to new hosts. Fungus-mediated transport of Devosia sp. ZB163 would benefit this bacterium, the fungus that transports it, as well as their mutual host plant. On prunella roots, Devosia sp. ZB163 can stimulate plant growth directly, but it also enhances the mycorrhizal colonization process and thus functions as a mycorrhization helper bacterium [ 27 ].

Devosia sp. ZB163 also promotes the uptake of N by the plant as evidenced by the increased amount of total N in Prunella plants that were inoculated with the isolate. To have insight into the mechanism by which Devosia sp. ZB163 promotes N uptake by Prunella, we sequenced the genome of Devosia sp. ZB163 and searched for genes involved in N conversion. Whereas our analysis suggests Devosia sp. ZB163 is not involved in N fixation or nitrification, we did identify gene clusters that are putatively used for the decomposition of urea, which is a critical process for ammonification in soil [ 58 ] and which could improve plant N availability [ 59 ].

Although AM fungi require considerable amounts of N for their own development, they can still contribute to the N uptake by the host plant [ 60 ]. AM fungi take up inorganic N outside the roots, mostly as ammonium [ 61 , 62 ], incorporate it as glutamine, translocate the N from the extraradical to the intraradical mycelium as arginine, and once inside the root cells, convert the arginine into urea, from where the N is finally transferred as ammonium to the host [ 5 ]. Hence, urea is an important precursor of ammonium [ 61 ], and it is tempting to speculate Devosia sp. ZB163 also operates as an endosymbiont, as observed for other AM-associated bacteria [ 63 ], and facilitates transfer of inorganic N to the host plant inside the intraradical hyphae by converting urea into ammonium. Consistent with this, our co-inoculation with Devosia sp. ZB163 and AM fungi in Prunella plants increased mycorrhization, suggesting a bacterial ability to enhance AM fungi growth, and also led to the highest accumulation of N in the host plant. Future research should attempt to characterize whether Devosia sp. ZB163 can operate as an endosymbiont of AM fungi.

Alternatively, Devosia sp. ZB163 might induce a response in the plant that enhances N uptake. For example, an Achromobacter sp. in the root of oilseed was found to stimulate the uptake rate of nitrate by stimulating the plant’s ionic transport system while simultaneously promoting the formation and length of root hairs [ 64 ]. It will be intriguing to find out whether Devosia sp. ZB163 similarly promotes the formation of an extensive root system in Prunella plants, as extensive root branching likely also affects the rate of mycorrhization [ 27 ]. In line with this hypothesis, we did see a significant correlation between root dry weight and the abundance of Devosia sp. ZB163 on the roots in our experiments.

Devosia sp. ZB163 by itself did not affect plant P content, but in the presence of the mycorrhiza, the abundance of Devosia sp. ZB163 was significantly correlated with increased P accumulation. This shows that, although Devosia sp. ZB163 does not itself provide P to the plant, it can indirectly provide extra P by stimulating mycorrhization and/or the mycorrhizal functioning. In line with this, we found that the combined treatment of AM fungi and Devosia sp. ZB163 can lead to more growth promotion than either microbe alone.

Overall, our study reveals that the microbiome of AM-fungi-rich hyphal samples is distinct from the surrounding soil and that specific bacteria are selected on fungal hyphae. We found that Halangium , Pseudomonas , and Devosia were consistently enriched in our hyphal samples. Devosia sp. ZB163 acts as a mycorrhization helper bacterium, promoting the mycorrhization of Prunella plants and indirectly providing extra P to the plant. The combination of AM fungi and Devosia sp. ZB163 results in more growth promotion than either microbe alone. These results provide new insights into the importance of the AM fungal microbiome and highlight the potential of beneficial bacteria such as Devosia for improving plant growth, nutrition, and health. Further studies are needed to explore the role of these bacteria in the AM fungal hyphosphere. Mycorrhizae are a long-standing promise for sustainable agriculture and their successful application could reduce the requirements of crop fertilizers. Our study suggests that the performance of mycorrhiza and crops in the agricultural field might benefit considerably from the application of mycorrhiza helper bacteria, such as Devosia sp. ZB163.

Soil collection

The organic soil (OS) and conventional soil (CS) used in this study were derived from the Farming System and Tillage experiment (FAST) site [ 35 ]. The FAST site was established in 2009 near Zürich (latitude 47°26′ N, longitude 8°31′ E) and the plots in this field have since undergone either conventional or organic management. The soil was collected in April 2019 and March 2020 for Experiments I and II respectively. The top layer of vegetation (2 cm) was removed, and a 20 cm depth of soil was excavated from the field. The soil was passed through a 2 mm sieve and stored at 4 ℃ before use.

Description of microcosms and plant growth conditions

Experiment i.

Microcosms were constructed of 20 × 10 × 19 cm (L × W × H) that were divided into 5 equal compartments (Fig.  1 A). The compartments were separated from each other by 30-μm nylon filters that allows hyphae to pass through but not roots. COMP1 and COMP2 were separated by a 1-μm filter that also blocked hyphae. The middle compartment (COMP3) was filled with 1200 g of a mixture of 30% non-autoclaved soil (either OS or CS), 4% autoclaved Oil-Dri (Damolin GmbH, Oberhausen, Germany), and 66% autoclaved sand. This compartment acted as soil inoculum. The outer compartments (COMP1, COMP2, COMP4, and COMP5, respectively) were each filled with 1200g of sterilized outer substrate (8% autoclaved soil (either OS or CS), 6% autoclaved Oil-Dri and 86% autoclaved sand). All autoclaved substrates used in this study were heated to 121 ℃ for 45 min twice. Seven replicate microcosms were set up for OS and CS, respectively.

Prunella vulgaris (henceforth Prunella) seeds were vapor-phase sterilized by exposure to chlorine gas for 4 h. To this end, chlorine gas was generated by adding 3.2 ml 37% HCl to 100 ml Bleach (Hijman Schoonmaakartikelen BV, Amsterdam, NL). The seeds were sown on half-strength Murashige and Skoog basal agar-solidified medium (Sigma Aldrich, St. Louis, MO, USA). The plates with seeds were subsequently incubated in a climate chamber (Sanyo MLR-352H; Panasonic, Osaka, Japan) under controlled conditions (light 24 ℃, 16 h; dark 16 ℃, 8 h). Seven 2-week-old seedlings with roots of approximately ~ 0.5 cm length were transplanted to the middle compartment of the microcosms. The plants in the microcosms were allowed to grow in the greenhouse (Reckenholze, Agroscope, Zürich, CH) with a 16 h photoperiod at 24 ℃ alternated with 8 h of darkness at 16 ℃. Plants were watered with 120 ml H 2 O 2–3 times per week.

Experiment II

To investigate the effect of an actively growing AM mycelium on the indigenous soil microbiome, we filled each of the compartments of the microcosm described above with 750 g of a mixture of 30% non-autoclaved OS, 4% autoclaved Oil-Dri (Damolin GmbH, Oberhausen, Germany) and 66% autoclaved sand. In this experiment, COMP1 and COMP2, and COMP2 and COMP3 were separated by 1-μm nylon filters to generate two AM-fungi-free compartments. COMP3 and COMP4, and COMP4 and COMP5 were separated by 30-μm nylon filters to create 2 compartments that could be colonized by extraradical AM hyphae (Fig.  3 A). We set up 11 biological replicates with Prunella plants in the center compartment (as described above) and 5 biological replicates of unplanted control. The plant growth conditions were similar to those described above for Experiment I, but the experiment was executed in a greenhouse at the botanical gardens of Utrecht University.

Harvest and mycorrhizal root colonization analysis

In both experiments, the shoots of 3-month-old plants were cut at the soil surface, dried at 70 ℃ for 48 h, and weighed. The microcosm soil was sampled by deconstructing the microcosm compartment by compartment, homogenizing the soil of each compartment, and collecting approximately 500 mg of soil in 2-ml tubes. For sampling of AM hyphae, 30 g of soil substrate was collected from COMP5 and stored in a 50-ml tube at − 20 ℃. The plant roots in COMP3 were collected by carefully removing soil from the roots and rinsing them under the running tap. For each microcosm, a 1-cm-long fragment of the rinsed root was cut weighed and stored in 50% ethanol for mycorrhizal root colonization analysis. Another 1-cm-long fragment of roots was cut, weighed, and stored at − 80 ℃ for root microbiome analysis. The rest of the roots were weighed, dried at 70 ℃ for 48 h and weighed again. From this root, water content was determined and the total root dry weight was calculated based on the combined fresh weight of all three root samples.

To check the mycorrhizal colonization of the roots, the root fragments stored in 50% ethanol were cleared in 10% KOH and stained with 5% ink-vinegar following a protocol described by Vierheilig et al. [ 65 ]. The percentage of total mycorrhiza colonization and frequency of hyphae, arbuscules, and vesicles were scored following the magnified intersections method by checking 100 intersections per sample at the microscope using a 200 × magnification [ 66 ].

Sampling of fungal hyphae from soil substrate

To sample fungal hyphae, we modified a wet sieving protocol typically used to collect mycorrhiza spores [ 67 ]. The schematic graph of the fungal hyphae extraction procedure is shown in Fig. S 7 . Briefly, 500 μm, 250 μm, and 36 μm sieves were surface sterilized to minimize irrelevant environmental microbes present in a hyphal sample by submersing in 0.5% sodium hypochlorite for 20 min, then submersed in 70% Ethanol for 10 min [ 68 ]. The sieves were stacked together with the biggest filter size on top and the smallest filter size at the bottom. Then, 25 g of soil substrate from COMP5 was placed on the top sieve. The small particles were washed down, and soil aggregates were broken down with sterilized water. The leftovers on all sieves were washed off into Petri dishes. Then, approximately 0.1 mg hyphae were picked from the samples in the Petri dishes using a set of flame-sterilized tweezers under a binocular microscope. We concentrated the hyphae in a single 1.5-ml tube filled with 0.2 ml 30% glycerin per compartment. This was then considered a hyphal sample (Fig. S 7 , S 8 ). The hyphal samples were stored at -80℃ until DNA extraction.

Soil, root and hyphal microbiome profiling

For Experiment I, the soil and root samples from COMP3 and concentrated hyphae samples from COMP5 were characterized by conducting 16S and ITS amplicon sequencing. For Experiment II, the soil samples (both planted and unplanted soil) from COMP1, 2, 3, 4, and 5, root samples from COMP3, and concentrated hyphae samples from COMP5 were characterized by conducting 16S and ITS amplicon sequencing. DNA extraction from soil, root, and hyphal samples was performed using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Hilden, Germany). The root and soil samples were homogenized in the kit’s PowerBead solution for 10 min at 30 m/s twice using a Tissuelyser II. The hyphal samples were homogenized in PowerBead solution for 2 min at 30 m/s 4 times with the Tissuelyser II. The rest of the DNA extraction steps followed the manufacturer’s instructions. Extracted DNA was quantified using Qubit dsDNA BR Assay Kit and Qubit Flex Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA).

DNA was amplified following a two-step PCR protocol. In the first step, we amplified bacterial 16S rRNA gene V3-V4 region (341F and 806R) [ 69 ], fungal ITS2 (5.8SFun and ITS4Fun) [ 70 , 71 ] using primers described in Table S 7 . The microbial communities were amplified in 24 µl reaction volume containing 7.5 ng DNA template, 12 µl KAPA HiFi HotStart ReadyMix (F. Hoffmann-La Roche AG, Basel, Switzerland), 2.5 µl 2 µM (bacterial and fungal) forward and reverse primers, and the rest volume were supplemented by MilliQ-purified water. The resulting PCR products were purified using AMPure XP beads (Beckman Coulter, High Wycombe, UK) according to the manufacturer’s instructions. The purified PCR products were then used as template DNA in the second PCR. The second PCR was performed similarly to the aforementioned but using primers from the Illumina Nextera Index Kit v2 that contain an error-tolerant 6-mer barcode to allow multiplexed library sequencing. The resulting PCR products were then cleaned-up again using AMPure XP beads. The two-step PCR were processed on a thermocycler (Hybaid, Ashford, UK) with cycling conditions as described in Table S 8 . The cleaned-up PCR products were quantified using Qubit dsDNA BR Assay Kit and Qubit Flex Fluorometer. Equal amounts of PCR product (2 µl 4 nM) were pooled and sequenced on an Illumina MiSeq Sequencer (Illumina, San Diego, USA) using a paired-end 300bp V3 kit at Utrecht Sequencing Facility ( www.useq.nl ).

Isolation of hyphae-adhering bacteria

In Experiment I, we sampled hyphae from microcosms with Prunella vulgaris (henceforth Prunella ) plants. Here, we used two strategies to isolate AM-associated bacteria from those hyphal samples. The first strategy was to place hyphae on agar plates directly and let the bacteria attached to the hyphae grow. Briefly, concentrated hyphal samples stored in − 80 ℃ were thawed at room temperature. In a sterile laminar flow cabinet, the hyphae were gently rinsed in a sterile 3.5% Na 4 P 2 O 7 solution to disaggregate small soil particles [ 20 ], then rinsed twice with sterile 0.9% saline water in a 2-ml tube, and subsequently transferred to a sterile petri-dish with sterile saline water. From there, single hyphal strands were picked from the saline water onto an agar plate using sterile tweezers. A maximum of eight hyphae were placed evenly distributed on a single agar plate (Fig. S 5 A, B, C, D).

The second strategy was to suspend hypha-adhering bacteria in solutions and culture serial diluted solutions on agar plates. Briefly, the hyphae were concentrated, gently rinsed by a sterile 3.5% Na 4 P 2 O 7 solution and saline water as described above. Rinsed hyphal samples were transferred to 900 µl sterile 0.9% saline water, followed by rigorous shaking for 40s at 5.5 m/s in a Tissuelyser II (Qiagen, Hilden, Germany). Serial dilutions of these samples were then plated on agar-solidified culture media (Fig. S 5 E, F). In both of the above strategies, seven distinct agar-solidified media were used to culture hyphae-adhering bacteria (Table S 9 ). Single bacterial colonies were picked after 3–21 days of incubation at 28 ℃ and streaked on ISP2 agar medium (Yeast extract, 4 g/l; Malt extract, 10 g/l; Dextrose, 4 g/l; Agar, 20 g/l; pH = 7.2). After 3–7 days of incubation at 28 ℃, isolates were examined for purity, and overnight cultures of single colonies in medium at 28 ℃ were stored in 25% glycerol at − 80 ℃ for future use.

Characterization of bacterial isolates and mapping to ASVs

To characterize the bacterial isolates, we used a pipette tip to transfer a single colony growing on ISP2 medium to 50 µl of sterile water. The bacterial suspension was then incubated at 95 ℃ for 15 min and immediately cooled on ice. Subsequently, the bacterial lysate was centrifuged at 10,000 × g for 1 min to remove cell debris. Two microliters of supernatant were taken as DNA template to amplify the 16S rRNA gene using 2.5 µl 27F and 2.5 µl 1492R primers [ 72 ], complemented with 1 µl dNTP, 1 µl Dreamtap polymerase (Thermo Scientific), 5 µl 10 × Dreamtap buffer (Thermo Scientific), and 36 µl H 2 O. The PCR reaction was processed on a thermocycler (Hybaid, Ashford, UK) with the cycling conditions in Table S 10 . PCR products were sequenced at Macrogen Europe (Amsterdam, the Netherlands). The 16S rRNA sequence were processed with MEGA 10.2.0 [ 73 ] and submitted to EzBioCloud 16S database [ 74 ] for taxonomy identification. We then mapped the 16S rRNA sequence of the isolates hyphosphere and bulk soil bacterial ASVs using VSEARCH [ 75 ] at 99% sequence similarity.

Screening of mycorrhiza-associated bacteria for impact on plant growth

Prunella seeds were vapor-phase sterilized by exposure to chlorine gas for 4 h. The seeds were sown on agar-solidified half-strength Murashige and Skoog basal medium (Sigma-Aldrich, St. Louis, MO, USA), with maximally 10 seeds per square Petri Dish (120 × 120 mm, Greiner). Seeds were allowed to germinate and develop in a climate chamber under controlled conditions (short-day: 10 h light/14 h dark, 22 °C). Two-week-old seedlings with roots of approximately ~ 0.5 cm in length that were free of visible contaminations were used in our experiment.

River sand was autoclaved twice at 121 ℃ for 45 min and mixed thoroughly with OS in a ratio of 4:1 (w/w). Devosia sp. ZB163 (HB1), Bosea sp. ZB026(HB2), Sphingopyxis sp. ZB004 (HB3), Achromobacter sp. ZB019 (HB4), and Microbacterium ZB113 (HB5), Arthobacter sp. ZB074 (SB1), Streptomyces sp. ZB117 (SB2), and Pseudomonas sp. ZB042 (SB3) were streaked on ISP2 media and incubated at 28 ℃ for 3 days. A single bacterial colony was then suspended with a loop in 50 µl 10 mM MgSO 4 , spread over a Petri-dish with ISP2 agar-solidified medium, and incubated at 28 ℃ overnight until the bacterial growth covered the full plate. Subsequently, 10 ml of 10 mM MgSO 4 was added to the plates and the bacteria were suspended with a sterile spatula. The suspension was then collected in a 15-ml Greiner tube followed by a double round of centrifugation and resuspension of the pellet in 10 ml 10 mM MgSO 4 . Finally, the suspensions of bacterial isolates were mixed through the sand/soil mixture to a final density of 3 × 10 7 CFU/g of soil. Moreover, we inoculated a SynCom of 5 HB and a SynCom of 3 SB, both inoculated at a total density of 3 × 10 7 CFU/g of soil. Soil for the control treatments received an equal amount of sterile 10mM MgSO 4 . For each treatment, we filled 11 replicate 60-ml pots, resulting in a total of 110 pots (10 treatments × 11 replicates). One P . vulgaris seedling was sown in each pot and plants were grown in a greenhouse for 9 weeks with 16 h light/8 h dark at 22 °C. Each pot received 10 to 15 ml of water three times a week. For the last 3 weeks, each plant was supplied with 15 ml of ½ strength Hoagland (Table S 5 ) solution once a week.

Shoots were cut at the soil surface, lyophilized, and weighted. Plant roots were removed from the soil and rinsed in sterile water. A 1-cm-long fragment of rinsed root was cut, weighted, and stored in 50% ethanol for mycorrhizal root colonization analysis. The colonization of mycorrhizae on plant roots was evaluated using the method outlined previously.

Propagation of AM fungi for pot experiments studying the impact of hyphal associated bacteria on plant growth

We cultured Ri T-DNA-transformed carrot root organs on one side of a two-compartment petri dish at 26 °C for 2 weeks and then inoculated the organs with spores of Rhizophagus irregularis MUCL43194 [ 76 ]. The root compartments were filled with modified Strullu and Romand (MSR; Duchefa Biochemie, NL) medium supplemented with 1% sucrose and the hyphal compartment were filled with MSR medium (Table S 11 ). R . irregularis then was left to colonize the root organs for 3 months during which R . irregularis mycelium colonized the hyphal compartment of the Petri-dish and formed spores. R . irregularis spores were harvested by chopping the agar-solidified medium of the hyphal compartment into small pieces using a sterile scalpel and subsequently dissolving the medium in a sterile citrate buffer (Citric acid, 0.3456 g/L; Sodium citrate, 2.4108 g/L). Thousands of R . irregularis spores in citrate buffer were then transferred to sterile 1.5-ml Eppendorf tubes in 500-µl aliquots and stored at 4 °C.

Impact of Devosia sp. ZB163 and AM fungi on plant growth

Organic soil-sand mixture was autoclaved twice to remove the indigenous microbiota and was inoculated with Devosia sp. ZB163 in 10 mM MgSO 4 at a density of 3 × 10 7 CFU/g of soil ( Devosia treatment) or an equal volume of 10 mM MgSO 4 as mock control. Two-week-old Prunella seedlings were transplanted into 60-ml pots filled with both soil treatments. Half of the pots received 100 R . irregularis spores immediately prior to seedling transplantation (AM treatment). Eleven replicate pots were prepared for each of the 4 treatments (Control, Devosia , AM, and Devosia & AM) resulting in a total of 44 pots. Plants were allowed to grow under climate-controlled conditions at a light intensity of 200 µE/m 2 /s with a 16 h photoperiod for 8 weeks at 22 °C. Each pot received 10 to 15 ml of water three times a week. To determine the effect of N and P availability on plant growth, we conducted a complementary experiment with the same four treatments and 20 biological replicates, resulting in a total of 80 pots. Moreover, the plants were watered when appropriate, and for the experiment shown in Fig.  7 , plants were supplied with 5 ml modified Hoagland solution without N or P (Table S 5 ) once per week from week 6 onwards. Following the 8th week of cultivation, shoot weight, root weight, and mycorrhization were assessed as described above.

N and P accumulation in plant leaves

Lyophilized Prunella leaves were first ground to powder. To determine P content, approximately 50 mg of powdered leaves were digested in 1ml HCl/HNO 3 mixture (4:1, v/v) in a closed Teflon cylinder for 6 h at 140 ℃. The P concentrations were determined colorimetrically using a Shimadzu UV-1601PC spectrophotometer [ 77 ]. The N concentrations were determined by dry combustion of a 3–4 mg sample with a Flash EA1112 elemental analyzer (Thermo Scientific, Rodano, Italy).

Absolute quantification of Devosia sp. ZB163 on plant roots

To quantify the absolute abundance of Devosia sp. ZB163 on plant roots, we spiked root samples with 14ng DNA of Salinibacter ruber , an extremely halophilic bacterium that exists in hypersaline environments [ 40 ], but does not occur in our soil samples. Subsequently, the DNA of the root samples was extracted using the DNeasy PowerLyzer PowerSoil Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. The 16S rRNA gene V3-V4 region was amplified following a two-step PCR using the primers 341F and 806R [ 69 ] and barcoding primers [ 78 ]. The amplified DNA was cleaned-up, quantified, normalized, pooled, and subsequently sequenced on the Novaseq 6000 SP platform (2 × 250 bp) by Genome Quebec (Montreal, Canada). The raw sequencing data were demultiplexed, trimmed, dereplicated, and filtered for chimeras by DADA2 [ 79 ] in the QIIME2 environment (version 2019.07, https://qiime2.org/ ) [ 80 ]. Amplicon sequence variants (ASVs) were generated and annotated against the SILVA reference database (v132) [ 81 ]. ASVs assigned to mitochondria and chloroplast were removed. Since ASVs that are present in only a few samples may represent PCR or sequencing errors, we removed the ASVs that were present in ≤ 4 samples. Filtered ASV counts were constructed into an ASV table. The absolute abundance amount of detected Devosia sp. ZB163 DNA using the following formula.

Devosia genome sequencing

Devosia sp. ZB163 was cultured on ISP2 medium for 7 days at 28 ℃. DNA was extracted from a loop of bacterial cells using the MagAttract Microbial DNA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. The extracted DNA was amplified following the Hackflex protocol [ 82 ] followed by DNA purification using the AMPure XP clean-up (Beckman Coulter, High Wycombe, UK). The purified DNA was sequenced with Novaseq 6000 SP platform (2 × 250 bp) by Genome Quebec (Montreal, Canada). The raw sequencing data were trimmed with Cutadapt. Quality checked and assembly was performed using the A5-miseq pipeline [ 83 ].

Genome analysis

Devosia sp. ZB163’s genome was annotated using prokka [ 84 ] and RAST [ 85 ]. Mining for orthologs of genes in the genomes of Devosia was performed using reciprocal BLASTp analysis. Genes were considered orthologs when the e-value was smaller than 10 −5 . Moreover, the whole Devosia genome was blasted against a nifH database [ 86 ] formatted for the dada2 pipeline [ 87 ].

Bioinformatics

Sequence reads were processed in the Qiime2 environment (version 2019.07, https://qiime2.org/ ) [ 80 ]. We used the Demux plugin to assess paired-end sequence quality. The imported primer sequences were removed using Cutadapt [ 88 ]. The paired-end sequences were dereplicated and chimeras were filtered using the Dada2 denoise-paired script [ 79 ], which resulted in the identification of ASVs and a count table thereof. Fungal ITS2 sequences were further processed by filtering nonfungal sequences using ITSx [ 89 ]. 16S and ITS2 ASVs were taxonomically annotated employing a pre-trained naive Bayes classifier [ 90 ] against the SILVA (v132) [ 81 ] and UNITE (v8) [ 91 ] database, respectively. From this taxonomic annotation, 16S ASVs assigned as mitochondria and chloroplast were removed.

Statistical analysis

All statistical analyses were conducted in R version 4.0.2 [ 92 ]. All bioinformatic files generated by Qiime2 were imported to R with Qiime2R [ 93 ]. Bray–Curtis distances were calculated by and visualized in principal coordinate analysis (PCoA) using the Phyloseq package [ 94 ]. Pairwise permutational analysis of variance (PERMANOVA) was performed using Adonis function in the Vegan package with 9999 permutations [ 95 ]. The visualization of microbial taxonomy and differentially abundant ASVs between sample types used ggplot2 [ 96 ] and Complex Heatmap package [ 97 ]. ASVs that are positively associated with hyphosphere, or soil microbiome were identified by R package indicspecies [ 37 ] and considered robustly enriched if their abundance was significantly higher in hyphal samples than both roots and soil samples as determined by one-way analysis of variance (ANOVA). The effect of microbial treatments on plant weight, AM fungi colonization rate, and plant nutrient uptake was assessed by one-way ANOVA and followed by the Tukey HSD test. Absolute abundance of Devosia sp. ZB163 was assessed for variation among treatments by ANOVA and followed by a Tukey HSD test. The correlation between Devosia sp. ZB163 absolute abundance and plant weight, AM fungi colonization, and plant nutrient uptake were assessed by simple linear regression.

Availability of data and materials

The raw sequencing data of Devosia genome are deposited at the National Center for Biotechnology Information, GenBank database ( https://www.ncbi.nlm.nih.gov/genbank/ ) by the accession PRJNA931835. The raw sequencing data of the amplicon reads are deposited at the European Nucleotide Archive ( http://www.ebi.ac.uk/ena ) by the study PRJEB59555.

Change history

19 february 2024.

A Correction to this paper has been published: https://doi.org/10.1186/s40168-024-01776-2

Strullu-Derrien C, Selosse MA, Kenrick P, Martin FM. The origin and evolution of mycorrhizal symbioses: from palaeomycology to phylogenomics. New Phytol. 2018;220:1012–30.

Article   PubMed   Google Scholar  

Brundrett M. Diversity and classification of mycorrhizal associations. Biol Rev. 2004;79:473–95.

Chowdhury S, Lange M, Malik AA, Goodall T, Huang J, Griffiths RI, Gleixner G. Plants with arbuscular mycorrhizal fungi efficiently acquire Nitrogen from substrate additions by shaping the decomposer community composition and their net plant carbon demand. Plant Soil. 2022;475:473–90.

Article   CAS   Google Scholar  

Drigo B, Pijl AS, Duyts H, Kielak AM, Gamper HA, Houtekamer MJ, Boschker HTS, Bodelier PLE, Whiteley AS, Veen JAv, Kowalchuk GA. Shifting carbon flow from roots into associated microbial communities in response to elevated atmospheric CO 2 . Proc Natl Acad Sci USA. 2010;107:10938–42.

Article   CAS   PubMed   PubMed Central   Google Scholar  

Govindarajulu M, Pfeffer PE, Jin H, Abubaker J, Douds DD, Allen JW, Bücking H, Lammers PJ, Shachar-Hill Y. Nitrogen transfer in the arbuscular mycorrhizal symbiosis. Nature. 2005;435:819–23.

Article   CAS   PubMed   Google Scholar  

Nuccio EE, Hodge A, Pett-Ridge J, Herman DJ, Weber PK, Firestone MK. An arbuscular mycorrhizal fungus significantly modifies the soil bacterial community and nitrogen cycling during litter decomposition. Environ Microbiol. 2013;15:1870–81.

Pfeffer PE, Douds DD Jr, Bécard G, Shachar-Hill Y. Carbon uptake and the metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiol. 1999;120:587–98.

Zhang L, Xu M, Liu Y, Zhang F, Hodge A, Feng G. Carbon and phosphorus exchange may enable cooperation between an arbuscular mycorrhizal fungus and a phosphate-solubilizing bacterium. New Phytol. 2016;210:1022–32.

van der Heijden MGA, Martin FM, Selosse MA, Sanders IR. Mycorrhizal ecology and evolution: the past, the present, and the future. New Phytol. 2015;205:1406–23.

Cosme M. Mycorrhizas drive the evolution of plant adaptation to drought. Commun Biol. 2023;6:346.

Article   PubMed   PubMed Central   Google Scholar  

Berendsen RL, Pieterse CMJ, Bakker PAHM. The rhizosphere microbiome and plant health. Trends Plant Sci. 2012;17:478–86.

Zhang L, Zhou J, George TS, Limpens E, Feng G. Arbuscular mycorrhizal fungi conducting the hyphosphere bacterial orchestra. Trends plant sci. 2021;27(4):402–11.

Pieterse CMJ, de Jonge R, Berendsen RL. The soil-borne supremacy. Trends Plant Sci. 2016;21:171–3.

Sasse J, Martinoia E, Northen T. Feed your friends: do plant exudates shape the root microbiome? Trends Plant Sci. 2018;23:25–41.

Cosme M, Fernández I, Declerck S, van der Heijden MGA, Pieterse CMJ. A coumarin exudation pathway mitigates arbuscular mycorrhizal incompatibility in Arabidopsis thaliana. Plant Mol Biol. 2021;106:319–34.

Toljander JF, Lindahl BD, Paul LR, Elfstrand M, Finlay RD. Influence of arbuscular mycorrhizal mycelial exudates on soil bacterial growth and community structure. FEMS Microbiol Ecol. 2007;61:295–304.

Filion M, St-Arnaud M, Fortin J. Direct interaction between the arbuscular mycorrhizal fungus Glomus intraradices and different rhizosphere microorganisms. New Phytol. 1999;141:525–33.

Article   Google Scholar  

Hartman K, Schmid MW, Bodenhausen N, Bender SF, Valzano-Held AY, Schlaeppi K, van der Heijden MGA. A symbiotic footprint in the plant root microbiome. Environ Microbiome. 2023;18(1):65.

Linderman R. Mycorrhizal interactions in the rhizosphere. In The Rhizosphere and Plant Growth: Papers presented at a Symposium held May 8–11, 1989, at the Beltsville Agricultural Research Center (BARC). Maryland: Springer; 1991. p. 343–8.

Book   Google Scholar  

Scheublin TR, Sanders IR, Keel C, Van Der Meer JR. Characterisation of microbial communities colonising the hyphal surfaces of arbuscular mycorrhizal fungi. ISME J. 2010;4:752–63.

Toljander JF, Artursson V, Paul LR, Jansson JK, Finlay RD. Attachment of different soil bacteria to arbuscular mycorrhizal fungal extraradical hyphae is determined by hyphal vitality and fungal species. FEMS Microbiol Lett. 2006;254:34–40.

Emmett BD, Lévesque-Tremblay V, Harrison MJ. Conserved and reproducible bacterial communities associate with extraradical hyphae of arbuscular mycorrhizal fungi. ISME J. 2021;15:2276–88.

Zhang L, Shi N, Fan J, Wang F, George TS, Feng G. Arbuscular mycorrhizal fungi stimulate organic phosphate mobilization associated with changing bacterial community structure under field conditions. Environ Microbiol. 2018;20:2639–51.

Nuccio EE, Blazewicz SJ, Lafler M, Campbell AN, Kakouridis A, Kimbrel JA, Wollard J, Vyshenska D, Riley R, Tomatsu A. HT-SIP: a semi-automated stable isotope probing pipeline identifies cross-kingdom interactions in the hyphosphere of arbuscular mycorrhizal fungi. Microbiome. 2022;10:1–20.

Li X, Zhao R, Li D, Wang G, Bei S, Ju X, An R, Li L, Kuyper TW, Christie P, et al. Mycorrhiza-mediated recruitment of complete denitrifying Pseudomonas reduces N2O emissions from soil. Microbiome. 2023;11:45.

Svenningsen NB, Watts-Williams SJ, Joner EJ, Battini F, Efthymiou A, Cruz-Paredes C, Nybroe O, Jakobsen I. Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota. ISME J. 2018;12:1296–307.

Frey-Klett P, Garbaye J, Tarkka M. The mycorrhiza helper bacteria revisited. New Phytol. 2007;176:22–36.

Roesti D, Ineichen K, Braissant O, Redecker D, Wiemken A, Aragno M. Bacteria associated with spores of the arbuscular mycorrhizal fungi Glomus geosporum and Glomus constrictum . Appl Environ Microbiol. 2005;71:6673–9.

Xavier LJC, Germida JJ. Bacteria associated with Glomus clarum spores influence mycorrhizal activity. Soil Biol Biochem. 2003;35:471–8.

Toro M, Azcon R, Barea J. Improvement of arbuscular mycorrhiza development by inoculation of soil with phosphate-solubilizing rhizobacteria to improve rock phosphate bioavailability ((sup32)P) and nutrient cycling. Appl Environ Microbiol. 1997;63:4408–12.

Geiger F, Bengtsson J, Berendse F, Weisser WW, Emmerson M, Morales MB, Ceryngier P, Liira J, Tscharntke T, Winqvist C. Persistent negative effects of pesticides on biodiversity and biological control potential on European farmland. Basic Appl Ecol. 2010;11:97–105.

Thiele-Bruhn S, Bloem J, de Vries FT, Kalbitz K, Wagg C. Linking soil biodiversity and agricultural soil management. Current Opinion in Environmental Sustainability. 2012;4:523–8.

Hole DG, Perkins AJ, Wilson JD, Alexander IH, Grice PV, Evans AD. Does organic farming benefit biodiversity? Biol Cons. 2005;122:113–30.

Banerjee S, Walder F, Büchi L, Meyer M, Held AY, Gattinger A, Keller T, Charles R, van der Heijden MGA. Agricultural intensification reduces microbial network complexity and the abundance of keystone taxa in roots. ISME J. 2019;13:1722–36.

Wittwer RA, Franz Bender S, Hartman K, Hydbom S, Lima RAA, Loaiza V, Nemecek T, Oehl F, Axel Olsson P, Petchey O, et al. Organic and conservation agriculture promote ecosystem multifunctionality. Science Advance. 2021;7:6995.

Google Scholar  

Hartman K, van der Heijden MGA, Wittwer RA, Banerjee S, Walser JC, Schlaeppi K. Cropping practices manipulate abundance patterns of root and soil microbiome members paving the way to smart farming. Microbiome. 2018;6:14.

Cáceres MD, Legendre P. Associations between species and groups of sites: indices and statistical inference. Ecology. 2009;90:3566–74.

Rivas R, Velázquez E, Willems A, Vizcaíno N, Subba-Rao NS, Mateos PF, Gillis M, Dazzo FB, Martínez-Molina E. A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (Lf) Druce. Appl Environ Microbiol. 2002;68:5217–22.

George E, Marschner H, Jakobsen I. Role of arbuscular mycorrhizal fungi in uptake of phosphorus and nitrogen from soil. Crit Rev Biotechnol. 1995;15:257–70.

Stämmler F, Gläsner J, Hiergeist A, Holler E, Weber D, Oefner PJ, Gessner A, Spang R. Adjusting microbiome profiles for differences in microbial load by spike-in bacteria. Microbiome. 2016;4:28.

Masterson RV, Prakash RK, Atherly AG. Conservation of symbiotic nitrogen fixation gene sequences in Rhizobium japonicum and Bradyrhizobium japonicum . J Bacteriol. 1985;163:21–6.

Roberts GP, MacNeil T, MacNeil D, Brill WJ. Regulation and characterization of protein products coded by the nif (nitrogen fixation) genes of Klebsiella pneumoniae . J Bacteriol. 1978;136:267–79.

Schlüter J-P, Reinkensmeier J, Daschkey S, Evguenieva-Hackenberg E, Janssen S, Jänicke S, Becker JD, Giegerich R, Becker A. A genome-wide survey of sRNAs in the symbiotic nitrogen-fixing alpha-proteobacterium Sinorhizobium meliloti . BMC Genomics. 2010;11:1–35.

Dos Santos PC, Fang Z, Mason SW, Setubal JC, Dixon R. Distribution of nitrogen fixation and nitrogenase-like sequences amongst microbial genomes. BMC Genomics. 2012;13:1–12.

Lin F, Wu Y, Ding Z, Zhou Z, Lin X, Majrashi A, Eissa MA, Ali EF. Effect of two urea forms and organic fertilizer derived from expired milk products on dynamic of NH 3 emissions and growth of Williams Banana. Agronomy. 2021;11:1113–1113.

Chhetri G, Kim I, Kang M, Kim J, So Y, Seo T. Devosia rhizoryzae sp. nov., and Devosia oryziradicis sp. nov., novel plant growth promoting members of the genus Devosia, isolated from the rhizosphere of rice plants. J Microbiol. 2022;60:1–10.

Amoo AE, Babalola OO. Ammonia-oxidizing microorganisms: key players in the promotion of plant growth. J Soil Sci Plant Nutr. 2017;17:935–47.

Jakobsen I, Rosendahl L. Carbon flow into soil and external hyphae from roots of mycorrhizal cucumber plants. New Phytol. 1990;115:77–83.

Pearson JN, Jakobsenf I. Symbiotic exchange of carbon and phosphorus between cucumber and three arbuscular mycorrhizal fungi. New PhytoL. 1993;124:481–8.

Wang L, Zhang L, George TS, Feng G. A core microbiome in the hyphosphere of arbuscular mycorrhizal fungi has functional significance in organic phosphorus mineralization. New Phytol. 2023;238:859–73.

Petters S, Groß V, Söllinger A, Pichler M, Reinhard A, Bengtsson MM, Urich T. The soil microbial food web revisited: predatory myxobacteria as keystone taxa? ISME J. 2021;15:2665–75.

Lévesque V, Rochette P, Hogue R, Jeanne T, Ziadi N, Chantigny MH, Dorais M, Antoun H. Greenhouse gas emissions and soil bacterial community as affected by biochar amendments after periodic mineral fertilizer applications. Biol Fertil Soils. 2020;56:907–25.

Uddin M, Chen J, Qiao X, Tian R, Arafat Y, Yang X. Bacterial community variations in paddy soils induced by application of veterinary antibiotics in plant-soil systems. Ecotoxicol Environ Saf. 2019;167:44–53.

Qiu M, Zhang R, Xue C, Zhang S, Li S, Zhang N, Shen Q. Application of bio-organic fertilizer can control Fusarium wilt of cucumber plants by regulating microbial community of rhizosphere soil. Biol Fertil Soils. 2012;48:807–16.

Vosátka M, Gryndler M. Treatment with culture fractions from Pseudomonas putida modifies the development of Glomus fistulosum mycorrhiza and the response of potato and maize plants to inoculation. Appl Soil Ecol. 1999;11:245–51.

Cosme M, Wurst S. Interactions between arbuscular mycorrhizal fungi, rhizobacteria, soil phosphorus and plant cytokinin deficiency change the root morphology, yield and quality of tobacco. Soil Biol Biochem. 2013;57:436–43.

Kohlmeier S, Smits THM, Ford RM, Keel C, Harms H, Wick LY. Taking the fungal highway: mobilization of pollutant-degrading bacteria by fungi. Environ Sci Technol. 2005;39:4640–6.

Liou JSC, Madsen EL. Microbial ecological processes: aerobic/anaerobic. Encyclopedia Ecol. 2008;1:2348–57.

Leghari SJ, Wahocho NA, Laghari GM, HafeezLaghari A, MustafaBhabhan G, HussainTalpur K, Bhutto TA, Wahocho SA, Lashari AA. Role of nitrogen for plant growth and development: a review. Adv Environ Biol. 2016;10:209–19.

Smith SE, Read DJ. Mycorrhizal symbiosis. Cambridge: Academic press; 2010.

Smith SE, Smith FA. Roles of arbuscular mycorrhizas in plant nutrition and growth: new paradigms from cellular to ecosystem scales. Annu Rev Plant Biol. 2011;62:227–50.

López-Pedrosa A, González-Guerrero M, Valderas A, Azcón-Aguilar C, Ferrol N. GintAMT1 encodes a functional high-affinity ammonium transporter that is expressed in the extraradical mycelium of Glomus intraradices. Fungal Genet Biol. 2006;43:102–10.

Desiro A, Salvioli A, Ngonkeu EL, Mondo SJ, Epis S, Faccio A, Kaech A, Pawlowska TE, Bonfante P. Detection of a novel intracellular microbiome hosted in arbuscular mycorrhizal fungi. ISME J. 2014;8:257–70.

Bertrand H, Plassard C, Pinochet X, Touraine B, Normand P, Cleyet-Marel JC. Stimulation of the ionic transport system in Brassica napus by a plant growth-promoting rhizobacterium (Achromobacter sp.). Can J Microbiol. 2000;46:229–36.

Vierheilig H, Coughlan AP, Wyss U, Piché Y. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol. 1998;64:5004–7.

McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA. A new method which gives an objective measure of colonization of roots by vesicular—arbuscular mycorrhizal fungi. New Phytol. 1990;115:495–501.

Pacioni G. 16 Wet-sieving and decanting techniques for the extraction of spores of vesicular-arbuscular fungi. Methods Microbiol. 1992;24:317–22.

Wagg C, Bender SF, Widmer F, Van Der Heijden MGA. Soil biodiversity and soil community composition determine ecosystem multifunctionality. Proc Natl Acad Sci USA. 2014;111:5266–70.

Herlemann DPR, Labrenz M, Jürgens K, Bertilsson S, Waniek JJ, Andersson AF. Transitions in bacterial communities along the 2000 km salinity gradient of the Baltic Sea. ISME J. 2011;5:1571–9.

Gao C, Montoya L, Xu L, Madera M, Hollingsworth J, Purdom E, Hutmacher RB, Dahlberg JA, Coleman-Derr D, Lemaux PG. Strong succession in arbuscular mycorrhizal fungal communities. ISME J. 2019;13:214–26.

Taylor DL, Walters WA, Lennon NJ, Bochicchio J, Krohn A, Caporaso JG, Pennanen T. Accurate estimation of fungal diversity and abundance through improved lineage-specific primers optimized for Illumina amplicon sequencing. Appl Environ Microbiol. 2016;82:7217–26.

Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol. 2008;74:2461–70.

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547.

Yoon S-H, Ha S-M, Kwon S, Lim J, Kim Y, Seo H, Chun J. Introducing EzBioCloud: a taxonomically united database of 16S rRNA gene sequences and whole-genome assemblies. Int J Syst Evol Microbiol. 2017;67:1613.

Rognes T, Flouri T, Nichols B, Quince C, Mahé F. VSEARCH: A versatile open source tool for metagenomics. PeerJ. 2016;2016:e2584–e2584.

Fortin JA, Bécard G, Declerck S, Dalpé Y, St-Arnaud M, Coughlan AP, Piché Y. Arbuscular mycorrhiza on root-organ cultures. Can J Bot. 2002;80:1–20.

Murphy J, Riley JP. A modified single solution method for the determination of phosphate in natural waters. Anal Chim Acta. 1962;27:31–6.

Baym M, Kryazhimskiy S, Lieberman TD, Chung H, Desai MM, Kishony R. Inexpensive multiplexed library preparation for megabase-sized genomes. PLoS ONE. 2015;10:e0128036.

Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:581–3.

Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37:852–7.

Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glöckner FO. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6.

Gaio D, Anantanawat K, To J, Liu M, Monahan L, Darling AE. Hackflex: Low-cost, high-throughput, Illumina Nextera Flex library construction. Microb Genom. 2022;8:000744.

CAS   PubMed   PubMed Central   Google Scholar  

Coil D, Jospin G, Darling AE. A5-miseq: An updated pipeline to assemble microbial genomes from Illumina MiSeq data. Bioinformatics. 2015;31:587–9.

Prokka ST. Rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9.

Aziz RK, Bartels D, Best A, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S, Glass EM, Kubal M, et al. The RAST Server: Rapid annotations using subsystems technology. BMC Genomics. 2008;9:75.

Heller P, Tripp HJ, Turk-Kubo K, Zehr JP. ARBitrator: a software pipeline for on-demand retrieval of auto-curated nifH sequences from GenBank. Bioinformatics. 2014;30:2883–90.

Moynihan MA. nifHdada2 GitHub repository. Zenodo. 2020. https://doi.org/10.5281/zenodo.3958370 .

Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet journal. 2011;17:10–2.

Bengtsson-Palme J, Ryberg M, Hartmann M, Branco S, Wang Z, Godhe A, De Wit P, Sánchez-García M, Ebersberger I, de Sousa F. Improved software detection and extraction of ITS1 and ITS 2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Methods Ecol Evol. 2013;4:914–9.

Werner JJ, Koren O, Hugenholtz P, Desantis TZ, Walters WA, Caporaso JG, Angenent LT, Knight R, Ley RE. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys. ISME J. 2012;6:94–103 Nature Publishing Group;

Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, Bahram M, Bates ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 2013;22:5271–7.

R Core Team. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. 2018. Retrieved from https://www.R-project.or .

Bisanz JE. qiime2R: Importing QIIME2 artifacts and associated data into R sessions. Version. 2018;099:13.

McMurdie PJ, Holmes S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE. 2013;8:e61217.

Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR. O’hara RB, Simpson GL, Solymos P, Stevens MHH, Wagner H. Community ecology package R package version. 2013;2:321–6.

Wickham, H, Winston C. "Package ‘ggplot2’." Create elegant data visualisations using the grammar of graphics. Version 2.1. 2016. p. 1–189.

Gu Z, Eils R, Schlesner M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics. 2016;32:2847–9.

Download references

Acknowledgements

We thank Utrecht Sequencing Facility for providing sequencing service and data. We are grateful to Dr. Claire E. Stanley from Imperial College London, for providing suggestions on hyphal bacteria isolation. We thank Richard van Logtestijn and Rob Broekman from Vrije Universiteit Amsterdam for determining the N and P concentrations on Prunella leaves. We also thank Gijs Selten from Universiteit Utrecht for assembling the Devosia genome.

This work was supported by China Scholarship Council (CSC201707720021), The Swiss National Science Foundation (grant 310030–188799), and by the Dutch Council (NWO) through the Gravitation program MiCRop (grant no. 908 024.004.014), and XL program and by the Dutch Research Council “Unwiring beneficial functions and regulatory networks in the plant endosphere” (grant no. OCE NW.GROOT.2019.063). M.C. was supported by the European Commission’s grant H2020-MSCA-IF-2018 “SYMBIO-INC” (GA 838525).

Author information

Authors and affiliations.

Plant-Microbe Interactions, Department of Biology, Faculty of Science, Utrecht University, Padualaan 8, 3584 CH, Utrecht, the Netherlands

Changfeng Zhang, Marcel G. A. van der Heijden, Bethany K. Dodds, Thi Bich Nguyen, Jelle Spooren & Roeland L. Berendsen

Plant Soil Interactions, Division Agroecology and Environment, Agroscope, Reckenholzstrasse 191, CH-8046, Zürich, Switzerland

Changfeng Zhang, Marcel G. A. van der Heijden & Alain Valzano-Held

Department of Plant and Microbial Biology, University of Zurich, Zollikerstrasse 107, CH-8008, Zurich, Switzerland

Marcel G. A. van der Heijden

Mycology, Earth and Life Institute, Université Catholique de Louvain, Louvain-La-Neuve, Belgium

Marco Cosme

Plants and Ecosystems, Biology Department, University of Antwerp, Antwerp, Belgium

You can also search for this author in PubMed   Google Scholar

Contributions

M.G.A.v.d.H. initiated the research. C.Z., R.L.B., and M.G.A.v.d.H. conceived and designed the experiments. C.Z., B.K.D., and T.B.N. collected the samples and performed the greenhouse experiments. C.Z., B.K.D., T.B.N., and J.S. isolated DNA from the collected samples and prepared the DNA libraries. C.Z. and A.H. isolated bacteria from fungal hyphae. C.Z. and T.B.N. identified the bacteria taxa. M.R.C. cultured the monoxenic mycorrhiza spores and provided suggestions for mycorrhiza inoculation. C.Z. analyzed the data. C.Z., M.G.A.v.d.H., M.C., and R.L.B. wrote the manuscript.

Corresponding author

Correspondence to Roeland L. Berendsen .

Ethics declarations

Ethics approval and consent to participate.

Not applicable.

Consent for publication

Competing interests.

The authors declare no competing interests.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

The original article has been updated: Figures 5 to 8 have been updated to correct the typographical error.

Supplementary Information

Additional file 1. .

Overview of the 144 bacteria isolated from hyphal samples. This file contains Unique ID, taxonomy, FASTA sequence of the hyphal bacterial isolates.  Fig. S1. Effects of field management practices on soil microbial communities in Experiment I. Fig. S2. Photo of root colonization in COMP3 of a representative mesocosm at the end of Experiment II. Fig. S3. Effects of field management practices on soil microbial communities in Experiment I. Fig. S4. Bacterial ASVs with significantly different abundance between hyphal and soil samples in Experiments I (A) and II (B). Fig. S5. Isolation of AM-associated microbes using two strategies.  Fig. S6. Pearson’s correlation between AM fungi root colonization (%) and plant P accumulation. Fig. S7. Schematic representation of the wet sieving protocol used to sample hyphae from COMP 5 as described in the Methods section. Fig. S8. Stereo microspore images of AM hyphae. Table S1. Effect of sample type on fungal and bacterial communities of experiment I. Table S2. Effect of preceding soil management practices in the FAST experiment on microbial communities of root, hyphal and soils samples at the end of experiment I. Table S3. Effect of the presence of plant on soil microbial communities. Table S4. Effect of sample type on fungal and bacterial communities of experiment II. Table S5. Hoagland solution ingredients. Table S6. Overview of microbial genes involved in N metabolism for which orthologs were putatively found in the genome of Devosia sp. ZB163. Table S7. Primers used for amplification of microbial ITS and 16S. Table S8. Two step PCR cycling conditions for amplifying ITS, 16S. Table S9. AM-associated bacteria isolation media. Table S10. PCR cycling conditions for amplifying 16S. Table S11. Modified Strullu and Romand (MSR) medium supplemented with 1% sucrose.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ . The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/ ) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Cite this article.

Zhang, C., van der Heijden, M.G.A., Dodds, B.K. et al. A tripartite bacterial-fungal-plant symbiosis in the mycorrhiza-shaped microbiome drives plant growth and mycorrhization. Microbiome 12 , 13 (2024). https://doi.org/10.1186/s40168-023-01726-4

Download citation

Received : 19 July 2023

Accepted : 18 November 2023

Published : 19 January 2024

DOI : https://doi.org/10.1186/s40168-023-01726-4

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Arbuscular mycorrhiza fungi
• Plant microbiome
• Organic farming
• Mycorrhization
• Nitrogen uptake
• Plant growth

ISSN: 2049-2618

• General enquiries: [email protected]

The Social Life of Forests

By Ferris Jabr Dec. 2, 2020

• Share full article

Trees appear to communicate and cooperate through subterranean networks of fungi. What are they sharing with one another?

By Ferris Jabr Photographs by Brendan George Ko

As a child, Suzanne Simard often roamed Canada’s old-growth forests with her siblings, building forts from fallen branches, foraging mushrooms and huckleberries and occasionally eating handfuls of dirt (she liked the taste). Her grandfather and uncles, meanwhile, worked nearby as horse loggers, using low-impact methods to selectively harvest cedar, Douglas fir and white pine. They took so few trees that Simard never noticed much of a difference. The forest seemed ageless and infinite, pillared with conifers, jeweled with raindrops and brimming with ferns and fairy bells. She experienced it as “nature in the raw” — a mythic realm, perfect as it was. When she began attending the University of British Columbia, she was elated to discover forestry: an entire field of science devoted to her beloved domain. It seemed like the natural choice.

Listen to This Article

By the time she was in grad school at Oregon State University, however, Simard understood that commercial clearcutting had largely superseded the sustainable logging practices of the past. Loggers were replacing diverse forests with homogeneous plantations, evenly spaced in upturned soil stripped of most underbrush. Without any competitors, the thinking went, the newly planted trees would thrive. Instead, they were frequently more vulnerable to disease and climatic stress than trees in old-growth forests. In particular, Simard noticed that up to 10 percent of newly planted Douglas fir were likely to get sick and die whenever nearby aspen, paper birch and cottonwood were removed. The reasons were unclear. The planted saplings had plenty of space, and they received more light and water than trees in old, dense forests. So why were they so frail?

Simard suspected that the answer was buried in the soil. Underground, trees and fungi form partnerships known as mycorrhizas: Threadlike fungi envelop and fuse with tree roots, helping them extract water and nutrients like phosphorus and nitrogen in exchange for some of the carbon-rich sugars the trees make through photosynthesis. Research had demonstrated that mycorrhizas also connected plants to one another and that these associations might be ecologically important, but most scientists had studied them in greenhouses and laboratories, not in the wild. For her doctoral thesis, Simard decided to investigate fungal links between Douglas fir and paper birch in the forests of British Columbia. Apart from her supervisor, she didn’t receive much encouragement from her mostly male peers. “The old foresters were like, Why don’t you just study growth and yield?” Simard told me. “I was more interested in how these plants interact. They thought it was all very girlie.”

Now a professor of forest ecology at the University of British Columbia, Simard, who is 60, has studied webs of root and fungi in the Arctic, temperate and coastal forests of North America for nearly three decades. Her initial inklings about the importance of mycorrhizal networks were prescient, inspiring whole new lines of research that ultimately overturned longstanding misconceptions about forest ecosystems. By analyzing the DNA in root tips and tracing the movement of molecules through underground conduits, Simard has discovered that fungal threads link nearly every tree in a forest — even trees of different species. Carbon, water, nutrients, alarm signals and hormones can pass from tree to tree through these subterranean circuits. Resources tend to flow from the oldest and biggest trees to the youngest and smallest. Chemical alarm signals generated by one tree prepare nearby trees for danger. Seedlings severed from the forest’s underground lifelines are much more likely to die than their networked counterparts. And if a tree is on the brink of death, it sometimes bequeaths a substantial share of its carbon to its neighbors.

Although Simard’s peers were skeptical and sometimes even disparaging of her early work, they now generally regard her as one of the most rigorous and innovative scientists studying plant communication and behavior. David Janos, co-editor of the scientific journal Mycorrhiza, characterized her published research as “sophisticated, imaginative, cutting-edge.” Jason Hoeksema, a University of Mississippi biology professor who has studied mycorrhizal networks, agreed: “I think she has really pushed the field forward.” Some of Simard’s studies now feature in textbooks and are widely taught in graduate-level classes on forestry and ecology. She was also a key inspiration for a central character in Richard Powers’s 2019 Pulitzer Prize-winning novel, “The Overstory” : the visionary botanist Patricia Westerford. In May, Knopf will publish Simard’s own book, “Finding the Mother Tree,” a vivid and compelling memoir of her lifelong quest to prove that “the forest was more than just a collection of trees.”

Since Darwin, biologists have emphasized the perspective of the individual. They have stressed the perpetual contest among discrete species, the struggle of each organism to survive and reproduce within a given population and, underlying it all, the single-minded ambitions of selfish genes. Now and then, however, some scientists have advocated, sometimes controversially, for a greater focus on cooperation over self-interest and on the emergent properties of living systems rather than their units.

Before Simard and other ecologists revealed the extent and significance of mycorrhizal networks, foresters typically regarded trees as solitary individuals that competed for space and resources and were otherwise indifferent to one another. Simard and her peers have demonstrated that this framework is far too simplistic. An old-growth forest is neither an assemblage of stoic organisms tolerating one another’s presence nor a merciless battle royale: It’s a vast, ancient and intricate society. There is conflict in a forest, but there is also negotiation, reciprocity and perhaps even selflessness. The trees, understory plants, fungi and microbes in a forest are so thoroughly connected, communicative and codependent that some scientists have described them as superorganisms. Recent research suggests that mycorrhizal networks also perfuse prairies, grasslands, chaparral and Arctic tundra — essentially everywhere there is life on land. Together, these symbiotic partners knit Earth’s soils into nearly contiguous living networks of unfathomable scale and complexity. “I was taught that you have a tree, and it’s out there to find its own way,” Simard told me. “It’s not how a forest works, though.”

In the summer of 2019, I met Simard in Nelson, a small mountain town not far from where she grew up in southern British Columbia. One morning we drove up a winding road to an old-growth forest and began to hike. The first thing I noticed was the aroma. The air was piquant and subtly sweet, like orange peel and cloves. Above our heads, great green plumes filtered the sunlight, which splashed generously onto the forest floor in some places and merely speckled it in others. Gnarled roots laced the trail beneath our feet, diving in and out of the soil like sea serpents. I was so preoccupied with my own experience of the forest that it did not even occur to me to consider how the forest might be experiencing us — until Simard brought it up.

“I think these trees are very perceptive,” she said. “Very perceptive of who’s growing around them. I’m really interested in whether they perceive us.” I asked her to clarify what she meant. Simard explained that trees sense nearby plants and animals and alter their behavior accordingly: The gnashing mandibles of an insect might prompt the production of chemical defenses, for example. Some studies have even suggested that plant roots grow toward the sound of running water and that certain flowering plants sweeten their nectar when they detect a bee’s wing beats. “Trees perceive lots of things,” Simard said. “So why not us, too?”

I considered the possibility. We’d been walking through this forest for more than an hour. Our sweat glands had been wafting pungent chemical compounds. Our voices and footsteps were sending pressure waves through the air and soil. Our bodies brushed against trunks and displaced branches. Suddenly it seemed entirely plausible that the trees had noticed our presence.

A little farther along the trail, we found a sunny alcove where we stopped to rest and chat, laying our backpacks against a log plush with moss and lichen. A multitude of tiny plants sprouted from the log’s green fleece. I asked Simard what they were. She bent her head for a closer look, tucking her frizzy blond hair behind her ears, and called out what she saw: queen’s cup, a kind of lily; five-leaved bramble, a type of wild raspberry; and both cedar and hemlock seedlings. As she examined the log, part of it collapsed, revealing the decaying interior. Simard dug deeper with her thumbs, exposing a web of rubbery, mustard-yellow filaments embedded in the wood.

“That’s a fungus!” she said. “That is Piloderma. It’s a very common mycorrhizal fungus” — one she had encountered and studied many times before in circumstances exactly like these. “This mycorrhizal network is actually linked up to that tree.” She gestured toward a nearby hemlock that stood at least a hundred feet tall. “That tree is feeding these seedlings.”

In some of her earliest and most famous experiments, Simard planted mixed groups of young Douglas fir and paper birch trees in forest plots and covered the trees with individual plastic bags. In each plot, she injected the bags surrounding one tree species with radioactive carbon dioxide and the bags covering the other species with a stable carbon isotope — a variant of carbon with an unusual number of neutrons. The trees absorbed the unique forms of carbon through their leaves. Later, she pulverized the trees and analyzed their chemistry to see if any carbon had passed from species to species underground. It had. In the summer, when the smaller Douglas fir trees were generally shaded, carbon mostly flowed from birch to fir. In the fall, when evergreen Douglas fir was still growing and deciduous birch was losing its leaves, the net flow reversed. As her earlier observations of failing Douglas fir had suggested, the two species appeared to depend on each other. No one had ever traced such a dynamic exchange of resources through mycorrhizal networks in the wild. In 1997, part of Simard’s thesis was published in the prestigious scientific journal Nature — a rare feat for someone so green. Nature featured her research on its cover with the title “The Wood-Wide Web,” a moniker that eventually proliferated through the pages of published studies and popular science writing alike.

In 2002, Simard secured her current professorship at the University of British Columbia, where she continued to study interactions among trees, understory plants and fungi. In collaboration with students and colleagues around the world, she made a series of remarkable discoveries. Mycorrhizal networks were abundant in North America’s forests. Most trees were generalists, forming symbioses with dozens to hundreds of fungal species. In one study of six Douglas fir stands measuring about 10,000 square feet each, almost all the trees were connected underground by no more than three degrees of separation; one especially large and old tree was linked to 47 other trees and projected to be connected to at least 250 more; and seedlings that had full access to the fungal network were 26 percent more likely to survive than those that did not.

Depending on the species involved, mycorrhizas supplied trees and other plants with up to 40 percent of the nitrogen they received from the environment and as much as 50 percent of the water they needed to survive. Below ground, trees traded between 10 and 40 percent of the carbon stored in their roots. When Douglas fir seedlings were stripped of their leaves and thus likely to die, they transferred stress signals and a substantial sum of carbon to nearby ponderosa pine, which subsequently accelerated their production of defensive enzymes. Simard also found that denuding a harvested forest of all trees, ferns, herbs and shrubs — a common forestry practice — did not always improve the survival and growth of newly planted trees. In some cases, it was harmful.

When Simard started publishing her provocative studies, some of her peers loudly disapproved. They questioned her novel methodology and disputed her conclusions. Many were perplexed as to why trees of different species would help one another at their own expense — an extraordinary level of altruism that seemed to contradict the core tenets of Darwinian evolution. Soon, most references to her studies were immediately followed by citations of published rebuttals. “A shadow was growing over my work,” Simard writes in her book. By searching for hints of interdependence in the forest floor, she had inadvertently provoked one of the oldest and most intense debates in biology: Is cooperation as central to evolution as competition?

The question of whether plants possess some form of sentience or agency has a long and fraught history.

Although plants are obviously alive, they are rooted to the earth and mute, and they rarely move on a relatable time scale; they seem more like passive aspects of the environment than agents within it. Western culture, in particular, often consigns plants to a liminal space between object and organism. It is precisely this ambiguity that makes the possibility of plant intelligence and society so intriguing — and so contentious.

In a 1973 book titled “The Secret Life of Plants,” the journalists Peter Tompkins and Christopher Bird claimed that plants had souls, emotions and musical preferences, that they felt pain and psychically absorbed the thoughts of other creatures and that they could track the movement of the planets and predict earthquakes. To make their case, the authors indiscriminately mixed genuine scientific findings with the observations and supposed studies of quacks and mystics. Many scientists lambasted the book as nonsense. Nevertheless, it became a New York Times best seller and inspired cartoons in The New Yorker and Doonesbury. Ever since, botanists have been especially wary of anyone whose claims about plant behavior and communication verge too close to the pseudoscientific.

In most of her published studies, Simard, who considered becoming a writer before she discovered forestry, is careful to use conservative language, but when addressing the public, she embraces metaphor and reverie in a way that makes some scientists uncomfortable. In a TED Talk Simard gave in 2016, she describes “a world of infinite biological pathways,” species that are “interdependent like yin and yang” and veteran trees that “send messages of wisdom on to the next generation of seedlings.” She calls the oldest, largest and most interconnected trees in a forest “mother trees” — a phrase meant to evoke their capacity to nurture those around them, even when they aren’t literally their parents. In her book, she compares mycorrhizal networks to the human brain. And she has spoken openly of her spiritual connection to forests.

Some of the scientists I interviewed worry that Simard’s studies do not fully substantiate her boldest claims and that the popular writing related to her work sometimes misrepresents the true nature of plants and forests. For example, in his international best seller, “The Hidden Life of Trees,” the forester Peter Wohlleben writes that trees optimally divide nutrients and water among themselves, that they probably enjoy the feeling of fungi merging with their roots and that they even possess “maternal instincts.”

“There is value in getting the public excited about all of the amazing mechanisms by which forest ecosystems might be functioning, but sometimes the speculation goes too far,” Hoeksema said. “I think it will be really interesting to see how much experimental evidence emerges to support some of the big ideas we have been getting excited about.” At this point other researchers have replicated most of Simard’s major findings. It’s now well accepted that resources travel among trees and other plants connected by mycorrhizal networks. Most ecologists also agree that the amount of carbon exchanged among trees is sufficient to benefit seedlings, as well as older trees that are injured, entirely shaded or severely stressed, but researchers still debate whether shuttled carbon makes a meaningful difference to healthy adult trees. On a more fundamental level, it remains unclear exactly why resources are exchanged among trees in the first place, especially when those trees are not closely related.

In their autobiographies, Charles Darwin and Alfred Russel Wallace each credited Thomas Malthus as a key inspiration for their independent formulations of evolution by natural selection. Malthus’s 1798 essay on population helped the naturalists understand that all living creatures were locked into a ceaseless contest for limited natural resources. Darwin was also influenced by Adam Smith, who believed that societal order and efficiency could emerge from competition among inherently selfish individuals in a free market. Similarly, the planet’s dazzling diversity of species and their intricate relationships, Darwin would show, emerged from inevitable processes of competition and selection, rather than divine craftsmanship. “Darwin’s theory of evolution by natural selection is obviously 19th-century capitalism writ large,” wrote the evolutionary biologist Richard Lewontin.

As Darwin well knew, however, ruthless competition was not the only way that organisms interacted. Ants and bees died to protect their colonies. Vampire bats regurgitated blood to prevent one another from starving. Vervet monkeys and prairie dogs cried out to warn their peers of predators, even when doing so put them at risk. At one point Darwin worried that such selflessness would be “fatal” to his theory. In subsequent centuries, as evolutionary biology and genetics matured, scientists converged on a resolution to this paradox: Behavior that appeared to be altruistic was often just another manifestation of selfish genes — a phenomenon known as kin selection. Members of tight-knit social groups typically share large portions of their DNA, so when one individual sacrifices for another, it is still indirectly spreading its own genes.

Kin selection cannot account for the apparent interspecies selflessness of trees, however — a practice that verges on socialism. Some scientists have proposed a familiar alternative explanation: Perhaps what appears to be generosity among trees is actually selfish manipulation by fungi. Descriptions of Simard’s work sometimes give the impression that mycorrhizal networks are inert conduits that exist primarily for the mutual benefit of trees, but the thousands of species of fungi that link trees are living creatures with their own drives and needs. If a plant relinquishes carbon to fungi on its roots, why would those fungi passively transmit the carbon to another plant rather than using it for their own purposes? Maybe they don’t. Perhaps the fungi exert some control: What looks like one tree donating food to another may be a result of fungi redistributing accumulated resources to promote themselves and their favorite partners.

“Where some scientists see a big cooperative collective, I see reciprocal exploitation,” said Toby Kiers, a professor of evolutionary biology at Vrije Universiteit Amsterdam. “Both parties may benefit, but they also constantly struggle to maximize their individual payoff.” Kiers is one of several scientists whose recent studies have found that plants and symbiotic fungi reward and punish each other with what are essentially trade deals and embargoes, and that mycorrhizal networks can increase conflict among plants. In some experiments, fungi have withheld nutrients from stingy plants and strategically diverted phosphorous to resource-poor areas where they can demand high fees from desperate plants.

Several of the ecologists I interviewed agreed that regardless of why and how resources and chemical signals move among the various members of a forest’s symbiotic webs, the result is still the same: What one tree produces can feed, inform or rejuvenate another. Such reciprocity does not necessitate universal harmony, but it does undermine the dogma of individualism and temper the view of competition as the primary engine of evolution.

The most radical interpretation of Simard’s findings is that a forest behaves “as though it’s a single organism,” as she says in her TED Talk. Some researchers have proposed that cooperation within or among species can evolve if it helps one population outcompete another — an altruistic forest community outlasting a selfish one, for example. The theory remains unpopular with most biologists, who regard natural selection above the level of the individual to be evolutionarily unstable and exceedingly rare. Recently, however, inspired by research on microbiomes, some scientists have argued that the traditional concept of an individual organism needs rethinking and that multicellular creatures and their symbiotic microbes should be regarded as cohesive units of natural selection. Even if the same exact set of microbial associates is not passed vertically from generation to generation, the functional relationships between an animal or plant species and its entourage of microorganisms persist — much like the mycorrhizal networks in an old-growth forest. Humans are not the only species that inherits the infrastructure of past communities.

The emerging understanding of trees as social creatures has urgent implications for how we manage forests.

Humans have relied on forests for food, medicine and building materials for many thousands of years. Forests have likewise provided sustenance and shelter for countless species over the eons. But they are important for more profound reasons too. Forests function as some of the planet’s vital organs. The colonization of land by plants between 425 and 600 million years ago, and the eventual spread of forests, helped create a breathable atmosphere with the high level of oxygen we continue to enjoy today. Forests suffuse the air with water vapor, fungal spores and chemical compounds that seed clouds, cooling Earth by reflecting sunlight and providing much-needed precipitation to inland areas that might otherwise dry out. Researchers estimate that, collectively, forests store somewhere between 400 and 1,200 gigatons of carbon, potentially exceeding the atmospheric pool.

Crucially, a majority of this carbon resides in forest soils, anchored by networks of symbiotic roots, fungi and microbes. Each year, the world’s forests capture more than 24 percent of global carbon emissions, but deforestation — by destroying and removing trees that would otherwise continue storing carbon — can substantially diminish that effect. When a mature forest is burned or clear-cut, the planet loses an invaluable ecosystem and one of its most effective systems of climate regulation. The razing of an old-growth forest is not just the destruction of magnificent individual trees — it’s the collapse of an ancient republic whose interspecies covenant of reciprocation and compromise is essential for the survival of Earth as we’ve known it.

One bright morning, Simard and I climbed into her truck and drove up a forested mountain to a clearing that had been repeatedly logged. A large tract of bare soil surrounded us, punctuated by tree stumps, saplings and mounds of woody detritus. I asked Simard how old the trees that once stood here might have been. “We can actually figure that out,” she said, stooping beside a cleanly cut Douglas fir stump. She began to count growth rings, explaining how the relative thickness reflected changing environmental conditions. A few minutes later, she reached the outermost rings: “102, 103, 104!” She added a few years to account for very early growth. This particular Douglas fir was most likely alive in 1912, the same year that the Titanic sank, Oreos debuted and the mayor of Tokyo gave Washington 3,020 ornamental cherry trees.

Mushrooms and conks are the fruiting bodies of fungi. Their underground filaments form networks among the root systems.

Looking at the mountains across the valley, we could see evidence of clearcutting throughout the past century. Dirt roads snaked up and down the incline. Some parts of the slopes were thickly furred with conifers. Others were treeless meadows, sparse shrubland or naked soil strewn with the remnants of sun-bleached trunks and branches. Viewed as a whole, the haphazardly sheared landscape called to mind a dog with mange.

When Europeans arrived on America’s shores in the 1600s, forests covered one billion acres of the future United States — close to half the total land area. Between 1850 and 1900, U.S. timber production surged to more than 35 billion board feet from five billion. By 1907, nearly a third of the original expanse of forest — more than 260 million acres — was gone. Exploitative practices likewise ravaged Canada’s forests throughout the 19th century. As growing cities drew people away from rural and agricultural areas, and lumber companies were forced to replant regions they had logged, trees began to reclaim their former habitats. As of 2012, the United States had more than 760 million forested acres. The age, health and composition of America’s forests have changed significantly, however. Although forests now cover 80 percent of the Northeast, for example, less than 1 percent of its old-growth forest remains intact.

And though clearcutting is not as common as it once was, it is still practiced on about 40 percent of logged acres in the United States and 80 percent of them in Canada. In a thriving forest, a lush understory captures huge amounts of rainwater, and dense root networks enrich and stabilize the soil. Clearcutting removes these living sponges and disturbs the forest floor, increasing the chances of landslides and floods, stripping the soil of nutrients and potentially releasing stored carbon to the atmosphere. When sediment falls into nearby rivers and streams, it can kill fish and other aquatic creatures and pollute sources of drinking water. The abrupt felling of so many trees also harms and evicts countless species of birds, mammals, reptiles and insects.

Simard’s research suggests there is an even more fundamental reason not to deprive a logging site of every single tree. The day after viewing the clear-cuts, we took a cable ferry across Kootenay Lake and drove into the Harrop-Procter Community Forest: nearly 28,000 acres of mountainous terrain populated with Douglas fir, larch, cedar and hemlock. In the early 1900s, much of the forest near the lake was burned to make way for settlements, roads and mining operations. Today the land is managed by a local co-op that practices ecologically informed forestry.

The road up the mountain was rough, dusty and littered with obstacles. “Hold on to your nips and your nuts!” Simard said as she maneuvered her truck out of a ditch and over a series of large branches that jostled us in our seats. Eventually she parked beside a steep slope, climbed out of the driver’s seat and began to skitter her way across a seemingly endless jumble of pine needles, stumps and splintered trunks. Simard was so quick and nimble that I had trouble keeping up until we traversed the bulk of the debris and entered a clearing. Most of the ground was barren and brown. Here and there, however, the mast of a century-old Douglas fir rose 150 feet into the air and unfurled its green banners. A line of blue paint ringed the trunk of every tree still standing. Simard explained that at her behest, Erik Leslie, the Harrop-Procter Forest Manager, marked the oldest, largest and healthiest trees on this site for preservation before it was logged.

When a seed germinates in an old-growth forest, it immediately taps into an extensive underground community of interspecies partnerships. Uniform plantations of young trees planted after a clear-cut are bereft of ancient roots and their symbiotic fungi. The trees in these surrogate forests are much more vulnerable to disease and death because, despite one another’s company, they have been orphaned. Simard thinks that retaining some mother trees, which have the most robust and diverse mycorrhizal networks, will substantially improve the health and survival of future seedlings — both those planted by foresters and those that germinate on their own.

For the last several years, Simard has been working with scientists, North American timber companies and several of the First Nations to test this idea. She calls the ongoing experiment the Mother Tree Project. In 27 stands spread across nine different climatic regions in British Columbia, Simard and her collaborators have been comparing traditional clear-cuts with harvested areas that preserve varying ratios of veteran trees: 60 percent, 30 percent or as low as 10 percent — only around eight trees per acre. She directed my attention across Kootenay Lake to the opposing mountains, where there were several more experimental plots. Although they were sparsely vegetated, there was an order to the depilation. It looked as though a giant had meticulously plucked out particular trees one by one.

Since at least the late 1800s, North American foresters have devised and tested dozens of alternatives to standard clearcutting: strip cutting (removing only narrow bands of trees), shelterwood cutting (a multistage process that allows desirable seedlings to establish before most overstory trees are harvested) and the seed-tree method (leaving behind some adult trees to provide future seed), to name a few. These approaches are used throughout Canada and the United States for a variety of ecological reasons, often for the sake of wildlife, but mycorrhizal networks have rarely if ever factored into the reasoning.

Sm’hayetsk Teresa Ryan, a forest ecologist of Tsimshian heritage who completed her graduate studies with Simard, explained that research on mycorrhizal networks, and the forestry practices that follow from it, mirror aboriginal insights and traditions — knowledge that European settlers often dismissed or ignored. “Everything is connected, absolutely everything,” she said. “There are many aboriginal groups that will tell you stories about how all the species in the forests are connected, and many will talk about below-ground networks.”

Ryan told me about the 230,000-acre Menominee Forest in northeastern Wisconsin, which has been sustainably harvested for more than 150 years. Sustainability, the Menominee believe, means “thinking in terms of whole systems, with all their interconnections, consequences and feedback loops.” They maintain a large, old and diverse growing stock, prioritizing the removal of low-quality and ailing trees over more vigorous ones and allowing trees to age 200 years or more — so they become what Simard might call grandmothers. Ecology, not economics, guides the management of the Menominee Forest, but it is still highly profitable. Since 1854, more than 2.3 billion board feet have been harvested — nearly twice the volume of the entire forest — yet there is now more standing timber than when logging began. “To many, our forest may seem pristine and untouched,” the Menominee wrote in one report. “In reality, it is one of the most intensively managed tracts of forest in the Lake States.”

On a mid-June afternoon, Simard and I drove 20 minutes outside Nelson to a bowl-shaped valley beneath the Selkirk Mountains, which houses an active ski resort in winter. We met one of her students and his friend, assembled some supplies — shovels, water bottles, bear spray — and started hiking up the scrubby slope toward a population of subalpine conifers. The goal was to characterize mycorrhizas on the roots of whitebark pine, an endangered species that feeds and houses numerous creatures, including grizzly bears, Clark’s nutcracker and Douglas squirrels.

About an hour into our hike, we found one: small and bright-leaved with an ashen trunk. Simard and her assistants knelt by its base and began using shovels and knives to expose its roots. The work was slow, tiring and messy. Mosquitoes and gnats relentlessly swarmed our limbs and necks. I craned over their shoulders, trying to get a better look, but for a long time there was not much to see. As the work progressed, however, the roots became darker, finer and more fragile. Suddenly Simard uncovered a gossamer web of tiny white threads embedded in the soil.

“Ho!” she cried out, grinning broadly. “It’s a [expletive] gold mine! Holy [expletive]!” It was the most excited I’d seen her the whole trip. “Sorry, I shouldn’t swear,” she added in a whisper. “Professors are not supposed to swear.”

“Is that a mycorrhiza?” I asked.

“It’s a mycorrhizal network!” she answered, laughing with delight. “So cool, heh? Here’s a mycorrhizal tip for sure.”

She handed me a thin strip of root the length of a pencil from which sprouted numerous rootlets still woolly with dirt. The rootlets branched into even thinner filaments. As I strained to see the fine details, I realized that the very tips of the smallest fibers looked as though they’d been capped with bits of wax. Those gummy white nodules, Simard explained, were mycorrhizal fungi that had colonized the pine’s roots. They were the hubs from which root and fungus cast their intertwined cables through the soil, opening channels for trade and communication, linking individual trees into federations. This was the very fabric of the forest — the foundation of some of the most populous and complex societies on Earth.

Trees have always been symbols of connection. In Mesoamerican mythology, an immense tree grows at the center of the universe, stretching its roots into the underworld and cradling earth and heaven in its trunk and branches. Norse cosmology features a similar tree called Yggdrasil. A popular Japanese Noh drama tells of wedded pines that are eternally bonded despite being separated by a great distance. Even before Darwin, naturalists used treelike diagrams to represent the lineages of different species. Yet for most of recorded history, living trees kept an astonishing secret: Their celebrated connectivity was more than metaphor — it had a material reality. As I knelt beneath that whitebark pine, staring at its root tips, it occurred to me that my whole life I had never really understood what a tree was. At best I’d been aware of just one half of a creature that appeared to be self-contained but was in fact legion — a chimera of bewildering proportions.

We, too, are composite creatures.

Diverse microbial communities inhabit our bodies, modulating our immune systems and helping us digest certain foods. The energy-producing organelles in our cells known as mitochondria were once free-swimming bacteria that were subsumed early in the evolution of multicellular life. Through a process called horizontal gene transfer, fungi, plants and animals — including humans — have continuously exchanged DNA with bacteria and viruses. From its skin, fur or bark right down to its genome, any multicellular creature is an amalgam of other life-forms. Wherever living things emerge, they find one another, mingle and meld.

Five hundred million years ago, as both plants and fungi continued oozing out of the sea and onto land, they encountered wide expanses of barren rock and impoverished soil. Plants could spin sunlight into sugar for energy, but they had trouble extracting mineral nutrients from the earth. Fungi were in the opposite predicament. Had they remained separate, their early attempts at colonization might have faltered or failed. Instead, these two castaways — members of entirely different kingdoms of life — formed an intimate partnership. Together they spread across the continents, transformed rock into rich soil and filled the atmosphere with oxygen.

Eventually, different types of plants and fungi evolved more specialized symbioses. Forests expanded and diversified, both above- and below ground. What one tree produced was no longer confined to itself and its symbiotic partners. Shuttled through buried networks of root and fungus, the water, food and information in a forest began traveling greater distances and in more complex patterns than ever before. Over the eons, through the compounded effects of symbiosis and coevolution, forests developed a kind of circulatory system. Trees and fungi were once small, unacquainted ocean expats, still slick with seawater, searching for new opportunities. Together, they became a collective life form of unprecedented might and magnanimity.

After a few hours of digging up roots and collecting samples, we began to hike back down the valley. In the distance, the granite peaks of the Selkirks bristled with clusters of conifers. A breeze flung the scent of pine toward us. To our right, a furtive squirrel buried something in the dirt and dashed off. Like a seed waiting for the right conditions, a passage from “The Overstory” suddenly sprouted in my consciousness: “There are no individuals. There aren’t even separate species. Everything in the forest is the forest.”

Ferris Jabr is a contributing writer for the magazine. His previous cover story on the evolution of beauty is featured in the latest edition of “The Best American Science and Nature Writing.” He is currently working on his first book, which explores how living creatures have continually transformed Earth throughout its history.

Brendan George Ko is a visual storyteller based in Toronto and Maui who works in photography, video and installation. His first art book, “Moemoea,” about traditional voyaging in the Pacific, will be published next year by Conveyor Editions.

Advertisement

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 18 March 2022

Response of tomatoes primed by mycorrhizal colonization to virulent and avirulent bacterial pathogens

• Moeka Fujita 1   na1 ,
• Miyuki Kusajima 1 , 2   na1 ,
• Masatomo Fukagawa 1 ,
• Yasuko Okumura 1 ,
• Masami Nakajima 3 ,
• Kohki Akiyama   ORCID: orcid.org/0000-0002-9171-9058 4 ,
• Tadao Asami 2 ,
• Koichi Yoneyama 5 ,
• Hisaharu Kato 1 &
• Hideo Nakashita 1  

Scientific Reports volume  12 , Article number:  4686 ( 2022 ) Cite this article

4088 Accesses

23 Citations

1 Altmetric

Metrics details

• Plant signalling

Most plants interact with arbuscular mycorrhizal fungi, which enhance disease resistance in the host plant. Because the effects of resistance against bacterial pathogens are poorly understood, we investigated the effects of mycorrhizal colonization on virulent and avirulent pathogens using phytopathological and molecular biology techniques. Tomato plants colonized by Gigaspora margarita acquired resistance not only against the fungal pathogen, Botrytis cinerea, but also against a virulent bacterial pathogen, Pseudomonas syringae pv. tomato DC3000 ( Pst ). In G. margarita -colonized tomato, salicylic acid (SA)- and jasmonic acid (JA)-related defense genes were expressed more rapidly and strongly compared to those in the control plants when challenged by Pst , indicating that the plant immunity system was primed by mycorrhizal colonization. Gene expression analysis indicated that primed tomato plants responded to the avirulent pathogen, Pseudomonas syringae pv. oryzae, more rapidly and strongly compared to the control plant, where the effect on the JA-mediated signals was stronger than in the case with Pst . We found that the resistance induced by mycorrhizal colonization was effective against both fungal and bacterial pathogens including virulent and avirulent pathogens. Moreover, the activation of both SA- and JA-mediated signaling pathways can be enhanced in the primed plant by mycorrhizal colonization.

Similar content being viewed by others

A novel Arabidopsis pathosystem reveals cooperation of multiple hormonal response-pathways in host resistance against the global crop destroyer Macrophomina phaseolina

Molecular insights into biochar-mediated plant growth promotion and systemic resistance in tomato against Fusarium crown and root rot disease

Foliar resistance to Rhizoctonia solani in Arabidopsis is compromised by simultaneous loss of ethylene, jasmonate and PEN2 mediated defense pathways

Introduction.

Plants have several types of self-defense mechanisms against pathogens. Systemically induced disease resistance, activated by various types of stimuli, protects the plant for long periods from a broad range of attackers. Systemically induced defense plays an important role in allowing plants to survive even under harsh conditions in the environment. Some interactions between plants and pathogens activate these resistance mechanisms through phytohormone-governed signaling pathways. Salicylic acid (SA)-mediated defense response is effective against biotrophic pathogens, whereas jasmonic acid (JA)-mediated defense signaling is important for the resistance against necrotrophic pathogens 1 , 2 . Systemic acquired resistance (SAR), induced by the SA-mediated signaling pathway, is accompanied by the expression of defense-related genes, such as pathogenesis-related (PR) genes 3 . SAR is a relatively strong defense against subsequent pathogenic attacks; therefore, it has been used in the field by exploiting plant activators that induce SAR. Among these chemicals, a derivative of probenazole, 1,2-benzisothiazol-3(2 H )-one1,1-dioxide (BIT) and benzo(1,2,3)thiadiazole-7-carbothioic acid S -methyl ester (BTH) are capable of activating upstream and downstream of SA biosynthesis, respectively, in the SAR signaling pathway 4 , 5 , which have been used for investigation of disease resistance mechanisms.

In addition to host–pathogen interactions, interactions with nonpathogenic or symbiotic microorganisms also activate plant immune systems. The rhizobacteria Pseudomonas fluorescens WCS417r 6 , 7 , Bradyrhizobium sp. ORS278 8 , and Pseudomonas aeruginosa 7NSK2 9 ; the endophytic bacterium Azospirillum sp. B510 10 , 11 ; and the arbuscular mycorrhizal fungi, Rhizophagus irregularis (formally Glomus intraradices ) 12 , 13 and Funneliformis mosseae (formerly Glomus mosseae ) 14 , 15 , are among those that have been reported to induce disease resistance in host plants 16 , 17 .

Previous studies on the priming of immune system of plants by arbuscular mycorrhizal fungi, called mycorrhiza-induced resistance (MIR), indicate that MIR is effective against fungal 12 , 14 , 18 , 19 , 20 , bacterial 21 , and viral pathogens 22 , 23 and, furthermore, against leaf-chewing caterpillars 24 and aphids 25 , 26 . Although primed plants are able to respond more rapidly and strongly to pathogenic infection to protect themselves, no or weak expression of the major defense-related genes through SA- or JA-mediated signaling pathways were observed before pathogenic infection. Since these analyses have been performed only for MIR induced by R. irregularis and F. mosseae, analysis of MIR by other arbuscular mycorrhizal fungi will provide further insights into the mechanism of MIR.

Another arbuscular mycorrhizal fungus Gigaspora margarita Becker & Hall ( G. margarita ) can colonize tomato plants, however its effect on plant immunity has not been investigated. Because gathering large spores of G. margarita (260–480 µm in diameter) 27 enable uniformity of colonization level among plants in experiments, this strain is suitable for characterization of plant immune systems in the mycorrhizal plants. Recent studies have revealed that effect of G. margarita colonization on plants growth is dependent on spore-associated bacteria interacting with spore surface and endobacteria existing in the fungal cytoplasm 28 , 29 .

Previous reports suggest that MIR is effective against necrotrophic pathogens but not against biotrophs such as foliar bacterial pathogens 30 . Furthermore, it has been reported that tobacco plants colonized with R. irregularis displayed reduced SA-mediated defense against infection with tobacco mosaic virus 31 . On the other hand, Medicago truncatula colonized with R. irregularis exhibited enhanced resistance against the virulent bacterial pathogen, Xanthomonas campestris pv. Alfalfae 21 . The question has been raised as to whether MIR is distinctly effective against biotrophic bacteria; however, only limited information is available on MIR against foliar bacterial pathogens. To better understand the effects of MIR on bacterial pathogens, we investigated the effects of MIR induced by Gigaspora margarita colonization on virulent and avirulent bacterial pathogens in tomato ( Solanum lycopersicum L. cv. Momotaro ) and the related priming effects on defense signaling. This is the first study to elucidate the priming responses against bacterial pathogens in MIR. The data presented here demonstrate the potentiality of MIR for controlling various diseases.

Mycorrhiza induces disease resistance in tomato

To verify root-colonization by G. margarita , 14 and 28 days after inoculation (with 25 spores per plant), tomato roots were cleared and stained with trypan blue for microscopic evaluation of infection (Fig.  1 A). The results revealed that the G. margarita colonization rate was only 1.5% at 14 days but increased to 10–15% at 28 days after inoculation.

( A ) Colonization of tomato root with G. margarita . Tomato plants treated with G. margarita (25 spores/pot) by soil drenching. Roots were washed and strained with trypan blue 6 days after the inoculation with G. margarita. Scale bar, 200 µm. ( B ) Induction of resistance against tomato leaf speck disease by G. margarita . Plants were treated with G. margarita (25 spores/pot) (AMF) 14 days prior to challenge inoculation with Pst (1 × 10 3  CFU/ml). SAR was induced by treatment with BIT (5 mg/pot) by soil-drenching method 5 days prior to challenge inoculation. The growth of Pst in tomato leaflet was evaluated 2 days after the inoculation. Each experiment was done with more than 4 plants. Values are shown as the means ± SE (n = 8) of a single experiment. Different letters indicate statistically significant differences between treatments (one-way ANOVA with Tukey’s post-test, p  < 0.05). The experiment was repeated three times with similar results. ( C ) Photograph of representative disease symptoms taken 5 days after inoculation with Pst . Scale bar, 10 mm.

Because G. margarita -colonized tomato plants (14 days after G. margarita inoculation) exhibited enhanced resistance against the necrotrophic fungal pathogen Botrytis cinerea (Supplementary Fig. S1 ) , we assessed the resistance against bacterial speck caused by Pseudomonas syringae pv. tomato DC3000 ( Pst ) in these plants. Resistance was determined by measuring bacterial growth in leaf tissues 2 days post challenge inoculation with Pst . As a positive control, SAR was induced with the SAR activator BIT. Treating tomato plants with BIT reduced bacterial growth compared to that in the water-treated control plants (Fig.  1 B). The bacterial growth in the leaves of G. margarita -inoculated plants was less than half of that in the leaves of the water-treated control plants. At 5 days after inoculation, the inoculated leaves in the water-treated control exhibited a yellowish area spreading from the infected region widely in the leaflet (Fig.  1 C). The disease severity in BIT-treated or G. margarita- inoculated plants was significantly reduced compared to that in the water-treated control (Fig.  1 C). These results indicated that the symptoms of tomato bacterial speck were consistent with the in-planta growth of Pst . Antimicrobial activity against Pst was not detected in the extract of leaves of G. margarita -colonized plants (Supplementary Fig. S2 ). Thus, the resistance of G. margarita -colonized tomato against bacterial pathogens was caused by the activation of the plant immunity system.

To examine the involvement of spore-associated bacteria and endobacteria in disease resistance in G. margarita -colonized plants, spores were crushed using a pestle with a small amount of fine sea sand powder and then treated to the tomato root. The challenge Pst -inoculation assay showed that the tomato plants treated with the crushed spores did not acquire disease resistance (supplementary Fig. S3 ), corroborating that the resistance was due to colonization by G. margarita and probably not to the spore-associated bacteria or endobacteria alone.

Defense-related signaling in the G. margarita-colonized tomato plants

To determine the physiological changes in G. margarita -induced disease resistance in tomato plants, we examined whether SAR was induced by G. margarita colonization. Transcript levels of SA-responsive genes, PR1b and PR2a , were strongly increased by the SAR inducer BIT; however, they were not influenced by G. margarita colonization (Fig.  2 A). Endogenous SA accumulation in leaves was examined 14 days after inoculation with G. margarita . The levels of free SA and total SA (free SA + SA-glucoside) in G. margarita -colonized plants were not significantly different from those in the water-treated control plants (Fig.  2 B), indicating that G. margarita colonization had no effect on SA accumulation in tomato plants. Thus, G. margarita colonization did not activate SA-mediated defense signaling in tomato plants.

( A ) Expression of defense-related genes in G. margarita -colonized tomato plants. Terminal leaflets of the 4th compound leaves were collected 14 days after the inoculation with G. margarita (AMF). SAR was induced by treatment with BIT (5 mg/pot) by soil drenching for 5 days. Real time PCR analysis was performed to evaluate the expression of SAR marker genes ( PR1b and PR2a ) and JA-related genes ( Loxd , OPR3 and PI2 ). Transcript levels were normalized to the expression of ACT4 measured in the same samples. The means and SEs were calculated from 4 independent samples, each taken from a single plant. Asterisk indicates statistically significant difference between data of the control and BIT-treated plants (two-sided t-test, p  < 0.05). The experiment was repeated three times with similar results. ( B ) Salicylic acid levels in G. margarita -colonized plants. Terminal and its neighboring leaflets of 4th compound leaves were harvested at 14 days after inoculation with G. margarita (25 spores/pot) (AMF). The levels of free and total SA (free SA + SA-glucoside) were quantified by HPLC. Values presented are the means ± SE from 6 samples, each prepared from a single plant. The experiment was repeated three times with similar results.

Another type of systemically induced disease resistance is induced via the JA-mediated signaling pathway, which is activated by wounding and attacks by necrotrophic pathogens and insects. To determine whether JA-mediated signal transduction was activated by G. margarita colonization in tomato plants, the expression of JA-related genes was analyzed. Mycorrhizal colonization did not influence the expression of the JA biosynthesis-related genes LOXd (encoding lipoxygenase), OPR3 (encoding 12-oxophytodienoate reductase 3), or the JA-responsive gene PI2 (encoding protease inhibitor 2) (Fig.  2 A), nor did the treatment with BIT. These results indicated that the JA-mediated defense signaling was not activated by G. margarita colonization in tomato plants.

Accelerated responses to pathogen infection by G. margarita colonization

To determine whether G. margarita colonization had any effects on the responses to pathogens in tomato plants, we examined the expression of defense-related genes after the infection with Pst . While the transcript levels of SA-related genes PR1b and PR2a increased from 20 h after infection with Pst in the water-treated control plants, a rapid increase in those transcripts was observed in G. margarita -colonized plants (Fig.  3 ). At 20 h after Pst infection, the transcript levels of PR1b and PR2a in G. margarita -colonized plants were approximately six- and four-fold higher, respectively, than those in the water-treated control plants (Fig.  3 ). These results indicated that activation of the SA-mediated signaling pathway in response to pathogen infection was accelerated in mycorrhizal plants compared to that in the water-treated control plants.

Expression of defense-related genes after infection with the virulent pathogen. The G. margarita -colonized (14 days after G. margarita inoculation) and the water-treated control tomato plants were inoculated with Pst . Leaf disks were taken from the Pst -infiltrated part of the leaflets at the indicated time points (0, 12, 16, 20 h post inoculation (hpi)) and used for gene expression analyses of SA-related genes ( PR1b and PR2a ) and JA-related genes ( LOXd, OPR3 and PI2 ). Transcript levels were normalized to the expression of ACT4 measured in the same samples. The means and SEs were calculated from 4 independent samples, each prepared from a single plant. Open circle, water-treated control plant; closed circle, G. margarita -colonized plants. Asterisks indicate statistically significant difference between data of the water-treated control and G. margarita -colonized plants (two-sided t-test, p  < 0.05). The experiment was repeated three times with similar results.

The expression of JA-related genes after infection with Pst was not as strong as that of SA-related genes probably because of the suppression by the SA-mediated defense signal that was activated by the biotrophic pathogen. The expression of LOXd and PI2 was enhanced in the G. margarita -colonized plants compared to that in the water-treated control plants, whereas this phenomenon was not observed regarding the OPR3 gene (Fig.  3 ). Although the induction levels of JA-related gene expression were quite low, these results indicated that the activation of the JA-mediated signaling pathway in response to pathogen infection was accelerated in mycorrhizal plants.

Effects of mycorrhizal colonization on responses against avirulent bacterial pathogens

Analysis using a virulent pathogen , Pst , indicated that G. margarita -colonized tomato plants were in the primed state. Furthermore, our results indicated that the priming effects of MIR were provoked not only by fungal but also bacterial pathogens. Despite microorganisms other than virulent pathogens having more opportunities to challenge plants, it is still poorly understood how primed plants respond to avirulent pathogens. To determine how MIR responded to avirulent pathogens, we examined the defense responses of G. margarita -colonized tomato plants against an incompatible bacterial strain, Pseudomonas syringae pv. oryzae ( Pso ). We also used a flagellin-deficient mutant ( Pso∆fliC ) to assess the influence of flagellin as an elicitor in defense response. First, the defense response in the incompatible interaction was examined by infecting a tomato leaflet with different concentrations of these pathogens. In both G. margarita -colonized and the control plants, the leaf tissue infected with Pso at a concentration of 1 × 10 6  CFU/mL exhibited a hypersensitive reaction (HR) involving cell death at 18 h after infection; however, lower concentrations of 1 × 10 4 and 1 × 10 5  CFU/mL did not cause HRs (Fig.  4 ). Similar results were obtained by infection with the Pso∆fliC mutant, suggesting that the tomato HR against Pso was caused by factors other than flagellin (Fig.  4 ).

Response of tomato leaves to infection with avirulent pathogens. Tomato plants were inoculated with G. margarita (25 spores/pot) for 14 days. Terminal leaflets of the 4th leaves of 3-week-old tomato plants were inoculated with Pso or Pso∆fliC (1 × 10 4 , 1 × 10 5 , or 1 × 10 6  CFU/ml) or water (H 2 O). Each experiment was done with more than 4 plants. Photographs were taken 30 h after inoculation. The experiment was repeated twice with similar results. Control, water-treated plants; AMF, G. margarita -colonized plants.

The defense responses against avirulent pathogens were analyzed at the gene expression level by using the same genes used in the Pst analysis. The expression patterns of PR1b and PR2a indicated that the activation of the SA-mediated signaling pathway in response to infection with Pso or Pso∆fliC was accelerated in G. margarita -colonized plants compared to that in the water-treated control plants (Figs.  5 and 6 ), which was similar to the results with respect to Pst. The enhanced expression of PR1b by mycorrhizal colonization was much stronger in response to Pst , a virulent pathogen (Fig.  3 ), whereas PR2a expression was strongly enhanced in response to avirulent pathogens (Figs. 5 and 6 ). This difference may be explained by the concentration of inoculants, the compatibility between the host plant and pathogens, and the rapid growth of Pst in leaf tissues.

Expression of defense-related genes after infection with avirulent pathogen Pso. The G. margarita -colonized (14 days after G. margarita inoculation) and the water-treated control tomato plants were inoculated with Pso . Leaf disks were taken from the Pso -infiltrated part of the leaflets at the indicated time points (0, 12, 16, 20 h post inoculation (hpi)) and used for gene expression analyses of SA-related genes ( PR1b and PR2a ) and JA-related genes ( LOXd, OPR3 and PI2 ). Transcript levels were normalized to the expression of ACT4 measured in the same samples. The means and SEs were calculated from 4 independent samples, each prepared from a single plant. Open circle, water-treated control plant; closed circle, G. margarita -colonized plants. Asterisks indicate statistically significant difference between data of the water-treated control and G. margarita -colonized plants (two-sided t-test, **, p  < 0.01; *, p  < 0.05; (*) in PI2 , p  = 0.061). The experiment was repeated three times with similar results.

Expression of defense-related genes after infection with avirulent pathogen mutant Pso∆fliC. The G. margarita -colonized (14 days after G. margarita inoculation) and the water-treaterd control tomato plants were inoculated with Pso∆fliC . Leaf disks were taken from the Pso∆fliC -infiltrated part of the leaflets at the indicated time points (0, 12, 14, 16 h post inoculation (hpi)) and used for gene expression analyses of SA-related genes ( PR1b and PR2a ) and JA-related genes ( LOXd, OPR3 and PI2 ). Transcript levels were normalized to the expression of ACT4 measured in the same samples. The means and SEs were calculated from 4 independent samples, each prepared from a single plant. Open circle, water-treated control plant; closed circle, G. margarita -colonized plants. Asterisks indicate statistically significant difference between data of the water-treated control and G. margarita -colonized plants (two-sided t-test; **, p  < 0.01; *, p  < 0.05; (*) in PR1b , p  = 0.056; (*) in Loxd , p  = 0.051). The experiment was repeated three times with similar results.

The expression of JA-related genes after the infection with avirulent pathogens was stronger than that with the virulent pathogen Pst , probably because of incompatible interactions, such as recognition of avirulent factors and initiation of programmed cell death, which contribute to the activation of JA-mediated signaling pathway (Figs. 3 , 5 and 6 ). Among the JA biosynthesis-related genes tested, LOXd expression in response to Pso or Pso∆fliC was accelerated by G. margarita colonization, whereas OPR3 expression was not influenced (Figs. 5 and 6 ). Enhancement by mycorrhizal colonization was also observed in the PI2 expression at 16 h after infection with Pso∆fliC , whereas infection with Pso had no significant effect (Figs. 5 and 6 ). These results indicated that the JA-mediated signaling pathway in response to infection with avirulent pathogens, at least with respect to Pso∆fliC, was accelerated in G. margarita -colonized plants compared to that in the water-treated control plants.

Disease resistance induced by symbiotic soilborne microbes in plants should be an important adaptative strategy to diversified environments, which is also an important mechanism for crop production. To understand the underlying mechanisms at the molecular level, we investigated the defense responses in G. margarita -colonized tomato plants to fungal and bacterial pathogens, including incompatible strains. The resistance induced by this mycorrhizal symbiosis revealed protective effects against the fungal pathogen B. cinerea and the bacterial pathogen Pst . Analyses of gene expression and SA accumulation indicated that the G. margarita colonization did not activate the defense signals mediated by SA and JA; however, the activation of these defense signals by infection with Pst was enhanced in G. margarita -colonized tomato plants, suggesting that the immune system was primed by G. margarita colonization. Against an avirulent pathogen , Pso , HR induction was not influenced by the priming of tomato plants; however, the SA- and JA-mediated responses to the lower bacterial concentration were enhanced. Thus, the G. margarita -primed tomato plants exhibited accelerated induction of defense signaling upon infection with a virulent strain, Pst , and with an avirulent strain, Pso . Both Pst and Pso had relatively strong effects on SA- and JA-signaling pathways in tomato, respectively.

G. margarita colonization enhanced disease resistance in tomato against necrotrophic pathogen B. cinerea , as well as the colonization with F. mosseae or R. irregularis 13 , 14 , 20 . The mechanisms of MIR have been investigated in many plant-mycorrhiza interactions. The tomato- F . mosseae interaction exhibited a protective effect against B. cinerea infection, which was likely related to the lower ABA levels in the mycorrhizal plants compared to those in the control 14 . In rice- R. irregularis interaction, defense regulatory genes are activated as a response to Magnaporthe oryzae infection 12 . The requirement of JA-mediated defense signaling for MIR was demonstrated in the resistance against Altenaria solani by interaction between the JA-biosynthesis-deficient tomato mutant spr2 and F. mosseae 15 .

Since gene expression analyses indicated that G. margarita colonization did not activate either SA- or JA-mediated defense signaling (Fig.  2 ), the disease resistance induced by G. margarita colonization was not SAR and the JA-mediated disease resistance but was due to priming of the plant defense system. Gene expression patterns after infection by Pst suggested that G. margarita -colonized plants were primed and able to respond more rapidly and strongly when challenged by a virulent bacterial pathogen compared to that in the water-treated control plants (Fig.  3 ). SAR accompanied by the expression of SA-related genes is effective against Pst in tomato 32 . Hence, the accelerated activation of the SA-mediated signaling pathway in response to infection presumably plays an important role in the disease resistance against Pst in G. margarita -colonized plants. Priming was previously reported as a type of resistance mechanism in plants interacting with arbuscular mycorrhizal (AM) fungi 30 , nonpathogenic bacteria 11 , 33 , and some chemicals 34 , 35 . Some of these priming mechanisms have been analyzed using bacterial pathogens, whereas the priming mechanisms of MIR have been analyzed only using fungal pathogens. Thus, this is the first demonstration of a priming response against a bacterial pathogen in MIR.

Examining both analyses with virulent and avirulent bacterial pathogens, tomato plants primed by G. margarita colonization were found to respond more rapidly and strongly to both types of pathogens, and in which activation of both SA- and JA-mediated signaling pathways could be enhanced (Figs. 3 , 5 and 6 ). The priming effects on each of these hormonal signal transductions differed according to the type of infecting pathogens, which is partly due to the antagonistic crosstalk between SA- and JA-mediated signaling pathways.

In analyses of defense response against avirulent pathogens, infection with Pso at the bacterial concentration as Pst (1 × 10 5  CFU/mL) provided unstable and unreliable data on gene expression (data not shown). This result was probably due to either—or both— intense response to the avirulent factors or the initiation of cell death events at an imperceptible rate. To precisely characterize cellular defense responses in mycorrhizal plants by avoiding these unfavorable conditions, we searched for the appropriate bacterial concentration for infection and sampling time points for gene expression analysis. We found that infection with Pso at a concentration of 1 × 10 4  CFU/mL resulted in a similar time course of gene expression patterns to those observed in the case of Pst .

Some plant-mycorrhiza interactions activate JA-related defense genes before the pathogen infection 14 , 15 , whereas tomato- G. margarita interaction, under the experimental conditions in this study, did not activate major defense genes, as presented here (Fig.  2 ). This difference is probably owing to the amount of G. margarita inoculum. Previous studies used more than 1,000 spores or propagules as the mycorrhiza inoculum per tomato plant and analyzed the primed plants more than 4 weeks after the mycorrhiza inoculation 14 , 15 . In this study, we analyzed the primed plant 2 weeks after treating plants with 25 spores of G. margarita . Nevertheless, these results indicated that the low colonization rate in our experiment was sufficient to analyze MIR, suggesting that even limited mycorrhizal colonization had the potential to promote systemic signaling to induce MIR. MIR is generally thought to be effective against necrotrophs but not against biotrophs 30 . Recently, it was proposed that SA- and JA-mediated defense signaling pathways were activated in the early and late stages, respectively, of mycorrhizal colonization 36 . In contrast, our study indicated that MIR induction without the activation of SA- and JA-mediated defense was effective against both necrotrophic and biotrophic pathogens. These results suggested that the effectiveness of MIR on necrotrophs or biotrophs was likely dependent on the SA-JA antagonistic crosstalk, although this is not the case for all MIRs .

Many plant-mycorrhizal interactions and the involvement of JA in the establishment of MIR, including colonization and defense response to pathogens, have been investigated 15 , 30 ; however, the signal transduction for resistance induction from colonization area to foliar tissues remains to be clarified. As different mycorrhizal symbiosis interactions probably induce different types of MIR, the use of the same bacterial pathogen will enable us to evaluate and compare the mechanisms of disease resistance induced by these MIRs. In this study, we selected the model bacterial pathogen Pst , which has been used in Arabidopsis research 37 , and used it for the evaluation of the induced resistance in tomato 11 , 32 . From the phytopathological point of view, a model pathogen provides valuable information to analyze defense mechanisms with respect to MIRs. Since many Pst mutants have already been identified and used to investigate the molecular mechanism of plant-pathogen interaction in Arabidopsis and also in tomato and tobacco plants 38 , 39 , they could be a potent tool to clarify the molecular mechanism of MIR in tomato.

In this study, to analyze the interaction between the primed plants and avirulent pathogens, we used the incompatible Pseudomonas strain, Pso . Gene expression analysis indicated that the primed plants responded rapidly and strongly to this avirulent pathogen, although the Pso infection induced HR in both of the primed and control tomato plants (Figs. 4 , 5 and 6 ). Most bacterial infections in nature are assumed to be caused by a low pathogen concentration—too low to induce HR in 24 h, as in the experimental condition—the priming effect on the avirulent pathogen, as shown here, would play an important role in defense. Enhanced responses to B. cinerea , Pst , and Pso suggested that the primed plants are able to recognize a broad range of microbial factors to protect themselves, in which pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-triggered immunity (ETI) should take part 40 . As the deletion of bacterial factors of an incompatible strain would provide further information about the defense response of the primed tomato plants, we analyzed the effects of flagellin-deficiency (Δ fliC ) on the defense response. The enhancement patterns of gene expression were different between Pso and Pso∆fliC, although it was difficult to conclude that this was owing to the lack of flagellin. Infection with the fliC mutant of P. syringae pv. tabaci in the non-host Arabidopsis caused a reduced HR and increased bacterial growth compared to that in the wild-type strain 41 . In the present study, the deletion of the fliC gene from Pso had no influence on HR under our experimental conditions. However, both defense response and its enhancement by priming, especially the expression of JA-related genes, after infection with this mutant were observed earlier than those with the wild-type strain. This result was probably due to the lack of recognition and response to flagellin or the lack of bacterial motility. Further analyses with other mutants, e.g., defective in hrcC and other hrp genes, would provide more information about the enhancement mechanism of defense responses in primed tomato plants.

This study demonstrated a fascinating potential of MIR that is effective to both fungal and bacterial pathogens simultaneously even with the low colonization rate. This indicates that symbiotic interaction primes some of the immune systems of host plants. Since a long period-colonization, such as for 2–3 months, activated JA-mediated defense signaling and was effective to fungal pathogens as shown in the tomato- F. mosseae interaction 14 , 15 , the physiological state of primed plants may vary according to the mycorrhizal colonization rates. Thus, analyzing the resistance against bacterial pathogens in other plant-mycorrhiza interactions would reveal the complex regulation mechanism of defense signals in MIR.

Preparation of gigaspora margarita spores

The inoculum of Gigaspora margarita Becker & Hall MAFF520054 was propagated using onion ( Allium cepa L.) cultured in a sterilized soil mixture of a horticultural medium (Kureha Chemical Co., Japan), sand (KOMERI Co., Ltd., Japan), and a humus-rich Andosol (KOMERI Co., Ltd., Japan) (1:5:4 [v/v/v]). Calcium carbonate (CaCO 3 ) (1 g/L) was added to maintain a pH of approximately 6. The onion- G. margarita co-culture was performed for three months and then air dried for a month. The potting medium containing root debris was maintained for more than a month at 4 °C. Spores were collected from the stocked soil samples using wet sieving followed by picking up using a glass Pasteur pipette (IWAKI, Japan) 42 . The operations were performed under sterile condition.

Construction of flagellin-deficient mutant of Pso

A flagella-deficient mutant of Pso was produced using a homologous recombination method to delete the fliC gene encoding flagellin protein. The DNA fragment including the fliC gene and adjacent regions of both sides of fliC (ca. 1.3 kb and 0.8 kb) were amplified by PCR with KOD-plus and a set of primers tgacttgctttaacctgccaagcg and ggttgccttgaccactgcttcatt, followed by the insertion into pCR-Blunt II-TOPO (Thermo Fisher Scientific, Waltham, MA, USA). The fliC gene region was removed by digestion at the Ssp I and Sca I sites, located outside of the 5’-end and 3’-end of the fliC gene, respectively, followed by blunt-end self-ligation. The modified DNA fragment (ca. 2.1 kb) containing only the adjacent regions of fliC was transferred from the pCR-Blunt II-TOPO to the mobilizable cloning vector, pK18 mobsacB 43 , by utilizing Xba I and Bam HI sites in the multi-cloning sites of these vectors. The resulting plasmid pMCPso was introduced into E. coli S17-1 by electrotransformation and then transferred to Pso by bacterial conjugation. The nalidixic acid-resistant and kanamycin-sensitive Pso colonies were selected as the fliC -deficient mutant, followed by PCR analysis to confirm the deletion.

Plant growth condition and mycorrhizal colonization

Tomatoes ( Solanum lycopersicum L. cv. Momotaro , Takii & Co., Ltd, Japan) were sown and grown in sterilized soil (Raising seedling soil, Takii & Co., Ltd, Japan) in plastic pots (5 cm × 5 cm × 5 cm) in a growth chamber (16:8 h L:D, 25 °C, 60% RH). One-week-old tomato seedlings were inoculated with mycorrhizal spores (25 spores per plant) by placing spores with a micropipette at 4 points (3-cm-deep) in the soil, 1.5 cm around the seedling, and returned to the growth chamber. Crushed spores (25 spores in 0.1 mL sterilized water) were prepared by crushing using a pestle with a small amount of fine-ground sea sand in a 1.5 mL plastic tube. To induce SAR, plants were treated with BIT (5 mg/pot) using the soil-drenching method 5 days before pathogen inoculation.

Pathogen inoculation assays

G. margarita -colonized (14 days after inoculation) and the water-treated plants were used for pathogen inoculation assay. Pst was cultured in nutrient broth containing rifampicin (100 µg/mL) at 30 °C for 24 h. Bacterial suspension (1 × 10 3  CFU /mL) prepared using 10 mM MgCl 2 were infiltrated into the terminal and its neighboring leaflets of the 4th compound leaves using a 1-mL syringe without a needle. Leaf disks (4-mm diameter) were taken from the infiltrated part of the leaflet 2 days after inoculation. Bacterial cells were extracted by homogenizing the leaf disks (5 disks per sample) in 10 mM MgCl 2 . The number of CFUs was estimated by culturing bacterial cells in nutrient broth agar plates after dilution. For each experiment, more than 4 plants were used and 8 samples were prepared. Pso and its mutant Pso∆fliC were cultured in nutrient broth at 30 °C for 24 h. Bacterial suspensions (1 × 10 4 , 1 × 10 5 , and 1 × 10 6  CFU/mL in 10 mM MgCl 2 ) were prepared and used for inoculation into leaflets of 4th compound leaves.

Quantification of mycorrhizal colonization

After 14 and 28 days of inoculation with G. margarita , tomato roots were washed gently with water to remove soil debris. Roots were cut into 2-cm segments and used for clearing with 10% KOH, acidifying with acetic acid, and staining with trypan blue 44 . The percentage of root colonization by G. margarita was determined by the gridline intersection method using a SZ61 stereo microscope (Olympus, Tokyo, Japan) under bright-field conditions 45 .

Extraction and analysis of SA

The terminal and its neighboring leaflets of the 4th compound leaves were harvested from the G. margarita -colonized (14 days after inoculation) and water-treated plants at the time of pathogen inoculation. Extraction and measurement of free and total SA (free SA + SA-glucoside) was performed as previously described 11 .

Gene expression analysis

For the gene expression analysis in leaves of the G. margarita -colonized (14 days after inoculation) and the water-treated control plants, terminal leaflets of the 4th compound leaves were harvested at the time of pathogen inoculation. These were used for total RNA extraction using Sepasol-RNA I super reagent (Nacalai Tesque, Kyoto, Japan), followed by cDNA synthesis using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio, Shiga, Japan). Quantitative RT-PCR was performed using a LightCycler 96 System (Roche, Basel, Switzerland). Thermal cycling conditions consisted of 30 s at 95 °C, 40 cycles of 5 s at 95 °C, and 20 s at 60 °C. The PCR reaction mixture contained 2 µL of tenfold diluted cDNA template, 0.8 µL of primer solution (containing 5 µM each of forward and reverse primers), 6.4 µL Milli Q water, and 10 µL of SYBR Premix Ex Taq II (Takara Bio, Shiga, Japan). Transcript levels were normalized to the expression of ACT4 measured in the same samples. The gene-specific primer pairs used are as follows: for PR1b , forward 5’- CTTGCGGTTCATAACGATGC-3’ and reverse 5’- TAGTTTTGTGCTCGGGATGC-3’; for PR2a , forward 5’- TCCCTTTTACTTGTTGGGCTTC-3’, reverse 5’- GGGCATTAAAGACATTTGTTTCTGG-3’; for LOXd , forward 5’-ATCTTGATGCTTTCACCGACA-3’, reverse 5’-ACACTGCTTGGTTGCTTTTCTTC -3’;for OPR3 , forward 5’-TCGTTTAATGAGGACTTTGAGGAAC-3’, reverse 5’-AGGATTAGAGATGAAAAGACGACCA-3’; for PI2 , forward 5’-ACGAAGAAACCGGCAGTGA-3’, reverse 5’-TTGCCTCCACCGAAAACC-3’; for ACT4 , forward 5’-TTGACTTGGCAGGACGTGA-3’, reverse 5’-CAGCTGAGGTGGTGAACGAG-3’.

Analysis of defense responses to pathogen infection

The culture and preparation of bacterial suspensions were performed using a method similar to that used for the pathogen-inoculation assay. The bacterial concentration of Pst was 1 × 10 5  CFU/mL, whereas those of Pso and Pso∆fliC were 1 × 10 4  CFU/mL to avoid the quick response leading to HR. Bacterial suspensions were infiltrated into terminal leaflets of the 4th compound leaves of the G. margarita -colonized (14 days after inoculation) and control plants, followed by a sampling of leaf tissues from the pathogen-infiltrated parts at several time points after inoculation. These were used for RT-PCR analysis. For each time point, more than 4 plants were used and 6 RNA samples were prepared.

Plant material collection and use permission

No permission is required for plant material as it was purchased from certified dealer of local area.

Ethics approval and consent to participate

The study has been conducted without violating any ethical codes of conduct.

Data availability

All data generated or analyzed during this study are present in this paper and the supplementary materials.

Kunkel, B. N. & Brooks, D. M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 5 , 325–331 (2002).

Article   CAS   PubMed   Google Scholar  

Pieterse, C., Leon-Reyes, A., Van der Ent, S. & Van Wees, S. C. M. Networking by small-molecule hormones in plant immunity. Nat. Chem. Biol. 5 , 308–316 (2009).

Durner, J., Shah, J. & Klessig, D. F. Salicylic acid and disease resistance in plants. Trends Plant Sci. 2 , 266–274 (1997).

Article   Google Scholar  

Lawton, K. A. et al. Benzothiadiazole induces disease resistance in Arabidopsis by activation of the systemic acquired resistance signal transduction pathway. Plant J. 10 , 71–82 (1996).

Yoshioka, K., Nakashita, H., Klessig, D. F. & Yamaguchi, I. Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action. Plant J. 25 , 149–157 (2001).

Van Peer, R., Niemann, G. J. & Schippers, B. Induced resistance and phytoalexin accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS417r. Phytopathology 91 , 728–734 (1991).

Van Wees, S. C. M. et al. Differential induction of systemic resistance in Arabidopsis by biocontrol bacteria. Mol. Plant Microbe Interact. 10 , 716–724 (1997).

Article   PubMed   Google Scholar  

Cartieaux, F. et al. Simultaneous interaction of Arabidopsis thaliana with Bradyrhizobium sp. strain ORS278 and Pseudomonas syringae pv. tomato DC3000 leads to complex transcriptome changes. Mol. Plant Microbe Interact. 21 , 244–259 (2008).

De Vleesschauwer, D., Cornelis, P. & Höfte, M. Redox-active pyocyanin secreted by Pseudomonas aeruginosa 7NSK2 triggers systemic resistance to Magnaporthe grisea but enhances Rhizoctonia solani susceptibility in rice. Mol. Plant Microbe Interact. 19 , 1406–1419 (2006).

Yasuda, M., Isawa, T., Shinozaki, S., Minamisawa, K. & Nakashita, H. Effects of colonization of a bacterial endophyte, Azospirillum sp. B510, on disease resistance in rice. Biosci. Biotechnol. Biochem. 73 , 2595–2599 (2009).

Fujita, M. et al. Effects of colonization of a bacterial endophyte, Azospirillum sp. B510, on disease resistance in tomato. Biosci. Biotechnol. Biochem. 81 , 1657–1662 (2017).

Campos-Soriano, L., García-Martínez, J. & San Segundo, B. The arbuscular mycorrhizal symbiosis promotes the systemic induction of regulatory defence-related genes in rice leaves and confers resistance to pathogen infection. Mol. Plant Pathol. 13 , 579–592 (2012).

Sanchez-Bel, P. et al. The nitrogen availability interferes with mycorrhiza-induced resistance against Botrytis cinerea in tomato. Front. Microbiol. 7 , 1598 (2016).

Article   PubMed   PubMed Central   Google Scholar  

Fiorilli, V., Catoni, M., Francia, D., Cardinale, F. & Lanfranco, L. The arbuscular mycorrhizal symbiosis reduces disease severity in tomato plants infected by Botrytis cinerea . J. Plant Pathol. 93 , 237–242 (2011).

Google Scholar  

Song, Y., Chen, D., Lu, K., Sun, Z. & Zeng, R. Enhanced tomato disease resistance primed by arbuscular mycorrhizal fungus. Front. Plant Sci. 6 , 786 (2015).

Martinez-Medina, A. et al. Recognizing plant defense priming. Trends Plant Sci. 21 , 818–822 (2016).

Pozo, M. J. & Azcón-Aguilar, C. Unraveling mycorrhiza-induced resistance. Curr. Opin. Plant Biol. 10 , 393–398 (2007).

Pozo, M. J. et al. Localized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophtora infection in tomato plants. J. Exp. Bot. 53 , 525–534 (2002).

Fritz, M., Jakobsen, I., Lyngkjær, M. F., Thordal-Christensen, H. & Pons- Kühnemann, J. Arbuscular mycorrhiza reduces susceptibility of tomato to Alternaria solani . Mycorrhiza 16 , 413–419 (2006).

Sanmartín, N. et al. Role and mechanisms of callose priming in mycorrhiza-induced resistance. J. Exp. Bot. 71 , 2769–2781 (2020).

Liu, J. et al. Arbuscular mycorrhizal symbiosis is accompanied by local and systemic alterations in gene expression and an increase in disease resistance in the shoots. Plant J. 50 , 529–544 (2007).

Miozzi, L. et al. Arbuscular mycorrhizal symbiosis limits foliar transcriptional responses to viral infection and favors long-term virus accumulation. Mol. Plant Microbe Interact. 24 , 1562–1572 (2011).

Maffei, G. et al. The arbuscular mycorrhizal symbiosis attenuates symptom severity and reduces virus concentration in tomato infected by Tomato yellow leaf curl Sardinia virus (TYLCSV). Mycorrhiza 24 , 179–186 (2014).

Song, Y. et al. Priming of anti-herbivore defense in tomato by arbuscular mycorrhizal fungus and involvement of the jasmonate pathway. J. Chem. Ecol. 39 , 1036–1044 (2013).

Maurya, A. K., Kelly, M. P., Mahaney, S. M. & Gomez, S. K. Arbuscular mycorrhizal symbiosis alters plant gene expression and aphid weight in a tripartite interaction. J. Plant Interact. 13 , 294–305 (2018).

Article   CAS   Google Scholar  

Rizzo, E., Sherman, T., Manosalva, P. & Gomez, S. K. Assessment of local and systemic changes in plant gene expression and aphid responses during potato interactions with arbuscular mycorrhizal fungi and potato aphids. Plants. 9 , 82 (2020).

Article   CAS   PubMed Central   Google Scholar  

Becker, W. N. & Hall, I. R. Gigaspora margarita , a new species in the endogonaceae. Mycotaxon 4 , 155–160 (1976).

Long, L., Lin, Q., Yao, Q. & Zhu, H. Population and function analysis of cultivable bacteria associated with spores of arbuscular mycorrhizal fungus  Gigaspora margarita . 3 Biotech 7 , 8 (2017).

Chialva, M. et al. Gigaspora margarita and its endobacterium modulate symbiotic marker genes in tomato roots under combined water and nutrient stress. Plants. 9 , 886 (2020).

Jung, S. C., Martinez-Medina, A., Lopez-Raez, J. A. & Pozo, M. J. Mycorrhiza-induced resistance and priming of plant defenses. J. Chem. Ecol. 38 , 651–664 (2012).

Shaul, O. et al. Mycorrhiza-induced changes in disease severity and PR protein expression in tobacco leaves. Mol. Plant Microbe Interact. 12 , 1000–1007 (1999).

Kusajima, M., Okumura, Y., Fujita, M. & Nakashita, H. Abscisic acid modulates salicylic acid biosynthesis for systemic acquired resistance in tomato. Biosci. Biotechnol. Biochem. 81 , 1850–1853 (2017).

Pieterse, C. M., Van Wees, S. C., Hoffland, E., Van Pelt, J. A. & Van Loon, L. C. Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis-related gene expression. Plant Cell 8 , 1225–1237 (1996).

CAS   PubMed   PubMed Central   Google Scholar  

Thevenet, D. et al. The priming molecule ß -aminobutyric acid is naturally present in plants and is induced by stress. New Phytol. 213 , 552–559 (2017).

Buswell, W. et al. Chemical priming of immunity without costs to plant growth. New Phytol. 218 , 1205–1216 (2018).

Miozzi, L. et al. Arbuscular mycorrhizal symbiosis: plant friend or foe in the fight against viruses?. Front. Microbiol. 10 , 1238 (2019).

Katagiri, F., Thilmony, R. & He, S. Y. The Arabidopsis thaliana - pseudomonas syringae interaction. Arabidopsis Book 1 , e0039 (2002).

Badel, J. L., Shimiz, R., Oh, H. S. & Collmer, A. A  Pseudomonas syringae pv.  tomato avrE1 / hopM1  mutant is severely reduced in growth and lesion formation in tomato. Mol. Plant Microbe Interact. 19 , 99–111 (2006).

Xin, X. F. & He, S. Y. Pseudomonas syringae pv. tomato DC3000: A model pathogen for probing disease susceptibility and hormone signaling in plants. Annu. Rev. Phytopathol. 51 , 473–498 (2013).

Ramirez-Prado, J. S., Abulfaraj, A. A., Rayapuram, N., Benhamed, M. & Hirt, H. Plant immunity: From signaling to epigenetic control of defense. Trends Plant Sci. 23 , 833–844 (2018).

Ishiga, Y. et al. Defense responses of  Arabidopsis thaliana  inoculated with  Pseudomonas syringae  pv.  tabaci  wild type and defective mutants for flagellin (Δ fliC ) and flagellin-glycosylation (Δ orf1 ). J. Gen. Plant Pathol. 71 , 302–307 (2005).

Uetake, Y., Kojima, T., Ezawa, T. & Saito, M. Extensive tubular vacuole system in an arbuscular mycorrhizal fungus Gigaspora margarita . New Phytol. 154 , 761–768 (2002).

Schäfer, A. et al. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum . Gene 145 , 69–73 (1994).

Vierheilig, H., Coughlan, A. P., Wyss, U. & Piche, Y. Ink and vinegar, a simple staining technique for arbuscular-mycorrhizal fungi. Appl. Environ. Microbiol. 64 , 5004–5007 (1998).

Article   ADS   CAS   PubMed   PubMed Central   Google Scholar  

Giovannetti, M. & Mosse, B. An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New Phytol. 84 , 489–500 (1980).

Download references

Acknowledgements

We thank H. Takeuchi, and A. Sugimoto (Fukui Pref. Univ.) for supporting plant cultures.

This work was partially supported by Ministry of Agriculture, Forestry and Fisheries under Science and Technology Research Promotion Program for Agriculture, Forestry, Fisheries and Food Industry (27004A) to K.Y., K.A., T.A., and H.N., by Grant-in-Aid for JSPS Fellows 19J14665 to M.Fuj, and by JSPS KAKENHI Grant Numbers 18K05656 to H.N.

Author information

These authors contributed equally: Moeka Fujita and Miyuki Kusajima.

Authors and Affiliations

Department of Bioscience and Biotechnology, Fukui Prefectural University, Eiheiji, Japan

Moeka Fujita, Miyuki Kusajima, Masatomo Fukagawa, Yasuko Okumura, Hisaharu Kato & Hideo Nakashita

Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, Japan

Miyuki Kusajima & Tadao Asami

Faculty of Agriculture, Ibaraki University, Ami, Japan

Masami Nakajima

Graduate School of Life and Environmental Sciences, Osaka Prefecture University, Sakai, Japan

Kohki Akiyama

Center for Bioscience Research and Education, Utsunomiya University, Utsunomiya, Japan

Koichi Yoneyama

You can also search for this author in PubMed   Google Scholar

Contributions

M.Fuj., M.K., K.A., T.A., K.Y., H.N. designed the experimental work. M.Fuj., M.K carried out the majority of the experiments. M.Fuk., Y.O., M.N., H.K. performed preparation of pathogens. M.Fuj., M.K., H.N. wrote the manuscript and all authors agreed on the final manuscript.

Corresponding author

Correspondence to Hideo Nakashita .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Additional information

Publisher's note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary information., rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .

Reprints and permissions

About this article

Cite this article.

Fujita, M., Kusajima, M., Fukagawa, M. et al. Response of tomatoes primed by mycorrhizal colonization to virulent and avirulent bacterial pathogens. Sci Rep 12 , 4686 (2022). https://doi.org/10.1038/s41598-022-08395-7

Download citation

Received : 12 January 2022

Accepted : 06 March 2022

Published : 18 March 2022

DOI : https://doi.org/10.1038/s41598-022-08395-7

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Adaptation of glycyrrhiza glabra l. to water deficiency based on carbohydrate and fatty acid quantity and quality.

• Tahereh Movahhed Haghighi
• Mohammad Jamal Saharkhiz
• Mehdi Zarei

Scientific Reports (2023)

Extended plant cognition: a critical consideration of the concept

• André Geremia Parise
• Michael Marder

Theoretical and Experimental Plant Physiology (2023)

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.