essay on tobacco plant

A Brief History of Tobacco in the Americas

The history of tobacco use in the Americas goes back over 1,000 years when natives of the region chewed or smoked the leaves of the plant now known as Nicotiana rustica (primarily in the north) and Nicotiana tabacum (mostly in the south). After European colonization , tobacco would become the most profitable crop exported from the Americas.

The secret of their Nicotiana tabacum blend was closely guarded by the Spanish – it was against the law to share seeds or plants with non-Spaniards – but travelers or merchants would do so anyway. When England began to colonize North America in the late 16th century CE, Sir Walter Raleigh (l. c. 1552-1618 CE) introduced the older, rougher, strain of tobacco – N. rustica – to Britain . By this time (c. 1585 CE), tobacco had already become a popular, recreational drug in the country, but N. rustica was a much harsher smoke than the Spanish N. tabacum .

The English colony of Jamestown was established in 1607 CE and a hybrid of various strains of N. tabacum was brought and planted by the merchant John Rolfe (l. 1585-1622 CE) in 1610 CE. Rolfe's crop not only made him wealthy but saved the Jamestown Colony of Virginia and further popularized tobacco use in England, throughout Europe , and in the rest of the world. Tobacco plantations expanded throughout Virginia as Jamestown itself began to grow, taking more land from the Native Americans of the region, and this practice finally resulted in the Anglo-Powhatan Wars (1610-1646 CE) which drove out most of the original inhabitants and made more room for even larger plantations.

The decrease in the practice of indentured servitude after 1676 CE, and the intense labor required for tobacco crops, led to the increase in importing African slaves and enslaving Native Americans. As tobacco became more popular, and more commercial businesses were established for its cultivation and sale, more land and more slaves were required. The original use of tobacco by the natives was forgotten as the plant became the most lucrative cash crop of the Americas.

It continued to fuel the colonial economy , contributed to the unrest which resulted in the American War of Independence (1775-1783 CE), increased tensions in the country leading up to the American Civil War (1861-1865 CE), and was the cause of the Tobacco Wars of the early 20th century CE. In the modern era, tobacco has been recognized as the leading cause of preventable deaths but continues in use by people around the world as one of the most accepted and popular recreational drugs.

Native American Uses & Colonization

Tobacco, along with the "three sisters" (beans, maize, and squash), potatoes, and tomatoes, was among the most significant crops cultivated by the natives prior to European colonization of the Americas . The plant was considered sacred and was frequently smoked or chewed as an appetite suppressant, a stimulant, for medicinal purposes, and to allow for communion with the spirit world. When Christopher Columbus (l. 1451-1506 CE), arrived in Cuba, the indigenous people offered him tobacco as a gift. Columbus seized on the plant and exported it to Spain where it found a large market.

Columbus instituted the feudal system of the encomienda which offered the natives protection from himself and his men, primarily, in return for labor. Tobacco became one of the main crops harvested on the large colonial plantations and, as demand for the plant grew in Europe, the Spanish overlords worked the natives harder. The Spanish priest Bartolomé de las Casas (l. 1484-1566 CE), who later witnessed the encomienda system first-hand, noted the brutality of the Spanish masters in his A Short Account of the Destruction of the Indies . After relating a number of atrocities the indigenous people suffered at the hands of the Spanish, he comments:

By the ferocity of one Spanish Tyrant (whom I knew), above two hundred Indians hanged themselves of their own accord [rather than continue to suffer in servitude] and a multitude of people perished by this kind of death . (23)

The Spanish had refined the original plant so that it smoked more easily and had a more pleasant taste, and this, of course, made it even more popular abroad. In 1561 CE, the French diplomat Jean Nicot de Villemain (l. 1530-1604 CE), who had been stationed in Lisbon, Portugal, returned to France with tobacco plants. He introduced tobacco to the French court as a medicine that could cure headaches and calm the nerves. Tobacco became an instant success at court, then in monasteries, and finally among the people in general. Nicot was rewarded by the French crown and his name was given to the active ingredient in tobacco, nicotine. The new market in France required greater efforts in production in the Americas. As tobacco became more profitable, more land was taken for production and more natives for forced labor.

Jamestown & John Rolfe

This same pattern would repeat itself in North America after Jamestown was established by the British in 1607 CE. Between 1607-1610 CE, Jamestown struggled, losing up to 80% of its population and, in 1609 CE, resorting to cannibalism just to survive. In 1610 CE, the merchant John Rolfe arrived along with Sir Thomas Gates (l. c. 1585-1622 CE) and Thomas West, Lord De La Warr (l. 1577-1618 CE) and reversed the colony's fortunes. De La Warr instituted a policy of conquest without compromise against the native Powhatan Confederation while Gates reformed both the colonists and their settlement. It was Rolfe, however, who saved the colony, expanded it, and provided justification for taking more Native American land when the tobacco seeds he had arrived with flourished and he became wealthy from the production and sale of Virginia tobacco.

Tobacco had already been cultivated in the regions around Virginia by the native Adena culture (c. 800 BCE - 1 CE), as evidenced by artifacts such as the Adena Pipe and others, and was continued by the Hopewell tradition (c. 100 BCE-500 CE), successors of the Adena, in modern-day West Virginia, Ohio, Pennsylvania, Kentucky, and Indiana. The native Powhatans had inherited tobacco cultivation, but this was the N. rustica variety. Rolfe's blend was the smoother N. tabacum, but his skill with the plant made it more popular than Spanish tobacco. Scholar Iain Gately comments:

John Rolfe's experiment heralded a rapid and permanent change in the fortunes of England's colonial enterprise. Englishmen understood the value of tobacco and needed little persuasion to finance its cultivation. The London marketplace welcomed increasing shipments of Virginian weed. The tobacco crop of 1618 was 20,000 pounds. Four years later, despite an Indian attack that killed nearly one-third of Virginia's colonists, the settlement sent a crop of 60,000 pounds. By 1627, the shipment totaled 500,000 pounds, and two years later that tripled. (72)

Although De La Warr had pushed a policy of conquest, it had not proved successful, and after he returned to England Rolfe tried a different approach: alliance through marriage. In 1614 CE, he married Pocahontas (l. c. 1596-1617 CE), daughter of the Powhatan chief (referred to by the colonists as Chief Powhatan ). It does not seem that Rolfe initially thought of his marriage as a political strategy – the couple were genuinely attracted to each other – but it served the purpose of uniting the natives and colonists for a few years and allowed for greater expansion of tobacco plantations.

Slavery & Tobacco

These farms were worked by indentured servants – people who, voluntarily or involuntarily, agreed to serve a master for seven years in return for passage to the New World and a land grant – but as the farms expanded, more labor was required than these servants could provide. Gately comments:

A solution appeared to Jamestown's labour problem in the form of a Dutch trading ship which dropped anchor in Chesapeake Bay in 1619. The colonists bought twenty African slaves who were set to work in the tobacco fields. The Dutch traders recognized a promising market and returned in subsequent years with more slaves for sale and slavery quickly became essential to the colony's economy. (73)

These early slaves seem to have been treated differently than those who were brought to the colony later. Scholar David A. Price notes:

Although it is tempting to assume that these first recorded Africans in English America were also the first slaves, there is evidence to suggest they were not. They may instead have had the legal position of indentured servants, like many of the white newcomers, eligible for freedom after completing a period of service. (197)

Part of the evidence Price references is the presence of free blacks in the colony prior to 1640 CE who had received land just as white indentured servants had. The year 1640 CE marks a turning point in the treatment of black servants as opposed to white servants in the case of the black indentured servant, John Punch. Punch objected to his treatment by his master and left his service, without fulfilling his contract, in the company of two other servants who were white. When the three were caught, the two white servants had their servitude extended by four years while Punch was sentenced to slavery for the rest of his life. Slavery was institutionalized in Virginia by 1661 CE and, although there were still free blacks in the colony, race now played a much larger part in community affairs and policies than it had previously.

Sign up for our free weekly email newsletter!

Expansion & Economy

By 1661 CE, the Powhatans had been defeated in three separate wars and the colonists had discovered that Native Americans did not make the best slaves. This realization did nothing to stop them from selling the natives to others, but the white landowners found African slaves to be stronger and able to endure labor longer. The colony expanded further as more indentured servants completed their contracts and were given land and the farms in the interior began encroaching on the lands the Powhatans had retreated to.

In 1676 CE, one of the interior landowners, Nathaniel Bacon (l. 1647-1676 CE) mounted a revolt ( Bacon's Rebellion ) against the governor William Berkeley (l. 1605-1677 CE), demanding better lands for farmers in the interior and the massacre or relocation of the Powhatans still in the area who would sometimes raid these farms. Berkeley refused Bacon's demands, and the insurrectionists then burned Jamestown. The rebellion fell apart when Bacon died of dysentery, but the authorities recognized the danger of continuing to award land grants to indentured servants who might then use their resources to fund revolt and so ended that policy.

From that point on, manual labor on the plantations would be taken care of by Africans purchased as slaves. Slaves who worked tobacco plantations soon were regarded as more valuable than those who worked in cotton or rice fields because tobacco required more skill to harvest. New slaves were apprenticed to older veterans of the fields to learn these skills and slave families were frequently separated when a skilled tobacco slave was kept but his or her family sold.

Tobacco & the Revolution

As the European demand for tobacco grew, more land was required for plantations and so, first, more Native Americans had to be removed from their tribal lands and, second, more Africans were needed as slaves. The colonies of Maryland and North Carolina became the next two greatest tobacco producers after Virginia, and by the early 1700s CE, all three were exporting thousands of pounds of tobacco to Europe every year. The British monarchy discouraged the production of cotton in the colonies owing to the economic policy of mercantilism (which balances exports over imports) so tobacco became the primary cash crop. Even though James I of England (r. 1603-1625 CE) objected to tobacco, he could not argue with the profits and settled for taxing tobacco instead of banning it.

The tobacco farmers stamped their product with seals to identify it, and certain plantations became known for better tobacco than others. Shipments of tobacco would arrive in London where they were handled by merchants, who would push one brand of tobacco for a higher price over others. These merchants also periodically depressed tobacco prices while still providing large loans to the colonial planters. The plantation owners, therefore, found themselves in the position of owing substantial debt they were unable to pay due to depressed London markets.

By this time (c. 1750 CE), tobacco was used in the colonies as currency and so the London merchants could demand payment on the loans in tobacco when planters found they could not pay in cash. This situation contributed to the outrage colonists felt over England's policies in the colonies and encouraged the rebellion that became the American Revolutionary War since a number of the Founding Fathers, including Thomas Jefferson and George Washington, were tobacco farmers.

Civil & Tobacco Wars

Tobacco continued to inform the economy and policies of the United States into the 19th century CE. As the northern states became more industrialized, they required less slave labor, and many abolished the institution. The southern states, however, continued to rely on slaves for labor in the tobacco and cotton fields. Southern goods were frequently shipped to the north and were taxed but, the states felt, nothing of consequence was coming from the north to them as compensation; disagreements over equitable trade and the southern states' defense of slavery finally led to conflict.

Southern states broke with the union that had been formed after the Revolution, declaring themselves a separate entity, the Confederate States of America. Northern states responded by defining this action as rebellion and so the American Civil War (more properly known as the War Between the States) was begun. By the time the south was defeated in 1865 CE, slavery had been abolished, large plantations could no longer function as they once had, and former slaves now had to be paid a fair wage.

The southern states were able to get around the new model by instituting laws on vagrancy whereby someone (almost always a black man) newly arrived in town, who could not provide a legal address, was arrested and sentenced to work on a local plantation. Planters who were provided with these “workers” were able to produce more tobacco at less cost than others with more modest farms who paid their laborers. The farmers sold their product to a distributor who then marketed it to the public, and those with the cheapest labor grew rich enough to also manage distribution.

The biggest distributor in the 19th and early 20th centuries was American Tobacco Company founded by James Buchanan Duke (l. 1856-1925 CE) who had nothing to do with production and everything with sales. He acquired all rights to the new cigarette-rolling machine in 1881 CE which was able to produce 400 cigarettes a minute. Having lowered his costs, he cut his prices, forcing competitors out of business who then sold their companies to him, allowing Duke to form a monopoly on the market. He then offered lower compensation to farmers for their crops which eventually resulted in the Tobacco Wars (better known as the Black Patch Tobacco Wars) of 1904-1909 CE in the region of Black Patch, Tennessee, a collection of counties so-named for the dark smoke from the tobacco-curing process.

The wars were a series of conflicts between tobacco suppliers and distributors and a coalition of farmers calling itself the Planter's Protective Alliance which burned storehouses, farms, and warehouses and periodically hanged sharecroppers who worked on farms supplying Duke. The wars ended when the leaders were arrested in 1908-1909 CE and the American Tobacco Company was dismantled by the federal government in 1911 CE.

Cigarettes had been looked down upon as associated with the lower-class and poor while the pipe or cigar was the preferred method for smoking tobacco by the affluent. Mass production and mass marketing, however, changed that, and by World War I (1914-1918 CE) cigarettes were included in military rations and associated with patriotism. Tobacco use, by this time, had become common practice worldwide, even though some countries had tried to ban it, even going so far as to execute tobacco merchants and users.

In the present day, efforts by groups such as the American Cancer Society have proved somewhat more effective and health warnings or images of diseased lungs are required on tobacco products. Tobacco companies are also no longer allowed to advertise on television or in magazines, and health professionals continually stress smoking tobacco as a cause of lung cancer. Even so, people around the world continue to use tobacco in spite of decades of warnings on its dangers.

Recognizing the plant's popularity, some Native American groups are now trying a different approach to curb smoking: to revive the sacred nature of tobacco. Those involved in these efforts claim that they have seen a reduction in the number of smokers in their community who have come to recognize tobacco in its sacred form, carefully cultivated from the earth to final product, as it was over 400 years ago, and so now treat it, and themselves, with greater respect.

Subscribe to topic Bibliography Related Content Books Cite This Work License

Bibliography

• de Las Casas, B. & Griffin, N. & Pagden, A. A Short Account of the Destruction of the Indies. Penguin Classics, 1999.
• Drake, S. G. History of the Early Discovery of America and Landing of the Pilgrims. Nabu Press, 2010.
• Gately, I. Tobacco: A Cultural History of How an Exotic Plant Seduced Civilization. Grove Press, 2003.
• Goodman, J. Tobacco in History: The Cultures of Dependence. Routledge, 1994.
• Historical Influences on Contemporary Tobacco Use by Northern Plains and Southwestern American Indians by Stephen J. Kunitz Accessed 7 Feb 2021.
• Horn, J. A Land As God Made It: Jamestown and the Birth of America. Basic Books, 2006.
• Mann, C. C. 1491: New Revelations of the Americas Before Columbus. Vintage, 2006.
• Mann, C. C. 1493: Uncovering the New World Columbus Created. Vintage, 2012.
• Price, D. A. Love and Hate in Jamestown: John Smith, Pocahontas, and the Start of a New Nation. Vintage, 2005.
• The Fight to Keep Tobacco Sacred by Dina Fine Maron Accessed 7 Feb 2021.

About the Author

Translations

We want people all over the world to learn about history. Help us and translate this article into another language!

Related Content

Jamestown Colony of Virginia

Henricus Colony of Virginia

Tobacco & Colonial American Economy

European Colonization of the Americas

Free for the world, supported by you.

World History Encyclopedia is a non-profit organization. For only $5 per month you can become a member and support our mission to engage people with cultural heritage and to improve history education worldwide.

Recommended Books

Cite This Work

Mark, J. J. (2021, February 10). A Brief History of Tobacco in the Americas . World History Encyclopedia . Retrieved from https://www.worldhistory.org/article/1677/a-brief-history-of-tobacco-in-the-americas/

Chicago Style

Mark, Joshua J.. " A Brief History of Tobacco in the Americas ." World History Encyclopedia . Last modified February 10, 2021. https://www.worldhistory.org/article/1677/a-brief-history-of-tobacco-in-the-americas/.

Mark, Joshua J.. " A Brief History of Tobacco in the Americas ." World History Encyclopedia . World History Encyclopedia, 10 Feb 2021. Web. 09 Jun 2024.

License & Copyright

Submitted by Joshua J. Mark , published on 10 February 2021. The copyright holder has published this content under the following license: Creative Commons Attribution-NonCommercial-ShareAlike . This license lets others remix, tweak, and build upon this content non-commercially, as long as they credit the author and license their new creations under the identical terms. When republishing on the web a hyperlink back to the original content source URL must be included. Please note that content linked from this page may have different licensing terms.

Our top issues

In our fight to end smoking, vaping and nicotine addiction, we focus on the issues that matter most. We constantly monitor the latest topics and trends in tobacco and substance use.

• Youth vaping, smoking & nicotine use
• Menthol & flavored tobacco products
• Harm reduction
• Tobacco & social justice
• Tobacco-free communities & campuses
• Tobacco industry interference
• Tobacco in pop culture
• Quitting smoking & vaping
• Opioids crisis

Truth Initiative is America's largest nonprofit public health organization committed to making tobacco use and nicotine addiction a thing of the past.

• Our mission
• Our history
• Annual reports

Research & resources

Get the latest facts and analyses on the most important issues related to smoking, vaping, nicotine and substance use.

Search by keywords

• Emerging tobacco products
• Traditional tobacco products
• Targeted communities
• Smoking by region
• Quitting smoking / vaping

We give young people the facts about smoking, vaping, nicotine and the tobacco industry, engage individuals and groups to make change in their communities, innovate ways to end nicotine addiction and join forces with collaborators committed to a future where tobacco and nicotine addiction are a thing of the past.

Truth Initiative Schroeder Institute®

truth® campaign

• Community & youth engagement
• Quit smoking & vaping tools
• Corporate tobacco cessation programs
• Truth Initiative Impact Series
• Partnerships

Get involved

Enlist in our movement, explore youth activism programs, share quitting resources and learn about more ways you can get involved.

• Take action
• Partner with us
• Request a training
• Participate in our research
• Apply for grants or scholarships

Join our newsletter

Search our site.

Top Searches

• Quit vaping
• Youth Activism
• Grants & Scholarships
• Featured Community Projects
• Quit smoking & vaping tools
• Featured Partnerships
• Partnership Opportunities
• Why Partner With Us
• Youth vaping, smoking & nicotine use
• Menthol & flavored tobacco products
• Harm Reduction
• Tobacco & social justice
• Tobacco-free communities & campuses
• Quitting smoking & vaping
• Opioid crisis
• Popular topics
• News & Insights
• Fact sheets
• Research articles
• Help Quitting
• Opioid Crisis
• Curriculums

Sign up for our newsletter

• Research and resources

Tobacco and the environment

• Harmful Effects of Tobacco
• Environment

RELATED MATERIALS

Most young users put disposable e-cigarettes in trash, creating huge streams of toxic and hazardous waste, as companies fail to take responsibility

A toxic, plastic problem: E-cigarette waste and the environment

Tobacco doesn’t just negatively impact the health of individuals, it also endangers the health of the environment. E-cigarette and cigarette waste can make its way into the environment where it pollutes water, air, and land with toxic chemicals, heavy metals, and residual nicotine. An estimated 766,571 metric tons of cigarette butts make their way into the environment every year , and according to the Bureau of Investigative Journalism, at least five disposable e-cigarettes are being thrown away every second in the United States , amounting to 150 million devices per year – which together contain enough lithium for about 6,000 Teslas. E-cigarette waste contributes to the already overwhelming issue of general electronic waste: in 2019, Americans generated 6.92 kilotons of consumer electronic waste, including e-cigarette waste , all bound for landfills or incinerators. The total amount of e-waste generated globally in 2019 was 53.6 metric tons, and this number is projected to rise to 74.7 metric tons by 2030 .

Cigarette butts are the most frequently littered item in U.S. beaches and waterways.  The largest U.S. cigarette companies sold about 190.2 billion cigarettes nationwide in 2021 alone. Cigarette butts are often disposed of on streets, sidewalks, and other public areas, and may then be carried as runoff to drains and ultimately end up polluting rivers, beaches, and oceans. Because cigarette butts are primarily made of plastic filters that don’t biodegrade, the butts that aren’t eaten by wildlife simply pile up on shorelines or at the bottom of bodies of water.

The problem isn’t limited to cigarettes. E-cigarettes contain plastic, electronic and chemical waste and many of them may also end up as litter – a growing problem as the products increase in popularity. In 2022, 321.4 million units of e-cigarettes were sold, generating $5.1 billion in convenience store e-cigarette sales alone. Corporations are projected to reach $8.3 billion in annual e-cigarette revenue in 2023. The lack of safe and environmentally friendly ways to dispose of e-cigarette waste is a growing dilemma, especially given the rise of disposable e-cigarettes. In 2022, the U.S. Food and Drug Administration found that 2.5 million middle school and high school students reported currently using e-cigarettes, with over half of them using disposables. After disposable e-cigarettes were exempted from federal restrictions on flavors in 2020, they skyrocketed in popularity,  with use increasing about 1,000% (from 2.4% to 26.5%) among high school e-cigarette users during 2019-2020. Inexpensive, flavored disposable e-cigarettes such as Puff Bar, which controlled over half of the disposable e-cigarette market in 2021, and Elf Bar have gained popularity and further contribute to e-cigarette waste. This increase in disposable e-cigarette products will eventually become tons of e-cigarette waste as products reach end-of-life.

• Cigarette butts have comprised 30%-40% of items collected in annual coastal/urban cleanups since the 1980s.
• Cigarette butts are the most prominently littered item on U.S. roadways, retail areas, storm drains, loading docks, construction sites and recreational areas.
• Globally, 1,134,292 cigarette butts were cleaned up in beaches and waterways in 2021, making them the world’s second most common type of litter after food wrappers, exceeding plastic bags and straws. Cigarette butts collected in U.S. beaches and waterways amount to over half of that figure making them the number one littered item collected by environmental cleanup crews in the U.S.
• However, not all cigarettes butts that are littered are collected. The 2020 Keep America Beautiful survey estimates that the actual number of cigarette butts polluting our environment is closer to 9.7 billion cigarette butts polluting roadways and waterways combined , along with 392 million pieces of other tobacco-related products and packaging, making up nearly 20% of all U.S. litter.
• Environmental cleanup efforts are a valuable and helpful endeavor, but they are not enough to combat the effect of littered tobacco. An overall reduction in tobacco use is essential to curbing the detrimental effects on fish, wildlife, public health, and water quality.
• 79% of smokers consider cigarette butts to be litter, but the majority of smokers (72%) reported littering a butt on the ground at least once in their lifetime and 64% reported tossing them out of a car window at least once in their lifetime.
• Smokers litter 47% of the cigarette butts they smoke.

E-CIGARETTES

• In 2020, Keep America Beautiful counted 894,700 littered e-cigarettes in U.S. roadways and waterways.
• According to a 2022 Truth Initiative survey, over two-thirds of disposable e-cigarette users disposed of the hazardous waste in the trash, where it can start fires in bins, waste trucks, or in waste processing facilities and 9% of young users littered their devices on the ground. Only 8% of young vape users disposed of their e-cigarettes properly through e-waste facilities.
• Inadequate or nonexistent safe product disposal guidelines from e-cigarette companies, a lack of recycling programs equipped to process e-cigarette waste, and limited federal guidelines inapplicable to the most popular variety of vapes and disposables, all contribute to the environmentally and publicly hazardous disposal methods common among young users.
• E-cigarette manufacturers do not provide guidance to consumers on how to dispose of used devices or pod/cartridge products , and there are no receptacles or specific processes in place. 
• The average e-cigarette device has a short life span and is often replaced with a newer, more efficient version before it stops working. The average e-cigarette battery only lasts approximately 6-8 months with normal use.
• Disposable e-cigarettes are single-use plastic products designed to reach their end-of-life much more quickly.

The actual number of cigarette butts polluting our environment is closer to 9.7 billion cigarette butts polluting roadways and waterways combined

BIODEGRADABILITY

Cigarette filters are made from cellulose acetate, a plastic which only degrades under severe biological circumstances, such as when filters collect in sewage. In practice, cigarette butts tossed on streets and beaches do not biodegrade .

• Under optimal conditions, it can take at least nine months for a cigarette butt to degrade .
• The sun may break cigarette butts down, but only into smaller pieces of waste which dilute into water/soil.

Growing concerns over the impact of tobacco waste on the environment, as well as the substantial costs of cleanup, have prompted states, municipalities, and institutions to enact a variety of policy actions. For example, 312 municipalities prohibited smoking on beaches and 1,497 prohibited smoking in parks as of July 2017 . In 2022, Florida passed a bill that allows municipalities and counties to restrict smoking on public beaches and in parks. This move was welcomed and backed by several local government bodies and constituents aiming to preserve the state’s delicate natural ecosystem, which includes coral reefs, wetlands, a dense forests. Additionally, four jurisdictions in California (Monterey, Monterey County, San Benito County, and Soledad) have prohibited the sale of single-use e-cigarettes.

Unlike cigarette butts, e-cigarette waste cannot be biodegradable even under severe weather conditions. E-cigarette cartridges discarded on streets mix with leaf litter and get pushed around by weather events, eventually breaking down into microplastics and chemicals that flow into storm drains to pollute waterways and wildlife. E-cigarette-related waste is potentially a more serious environmental threat than cigarette butts because it contains metal, circuitry, disposable plastic cartridges, batteries, and toxic chemicals in e-liquids. Currently, there are only two ways to safely dispose of e-cigarette cartridges: return to e-cigarette manufacturers and vendors for recycling or rinse under running water to remove nicotine residues, wrap in a scrap of biodegradable material, and discard as a plastic waste.

312 municipalities prohibited smoking on beaches and 1,497 prohibited smoking in parks as of July 2017.

LAND, COASTAL AND WATER POLLUTION

Cigarette and e-cigarette waste can pollute soil, beaches, and waterways. Studies have also shown that cigarette and e-cigarette waste is harmful to wildlife.

• Cigarette butts cause pollution by being carried as runoff to drains and from there to rivers, beaches and oceans.
• Preliminary studies show that organic compounds (such as nicotine, pesticide residues and metal) seep from cigarette butts into aquatic ecosystems , becoming acutely toxic to fish and microorganisms.
• In one laboratory study, the chemicals that leached from a single cigarette butt (soaked for 24 hours in a liter of water) released enough toxins to kill 50 percent of the saltwater and freshwater fish exposed to it for 96 hours.
• Another laboratory study found that cigarette butts can be a source for heavy metal contamination in water , which may harm local organisms.
• A study of the effects of roadside waste on soil found that patterns of hydrocarbon levels in the soil were similar to those of littered cigarette butts. This indicates that the chemicals in the soil had seeped out of cigarette butts. Some hydrocarbons are carcinogenic .
• Both the batteries and e-cigarette devices themselves contain hazardous substances such as lead and mercury .
• Incompletely used liquid cartridges and refills contain nicotine salts and heavy metals, which leach into soil and waterways or can be ingested by wildlife .
• Before lithium-ion batteries can be placed in the trash, they need to be fully discharged and cooled, submerged in cold saltwater for two weeks – covered securely with lid – and wrapped in newspaper .
• In California, 40% of the fires at waste facilities between 2016-2018 were reported to have been caused by lithium-ion batteries . Vape batteries may be the greatest threat to waste management programs.
• In New York in 2022, firefighters responded to over 200 lithium-ion battery fires stemming from e-scooters and bikes, making lithium-ion batteries the third leading cause of fires in the city.
• London Heathrow Airport’s Grundon waste processing facility reported three fires within the past six months in 2023, each suspected to be the result of discarded lithium-ion batteries in disposable vapes . A study by Material Focus , a British not-for-profit aimed at reducing and recycling e-waste, found that 1.3 million disposable vapes are disposed of weekly in the U.K., about 2 vapes per second .
• In 2022, leaders from 18 different environmental and public health groups directed an open letter to the U.K.’s Environment Secretary and Health Secretary urging them to launch a full-scale ban on disposable e-cigarettes .

THE TOBACCO INDUSTRY’S EFFECTS ON DEFORESTATION

• Research has found that growing tobacco contributes to deforestation , especially in the developing world. Deforestation for tobacco plantations promotes soil degradation and “failing yields” or the capacity for the land to support the growth of any other crops or vegetation.  Tobacco farming is responsible for 5% of all global deforestation.
• Tobacco farmers typically clear land by burning it. But this land is often agriculturally marginal and is abandoned after only a few seasons, contributing in many cases to desertification . Burning increases greenhouse gas levels by generating water and air pollutants, and decreasing forest cover which would otherwise absorb the almost 84 million metric tons of CO2 emitted by tobacco production annually.
• Production and consumption of tobacco releases carbon dioxide equivalent to driving 17 million gas powered cars each year , according to a 2022 report from the World Health Organization.
• 718,217 pounds of toxic chemicals were released from U.S. tobacco production facilities in 2021. This number has increased from 674,309 pounds in 2020.
• Tobacco production uses more water and wood, and has more pesticides applied to it, than most other crops , further affecting water supplies and contamination of the soil. Tobacco growth uses 22 billion tons of water every year.

• Approximately 600 million trees are chopped down every year by the tobacco industry . On average each tree produces enough paper for 15 packs of cigarettes.
• Tobacco manufacturers use four miles of paper every hour to wrap and package cigarettes and other products – making the entire industry a sizeable contributor to deforestation. This also leads to the creation of over 2 million tons of packaging waste every year.
• Since e-cigarettes quickly rose in popularity in an under-regulated environment, we know little about how e-cigarettes are manufactured and the environmental impact of the production process. Because of the significant impact this rapid rise has had on public health, until recently research and policy on e-cigarettes has focused on the youth e-cigarette crisis and lack of regulation rather than the product’s environmental impact .
• E-cigarette companies were required to submit information by September 9, 2020 on the environmental impact of their products as part of applications to the Food and Drug Administration to keep their products on the market, but this information is not yet publicly available.
• The lithium contained in e-cigarette batteries is not just an environmental and public health hazard when discarded, but a precious natural resource that must be conserved, reused, and recycled . The ten tons of lithium discarded in vapes yearly in the U.K. alone is enough to construct 1,200 electric vehicles . Meanwhile, the International Energy Agency estimates the world will face lithium shortages by 2025 . Combined with the complicated ethics of sourcing precious resources like lithium and cobalt, including human rights abuses like child labor, forced labor, and hazardous work conditions, disposable e-cigarettes are a tragic waste of this precious element .

INDUSTRY ACCOUNTABILITY FOR TOBACCO WASTE

• Many e-cigarette manufacturers simply direct users to hazardous waste/electronic waste disposal companies, which often don’t accept e-cigarettes.
• From the cellulose acetate of cigarette butts to e-liquid residue and batteries, waste management and hazardous waste disposal plants are not currently equipped to handle either type of waste . Federal regulations have not yet caught up to the need for guidance on disposal.
• Currently, there is no legal way to recycle e-cigarettes in the U.S and no documented baseline standards for end-of-life disposal by manufacturers. There is no requirement in place to hold manufacturers accountable for the post-consumer waste they helped produce or to devise a clear and safe system to dispose of these items as hazardous materials or e-waste.
• Even though guidance exists on best practices for holding companies like tobacco manufacturers accountable for reducing or disposing of the post-consumer waste that results from use of their products, they are not currently enforced across the industry by any governing body including the Environmental Protection Agency .
• States and local agencies that have the authority to enforce hazardous waste penalties can help reduce the environmental impact . As of January 2022, violators of hazardous waste requirements can incur civil penalties of up to $81,540 per day . In 2006, Washington state became one of the first states in the nation to pass a law putting the responsibility for recycling e-waste on the producer , not taxpayers. Manufacturers that produce electronics were required to pay for and manage their recycling.

The tobacco industry is responsible for producing much more than tobacco products — they are guilty of creating hundreds of thousands of pounds of cigarette and e-cigarette waste each year.

TOBACCO INDUSTRY NEGLIGENCE

The tobacco industry is responsible for producing much more than tobacco products—they are guilty of creating hundreds of thousands of pounds of cigarette and e-cigarette waste each year. Cigarette and e-cigarette waste presents serious threats to the ecosystem and requires a long-term solution. Instead of accepting responsibility for their products, tobacco companies are presenting topical solutions to the environmental problems their products create in a ploy for positive press attention.

Some tobacco companies have included reducing the amount of cigarette butts in the environment as part of their sustainability goals . For example, Philip Morris International claims it endeavors to reduce plastic litter from its products by 50% from 2021 to 2025 as part of its “Our World Is Not an Ashtray” initiative. Campaigns like this one appear to be hypocritical and misleading to the public . The tobacco industry not only created this new waste stream in the first place, but they are also trying to greenwash their harmful practices through misdirection and public displays of eco-activism.

POLICIES TO PROTECT THE ENVIRONMENT

Tobacco manufacturers need to be held responsible for the extreme amounts of litter that their products create and should facilitate the environmentally safe disposal of their products – both combustible and electronic . Strong local regulations coupled with financial penalties are needed to limit e-cigarette waste and reduce the negative environmental consequences of tobacco products. Such policies have strong support, with 72% of U.S. adults supporting the addition of a $0.75 litter fee for cigarette packs in a 2021 Truth Initiative study. Increasing consumer awareness of the environmental toxicity and dangers posed by discarding cigarette and e-cigarette related waste into landfills, and encouraging smokers and vapers to quit using these products altogether, are the best ways to protect the environment from tobacco product waste.

The federal government could do more as well, including ensuring the tobacco industry is held accountable for waste they produce and enforcing all guidance and best practices regarding tobacco products waste disposal; establishing product and packaging standards that reduce the amount of packaging waste, plastics waste, and hazardous chemicals from tobacco products; requiring tobacco companies to establish recycling programs and other options for properly disposing of tobacco product waste. On a global scale, 175 countries in the United Nations have already committed to developing a legally binding international treaty against pollution and waste from plastic production, use, and disposal by 2024. This treaty, when drafted and enacted, will address the “root causes of plastic pollution” rather than its symptoms. This will be achieved by targeting the entire lifecycle of a single use plastic product from design to production and disposal. This move towards a circular economy from global leaders may finally make an impact on tobacco industry waste, along with many other environmentally detrimental industries and practices.

TAGS: environment the truth about

More in harmful effects of tobacco

3 ways tobacco use impacts your sex life

Vaping advocates promote false claims on Twitter about COVID-19 and e-cigarettes

History of Tobacco

• First Online: 01 January 2009

Cite this chapter

• Knut-Olaf Haustein 3 &
• David Groneberg 4  

2074 Accesses

Nicotiana tabacum , the tobacco plant used since ancient times in the Central and South America, does not occur naturally but is a product of human cultivation [1], being a hybrid of Nicotiana sylvestris and Nicotiana tomentosifosa [2]. Nicotiana rustica (developed later in Russia as machorka) was the variety cultivated in North America, and has a higher nicotine content than the other tobacco plants. Illustrations of tobacco plant appeared under the name of Nicotiana major in the seventeenth-century herbals (Fig. 1.1) because tobacco was believed to possess healing properties [3]. The nicotine content of the tobacco leaves is increased if the leading stem of the plant and its lateral shoots are removed (a process known as “topping and suckering”), and drying improves the flavour of the leaves [1]. The juice of lime is used to enhance the flavour of some tobacco varieties [4], and in the process the nicotine release as a free base is improved [5].

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

• Available as PDF
• Read on any device
• Instant download
• Own it forever
• Available as EPUB and PDF
• Compact, lightweight edition
• Dispatched in 3 to 5 business days
• Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

Akuhurst BC (1981) Tobacco. Longman, London

Google Scholar  

Japan Tobacco Plant Breeding & Genetic Research Laboratory (1994) The genus Nicotiana illustrated

Tabernaemontanus DIT (1664) New vollkommen Kräuter-Buch. Johann Königs, Basel

Wilbert J (1987) Tobacco and Shamanism in South America. Yale University Press, New Haven

Travell J (1940) The influence of the hydrogen ion concentration on the absorption of alkaloids from the stomach. J Pharmacol Exp Ther 69:23–33

Robicsek F (1978) The smoking gods. Tobacco in Maya art, history and religion. The University of Oklahoma Press, Norman

Corti ECC (1930) Die trockene Trunkenheit: Ursprung, Kampf und Triumph des Rauchens . Insel, Leipzig

Tiedemann F (1854) Geschichte des Tabaks und anderer ähnlicher Genussmittel. H. L. Brömmer, Frankfurt

Monardes N (1970) Joyful Newes Out to the Newe Founde Worlde. London. 1577 (reprint). Da Capo Press, Amsterdam

Laufer B (1924) Introduction of tobacco into Europe. Field Museum of Natural History, Chicago

Brooks JE (1952) The mighty leaf. In: Little B (ed) Tobacco through the centuries. Little Brown, Boston

Sandgruber R (1994) Genussmittel. Ihre reale und symbolische Bedeutung im neuzeitlichen Europa. In: Jahrbuch für Wirtschaftsgeschichte. Akademie, Berlin, pp 73–88

Jacob. (1603) MBR. Misocapnus seu de abusu tabaci lusus regius. London

Precht K, Baumgartner HJ (1993) Tabak. Gewohnheiten, Konsequenzen. Edition diá, St. Gallen

Bunbury H (1794) A Smoking Club. S.W. Fores No. 3, Piccadilly

Tilley NM (1948) The bright-tobacco industry, 1860–1929. University of North Carolina Press, Chapel Hill

Slade J (1993) Nicotine delivery devices. In: Orleans CT, Slade J (eds) Nicotine addiction: principles and management. Oxford University Press, New York, pp 3–23

Tilley NM (1985) The R.J. Reynolds Tobacco Company. University of North Carolina Press, Chapel Hill

Kluger R (1996) Ashes to ashes. America’s Hundred-Year Cigarette War, the Public Health, and the Unabashed Triumph of Philip Morris. Alfred A. Knopf, New York

Lorillard P Jr (1895) American tobacco factories. In: Depew CM (ed) One hundred years of American commerce. Haynes, New York

Goodman J (1993) Tobacco in history. The cultures of dependence. Routledge, London

Lickint F (1939) Tabak und Orgnaismus. In: Handbuch der gesamten Tabakkunde. Hippokrates, Stuttgart, pp 1232

(1938–1939) Pennsylvania Med J 42:471

Posselt WH, Reimann KL (1821) Bemerkungen Nicotinanin und seine Eigenschaften. Schweigger u Meinicke Neues Journal für Chemie und Physik, pp 1–442

Posselt WH, Reimann KL (1828) Chemische Untersuchung des Tabaks und Darstellung des eigenthümlichen wirksamen Prinzips dieser Pflanze. Geigers Magazin f Pharmacie 6(23):138–161

Trommsdorff JB (1829) Beiträge zur chemischen Kenntnis des Tabaks. Neues Journal der Pharmacie (Leipzig) 19:129–155

Hartwich C (1911) Die menschlichen Genußmittel. Ihre Herkunft, Verbreitung, Geschichte, Bestandteile, Anwendung und Wirkung. Tauchnitz, Leipzig

Bentley HR (1997) Report on visit to USA and Canada, 17 April–12 May 1958. Tob Prod Litigation Rep 12:383–389

Goodman J (1993) Tobacco in history.Routledge, London

Kellogg JH (1946) Tobaccoism. Battle Creek/Mich. The Good Health Publishing, Michigan

Hamilton AE (1927) The smoking world. Century, New York

Blum D (1997) Auf leichten Flügeln ins Land der Phantasie. Tabak und Kultur – Columbus bis Davidoff. Transit, Berlin

Hurt RD, Robertson CR (1998) Prying open the door to the tobacco industry’s secrets about nicotine: the Minnesota Tobacco Trial. JAMA 280:1173–1181

Article   PubMed   CAS   Google Scholar  

Müller J (1842) Der Tabak in geschichtlicher, botanischer, chemischer, medicinischer und diätetischer Hinsicht. von Gebrüder Daams, Emmerich

Redmond DE Jr (1970) Tobacco and cancer: the first clinical report, 1761. N Engl J Med 282:18–23

Article   PubMed   Google Scholar  

Glinski von (1939) Untersuchungen über die Zunahme des primären Lungenkrebses unter Berücksichtigung der Pathogenese. Dtsch Arch klin Med 185:75–88

Müller FH (1939) Tabakmissbrauch und Lungencarcinom. Zschr Krebsforsch 49(1):57–85

Article   Google Scholar  

Haustein KO (2004) Fritz Lickint (1898–1960) – Ein Leben als Aufklärer über die Gefahren des Tabaks. Suchtmed 6(3):249–255

Schöninger E (1944) Lungenkrebs und Tabakrauch. Inaugural-Dissertation, Universität Jena, pp 1–25

Schairer E, Schöninger E (1943) Lungenkrebs und Tabakverbrauch. Zschr Krebsforsch 54:261–269

Schairer E, Schoniger E (2001) Lung cancer and tobacco consumption. Int J Epidemiol 30(1):24–27

Ernst E (2001) Commentary: The Third Reich – German physicians between resistance and participation. Int J Epidemiol 30:37–42

Proctor RN (2001) Commentary: Schairer and Schoniger’s forgotten tobacco epidemiology and the Nazi quest for racial purity. Int J Epidemiol 30(1):31–34

Wachter T (2001) Befleckte Kampagne gegen das Rauchen. Der Bund (Zürich) 2:16

Download references

Author information

Authors and affiliations.

Nikotinforschung und Raucherentwöhnung, Fritz-Lickint-Institut für, Johannes Str. 85–87, 99084, Erfurt, Germany

Prof. Dr. Knut-Olaf Haustein

Institut für Arbeitsmedizin, Charité - Universitätsmedizin Berlin, Thielallee 73, 14195, Berlin, Germany

Prof. Dr. Dr. h.c. mult. David Groneberg

You can also search for this author in PubMed   Google Scholar

Rights and permissions

Reprints and permissions

Copyright information

© 2010 Springer-Verlag Berlin Heidelberg

About this chapter

Haustein, KO., Groneberg, D. (2010). History of Tobacco. In: Tobacco or Health?. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-540-87577-2_1

Download citation

DOI : https://doi.org/10.1007/978-3-540-87577-2_1

Published : 21 July 2009

Publisher Name : Springer, Berlin, Heidelberg

Print ISBN : 978-3-540-87576-5

Online ISBN : 978-3-540-87577-2

eBook Packages : Medicine Medicine (R0)

Share this chapter

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Publish with us

Policies and ethics

• Find a journal
• Track your research

• Games & Quizzes
• History & Society
• Science & Tech
• Biographies
• Animals & Nature
• Geography & Travel
• Arts & Culture
• On This Day
• One Good Fact
• New Articles
• Lifestyles & Social Issues
• Philosophy & Religion
• Politics, Law & Government
• World History
• Health & Medicine
• Browse Biographies
• Birds, Reptiles & Other Vertebrates
• Bugs, Mollusks & Other Invertebrates
• Environment
• Fossils & Geologic Time
• Entertainment & Pop Culture
• Sports & Recreation
• Visual Arts
• Demystified
• Image Galleries
• Infographics
• Top Questions
• Britannica Kids
• Saving Earth
• Space Next 50
• Student Center
• Introduction
• Lung disease
• Heart disease
• Effects on pregnancy
• Behavioral intervention
• Nicotine patch
• Nicotine gum and lozenges
• Nicotine nasal spray
• Nicotine inhaler
• Sublingual nicotine tablets
• Other approaches to smoking cessation
• The goals and strategies of public policy on smoking
• Litigation against the tobacco industry
• Tobacco in New World culture
• Tobacco in Old World culture
• Mass production and mass appeal
• The antismoking movement

Our editors will review what you’ve submitted and determine whether to revise the article.

• MedlinePlus - Risks of Tobacco
• American Lung Association - Smoking Facts
• National Institute of Arthritis and Musculoskeletal and Skin Diseases - Smoking and Bone Health
• WebMD - Quit-Smoking Aids: Know Your Options
• National Center of Biotechnology Information - Smoking
• Centers for Disease Control and Prevention - Use of Smoking and Tobacco
• Cleveland Clinic - Smoking
• Verywell Health - Health Risks and Diseases of Smoking
• The Nemours Foundation - For Teens - Smoking
• smoking - Student Encyclopedia (Ages 11 and up)
• Table Of Contents

Recent News

smoking , the act of inhaling and exhaling the fumes of burning plant material. A variety of plant materials are smoked, including marijuana and hashish , but the act is most commonly associated with tobacco as smoked in a cigarette , cigar , or pipe . Tobacco contains nicotine , an alkaloid that is addictive and can have both stimulating and tranquilizing psychoactive effects. The smoking of tobacco, long practiced by American Indians , was introduced to Europe by Christopher Columbus and other explorers. Smoking soon spread to other areas and today is widely practiced around the world despite medical, social, and religious arguments against it.

Smoking and health

At the dawn of the 20th century, the most common tobacco products were cigars, pipe tobacco, and chewing tobacco . The mass production of cigarettes was in its infancy, although cigarette smoking was beginning to increase dramatically. According to the ninth edition of the Encyclopædia Britannica (1888), tobacco products were suspected of producing some adverse health effects, yet tobacco was also considered to have medicinal properties. Many scholars and health professionals of the day advocated tobacco’s use for such effects as improved concentration and performance, relief of boredom, and enhanced mood.

By the dawn of the 21st century, in stark contrast, tobacco had become recognized as being highly addictive and one of the world’s most-devastating causes of death and disease. Moreover, because of the rapid increase in smoking in developing countries in the late 20th century, the number of smoking-related deaths per year was projected to rise rapidly in the 21st century. For example, the World Health Organization (WHO) estimated that in the late 1990s there were approximately four million tobacco-caused deaths per year worldwide. This estimate was increased to approximately five million in 2003 and six million in 2011 and was expected to reach eight million per year by 2030. An estimated 80 percent of those deaths were projected to occur in developing countries. Indeed, although tobacco use was declining in many countries of western Europe and North America and in Australia, it continued to increase in countries of Asia, Africa, and South America .

The primary cause of the escalation in the number of deaths and incidents of disease from tobacco is the large increase in cigarette smoking during the 20th century. During that time cigarette smoking grew to account for approximately 80 percent of the world’s tobacco market. Nonetheless, all tobacco products are toxic and addictive. In some regions of the world, the use of smokeless tobacco products is a major health concern.

Tobacco products are manufactured with various additives to preserve the tobacco’s shelf life, alter its burning characteristics, control its moisture content, inhibit the hatching of insect eggs that may be present in the plant material, mask the irritative effects of nicotine, and provide any of a wide array of flavours and aromas. The smoke produced when tobacco and these additives are burned consists of more than 4,000 chemical compounds . Many of these compounds are highly toxic, and they have diverse effects on health.

The primary constituents of tobacco smoke are nicotine , tar (the particulate residue from combustion ), and gases such as carbon dioxide and carbon monoxide . Although nicotine can be poisonous at very high dosages, its toxic effect as a component of tobacco smoke is generally considered modest compared with that of many other toxins in the smoke. The main health effect of nicotine is its addictiveness. Carbon monoxide has profound, immediate health effects. It passes easily from the lungs into the bloodstream, where it binds to hemoglobin , the molecule in red blood cells that is responsible for the transfer of oxygen in the body. Carbon monoxide displaces oxygen on the hemoglobin molecule and is removed only slowly. Therefore, smokers frequently accumulate high levels of carbon monoxide, which starves the body of oxygen and puts an enormous strain on the entire cardiovascular system .

The harmful effects of smoking are not limited to the smoker. The toxic components of tobacco smoke are found not only in the smoke that the smoker inhales but also in environmental tobacco smoke, or secondhand smoke—that is, the smoke exhaled by the smoker (mainstream smoke) and the smoke that rises directly from the smoldering tobacco (sidestream smoke). Nonsmokers who are routinely exposed to environmental tobacco smoke are at increased risk for some of the same diseases that afflict smokers, including lung cancer and cardiovascular disease .

Clean-air laws that prohibit cigarette smoking are becoming widespread. In the 1980s and 1990s, such laws typically required that nonsmoking areas be established in restaurants and workplaces. However, the finding that toxins in environmental smoke could easily diffuse across large spaces led to much stronger bans. Since 2000 many cities, states, and regions worldwide, including New York City in 2003, Scotland in 2006, Nairobi in 2007, and Chicago in 2008, have implemented complete smoking bans in restaurants, taverns , and enclosed workplaces. A ban introduced in 2011 in China , which was home to one-third of the global smoking population , barred smoking in hotels, restaurants, and other indoor public spaces (the ban did not include smoking in workplaces, nor did it specify penalties).

In addition, entire countries have implemented smoking bans in workplaces or restaurants or, in some cases, in all public areas, including Ireland , Norway , and New Zealand in 2004 and France and India in 2008. In 2005 Bhutan became the first country to ban both smoking in public places and the sale of tobacco products.

Essay on Tobacco

Students are often asked to write an essay on Tobacco in their schools and colleges. And if you’re also looking for the same, we have created 100-word, 250-word, and 500-word essays on the topic.

Let’s take a look…

100 Words Essay on Tobacco

Tobacco: a dangerous plant.

Tobacco is a harmful plant that can cause serious health problems. It contains nicotine, a highly addictive substance that can damage the brain and body.

Health Risks of Tobacco

The addictive nature of nicotine.

Nicotine is a powerful addictive drug. It can be difficult to quit smoking once you start. Nicotine withdrawal can cause irritability, anxiety, and depression.

Secondhand Smoke

Secondhand smoke is the smoke from cigarettes, cigars, or pipes that is breathed in by people who are not smoking. Secondhand smoke can cause health problems in nonsmokers, including cancer, heart disease, and stroke.

Also check:

250 Words Essay on Tobacco

Tobacco: a harmful habit.

Tobacco is a plant that is grown for its leaves, which are dried and used to make cigarettes, cigars, and other tobacco products. Tobacco contains nicotine, a drug that is addictive and can have harmful effects on your health.

Smoking tobacco can cause many health problems, including cancer, heart disease, stroke, and lung disease. It can also increase your risk of developing gum disease, cataracts, and age-related macular degeneration. Smoking during pregnancy can also harm the baby.

Even if you don’t smoke, you can still be exposed to tobacco smoke from other people who smoke. This is called secondhand smoke, and it can also cause health problems, including cancer, heart disease, and stroke.

Quitting Tobacco

Tobacco is a harmful substance that can have a negative impact on your health. If you smoke, quitting is the best way to protect your health and the health of those around you.

500 Words Essay on Tobacco

Tobacco: a plant with a dark side.

Tobacco is a plant that has been used for centuries by people all over the world. It is native to the Americas, but it is now grown in many countries around the world. Tobacco contains nicotine, which is a highly addictive drug. Nicotine is what makes cigarettes and other tobacco products so appealing.

The Dangers of Tobacco

Tobacco smoke contains over 7,000 chemicals, many of which are known carcinogens. This means that they can cause cancer. Smoking tobacco is the leading cause of preventable death in the United States. It is responsible for more deaths than car accidents, murders, and AIDS combined.

The History of Tobacco

Tobacco was first used by Native Americans for religious and ceremonial purposes. European explorers brought tobacco back to Europe in the 16th century, and it quickly became popular there. By the 19th century, tobacco was being smoked by people all over the world.

The Tobacco Industry

The fight against tobacco.

Tobacco is a dangerous drug that can cause serious health problems. The tobacco industry has a long history of deceiving the public about the dangers of smoking. There is a growing movement to fight tobacco use, and smoking rates have declined in many countries as a result of these efforts.

If you’re looking for more, here are essays on other interesting topics:

Apart from these, you can look at all the essays by clicking here .

Leave a Reply Cancel reply

Arts & Culture

Business & Economy

Counties, Cities & Neighborhoods

Geography & Environment

Government & Politics

History & Archaeology

Science & Medicine

Sports & Outdoor Recreation

Frankie Welch’s Americana

Fashion and politics from Georgia-born designer Frankie Welch

Art Across Georgia

Take a virtual tour of Georgia's museums and galleries

Recently Added

City Page: Savannah

Georgia’s State Art Collection

Georgia Studies

Georgia, My State

Genetics of Tobacco

Tobacco, once a historically significant crop in Georgia, is a relatively minor agricultural commodity in the twenty-first century. Grown in thirty-five Georgia counties in 2007, tobacco generated a farm gate value (the value of the product when it leaves the farm) of around $65 million, ranking it twenty-seventh in the state’s top commodities for that year. ( Cotton was ranked second, with a farm gate value of more than $600 million, and peanuts were seventh, with $382 million.)

Unlike other crops raised for human consumption, tobacco is generally considered to be harmful to human health. As a result, much of the genetics research on tobacco in Georgia centers on the consequences of tobacco use on human health, rather than on improving the agricultural production of the plant. According to the Centers for Disease Control and Prevention (CDC) in Atlanta , 19.3 percent of adults in Georgia smoked in 2007. (The state with the highest percentage of adult smokers in that year was Kentucky, with 28.3 percent, and the lowest was Utah, with 11.7 percent.)

Genetic Modifications for Tobacco Cultivation

During the 1990s researchers at the University of Georgia ’s Horticulture Department and the Coastal Plain Experiment Station (later University of Georgia Tifton campus ) collaborated on identifying a genetically modified strain of tobacco for resistance to drought and saltwater, but they were not successful. Their findings were published in 1997, and since that time very little research on the genetic modification of tobacco has been conducted in Georgia, although such research has continued in other places, primarily at the University of Arizona.

Genetically Modified Tobacco in Cigarettes

Widely recognized as a center for public health, Atlanta is home to both the CDC and the American Cancer Society . Both institutions research tobacco use and advocate against it. Some of this research involves tobacco that has been genetically modified to contain less of the addictive substance nicotine.

Photograph by Sarah E. McKee, New Georgia Encyclopedia

When the U.S. government began pressuring tobacco companies to encourage smoking cessation, the companies responded with potential reduced exposure products (PREPs). One PREP idea involved removing the nicotine from cigarettes to eliminate their addictive properties. Early methods attempted during the late 1980s involved directly removing nicotine from the tobacco leaves, but doing so caused the cigarettes to taste different. Researchers specializing in genetics realized that if they could turn off the gene that makes tobacco plants produce nicotine, then the plants would be nicotine-free and probably taste the same.

Vector Tobacco, Inc., a tobacco company based in North Carolina, hired geneticist Mark Conkling to create a nicotine-free tobacco strain. Conkling developed and patented a method that alters the plant’s genetic material, or deoxyribonucleic acid (DNA), so that the tobacco will not produce any nicotine in its roots. Since tobacco plants make nicotine in their root systems and transport it to the leaves, the leaves of a plant with this DNA modification will not contain nicotine. (In reality, some nicotine is still present in the leaves, but only in a very small quantity.) The removal of nicotine from tobacco leaves yields a smoking product that is free of any chemically addictive properties, although many other harmful substances are still present.

Photograph from CAES Newsire, University of Georgia

In 2001 Vector began selling Omni cigarettes, the first genetically modified tobacco product on the market. Two years later the company released a new nicotine-free cigarette, Quest, which researchers in Atlanta and elsewhere began testing shortly after its release. In 2008 chemists at the CDC’s National Center for Environmental Health began using Quest cigarettes in experiments involving nicotine content and charcoal filters.

Tobacco and Cancer

Present in all tobacco smoke is a class of harmful chemical compounds called carcinogens, which change human DNA in such a way as to cause cancer . Some examples of carcinogens found in tobacco smoke are 1,3-butadiene, benzene, and vinyl chloride. Although Quest cigarettes do not contain nicotine, the smoke they produce consists of the same carcinogens as regular cigarettes.

In 2002 the American Cancer Society published a report on the relationship between tobacco use and cancer. This report summarizes more than fifty years of tobacco research and explains how advances in molecular biology have allowed geneticists to identify the mutation that initiates tobacco-related cancers. The report also mentions the future of genetics-related cancer research, including the possibility that doctors may one day be able to determine if an individual’s cancer was caused directly by tobacco use.

Cite this Article

Chen, Eric and Matthew Hammond. "Genetics of Tobacco." New Georgia Encyclopedia, last modified Dec 13, 2019. https://www.georgiaencyclopedia.org/articles/science-medicine/genetics-of-tobacco/

Chen, E. & Hammond, M. D. (2009). Genetics of Tobacco. In New Georgia Encyclopedia . Retrieved Dec 13, 2019, from https://www.georgiaencyclopedia.org/articles/science-medicine/genetics-of-tobacco/

Chen, Eric and Hammond, Matthew. "Genetics of Tobacco." New Georgia Encyclopedia , 27 April 2009, https://www.georgiaencyclopedia.org/articles/science-medicine/genetics-of-tobacco/.

Article Feedback

• General feedback
• Content feedback
• Suggest an article
• Website issue
• Suggestions or comments *
• First name *
• Last name *
• Title of article *
• Description of error *
• Correction to be made *
• Your source(s) for the correct information *
• Suggested topic *
• Brief description and information about the topic's significance for Georgia *
• Sources for information about this topic *
• Title of article or page where error occurred *
• Description of error or error message *

Share this Article

Tobacco, once a historically significant crop in Georgia, is a relatively minor agricultural commodity in the twenty-first century. Grown in thirty-five Georgia counties in 2007,…

Share this Snippet

Featured content.

James Oglethorpe

Harriet Powers

Pierce County

Alan Jackson

Georgia History

Chick-fil-A

Updated recently.

Indigo Girls

Athos Menaboni

Pulitzer Prizes of Georgia

The American Music Show

A more perfect union.

The New Georgia Encyclopedia is supported by funding from A More Perfect Union, a special initiative of the National Endowment for the Humanities.

Transgenic Tobacco Plants

• Info Details
• Citation Terms of Use

Transgenic, or genetically modified, tobacco plants grow in the laboratory of geneticist Richard Meagher at the University of Georgia.

The New Georgia Encyclopedia does not hold the copyright for this media resource and can neither grant nor deny permission to republish or reproduce the image online or in print. All requests for permission to publish or reproduce the resource must be submitted to the rights holder.

A tobacco farm in south Georgia. While researchers in Georgia have made advances in the field of genetic engineering to develop crops that are resistant to weeds and insects, most genetics research on tobacco in the state examines the plant's impact on public health.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

Preview improvements coming to the PMC website in October 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• J Int Soc Prev Community Dent
• v.3(1); Jan-Jun 2013

Tobacco: Its historical, cultural, oral, and periodontal health association

Shanu mishra.

Registrar, Rotherham General Hospital, Rotherham S60 3 rd , South Yorkshire, UK

M. B. Mishra

1 Professor and Head Department of Periodontics, Mahatma Gandhi Dental College and Hospital, Jaipur, Rajasthan, India

This article provides information on the origin of tobacco and its subsequent spread throughout the world. In the era of the migration of communities, tobacco use gradually gained access and subsequently migrated along with the migrants, establishing in different locations. Probably at that time people were unaware of the health hazards and were using tobacco in treating certain ailments. Much has been known and written about tobacco in the context of oral and general health hazards but little has been explored and is known to many about where from and how this plant, which is now used in various forms, and speading widely. In what form, where, and how it had been served in religious rituals and considered for treatment or remedy of certain ailments in those days could not certainly be known. In the 21 st century, people are considering hazardous tobacco as beneficial for their teeth, good for concentration of mind, and something which keeps them engaged. Even many professionals, though knowing the deleterious effects, are still using tobacco and gutkha in one or the other form. This article has been designed to revive the awareness for health hazards of tobacco and similar products. A pilot project questionnaire survey comprising this subject involving the educated mass has already been started and will be produced after analysis of data in part II of this paper.

INTRODUCTION

For ages, tobacco has been popular and its use is significantly increasing in spite of alarming health hazards. However, so far a lot has been known about its disadvantages, but still tobacco is grown, developed, advertised, marketed, and sold to earn a big chunk of the financial cake. It is one of the great sources of revenue for the government as excise duty.

Many research works in different countries have emphasized potential detrimental effects of its use on almost all systems of living beings, in whatever form it is used. Many times articles are published in the newspapers, to develop awareness of its effects. Print and electronic media are playing a dual role by helping in promoting and popularizing tobacco / gutkha and similar products and contrarily printing and showing the health hazards.

The literature suggests that approximately 70% of alcoholics are heavy smokers compared with 10% of the general population. Likewise, smokers are 1.3 times more likely to consume alcohol compared with nonsmokers.

Where from, in what form, and how these leaves of the noxious plant gained popularity and made the mankind addictive is to be known. Although much has been known by now but knowing the history of tobacco is also necessary.

Tobacco is derived from the leaves of the genus Nicotiana, a plant from the night-shade family, indigenous to North and South America.

Archeological studies suggest the use of tobacco in around first century BC, when Maya people of Central America used tobacco leaves for smoking, in sacred and religious ceremonies. It then later started spreading as far as high up to the Mississippi Valley with the Maya community migrating from down south of America, between 470 and 630 AD. Gradually, it was then adopted by neighboring and native tribes.

Native American “Shamans” developed tobacco use for religious rites. Simultaneously, people practicing medicine also started using tobacco in different forms to cure certain illnesses such as asthma, earaches, bowel problems, fever, sore eyes, depression, insect bites, burns, etc.[ 1 ]

By the time Columbus and his successors documented tobacco in other countries, the natives started useing tobacco in pipes, cigars, and snuff. Subsequently, Portuguese and Spanish sailors helped to spread different forms of tobacco to be used, around the world.

Today, tobacco is used in various forms in different parts of the world. Tobacco in many countries is sometimes adopted as a cash crop by the farmers and government treasuries (excise, taxes, etc.), and is also grown for local consumption.

The major tobacco-growing and consuming countries are China, USA, the Former Soviet States, India, and Brazil. In South and Southeast Asia, it is incorporated into existing traditional customs, in the form of betel quid (paan) chewing.

The tobacco industry provides thousands of jobs, and is also a major source of income for the advertising industries, printed and electronic media, government (for revnew and as a source of foreign currency).

Modes of use

There is a wide range of use of tobacco in different countries.

The smoking form of tobacco, since its introduction in South Asian countries, has been used in several forms, like hukka (water pipe), chilam (clay pipe), cigarettes, rolled tobacco in the form of bidees, Chchuta (reverse smoking), etc., whereas the nonsmoking or chewable tobacco is in the form of snuff/naswar (roasted and finely powdered for inhalation), mawa, qiwam, gutkha, kheni (mixture of dry raw tobacco with lime), zarda, betel quid with tobacco, paan-masala, etc.. In Indonesia, tobacco is mixed with clove and dipped in the oral cavity.

Paan acquired significant popularity among the male population of the central and western India in contrast to female of these locations. Contrary are the findings in Bangladesh, with educated or uneducated females consuming more paan preferably with tobacco. According to a survey report, tobacco-consuming females in Bangladesh believe that this helps them in concentrating more on their work. The survey also states that a large population believes that paan strengthens their teeth and eliminates bad breath.

Influencing factors

Tobacco use has multifactor influences. Despite increasing public awareness of risks associated with tobacco use and education programs to discourage its use, cigarettes and alcohol are both considered as significant risk factors for a multitude of health consequences from the long-term use of either of these two.

There is a direct or an indirect influence of culture on tobacco use as some individuals having an inherited factor later become nicotine dependent. Boys see their grandfathers or fathers smoking, so they think it is part of being a man.[ 2 ] Smoking is seen as part of being a man and a sign of his male authority. In any society at large, it is not considered good for women to smoke but fine for men. The man is the boss and smoking is a symbol of that authority, and if a woman smokes,it is seen as a threat to the man and his manhood. Also, if a woman smokes, she is assumed to be indecent both morally and sexually.[ 3 ]

Smoking and paan chewing can be part of a social event, confirming hospitality and binding friendships.[ 4 ] Hookah, chilam (clay pipe with tobacco), and shisha are used in a social setting specifically in the rural culture. To attract youngsters, now a days some restaurants have started providing shisha clubs. Havana cigar is smoked in celebrations and is recognized as a status symbol.

Promotion and popularity

In India, gutkha users claim that it relieves tension, helps in concentration, combats bad breath, and keeps one engaged.[ 5 , 6 ] Before a decade, cinema and print media were the chief source of advertisement of and marketing cigarettes. An amendment in the law has imposed a ban on the advertisement of any smoking form of tobacco in the public places and through print media this message is published for the community to know. Still in Indian cinema, male stars are shown smoking in a stylish way, which leaves an imprint on the psychology of the younger generation who later try adopt and replicate that.

On satellite TV and cinema screen, the Indian cinema “heartthrobs” are shown advertising, propagating, promoting, and popularizing the different brands of gutkha products. Gutkha is a branded product of many companies, and sold in colorful, attractive sachets in India. Hence the younger generations consider and take it as modern, acceptable, and fashionable, and sussequently become addicted to it. In UK, the mothers of Asian origin blame the media of these countries for introducing children to gutkha.

It impacts on the vulnerable minds of the school children,as in a study many children were reported as spending their pocket money on gutkha.[ 7 ]

Some companies popularize tobacco as the dental care product by incorporating it in toothpastes or toothpowders. Although law has been amended barring the use of tobacco in dental care products, still some manufacturers use tobacco as an ingredient in the toothpowders without mentioning ingredients on the packaging.[ 8 ]

Chaudhury, in a questionnaire survey, has reported that among 13–15 year olds, 6–68% of respondents use tobacco products.[ 9 ]

In USA, split tobacco was popularized by sports icons. [ 10 ]

Health hazards

There are 2550 known compounds in tobacco and more than 4000 compounds in tobacco smoke.

Primary tobacco biohazardous compounds include at least 43 carcinogens, such as nicotine and nitrosamines, and alpha-emitting radionuclides such as polonium 210.

Tobacco smoke contains carbon monoxide, thiocyanate, herbicide, fungicide and pesticide residues, tars, and many other substances which promote diseases and impair the body's defense mechanism and functions. Toxic substances in the tobacco smoke affect virtually every viable cell type.

First and foremost, adverse effect of smoking is immunosuppressive effect on the host, and hence adversely affecting host-parasite interactions.

The consumption of tobacco, whether inhaled, sniffed, sucked, or chewed, has evident harmful effects on health, and is addictive too. Scientists unequivocally evidenced that tobacco consumers suffer from three Ds: death, disease, and disability.[ 11 ]

Different systems of our body are interrelated and they influence the use of any such product which is likely to cause health hazards affects many such body functions.

Its active ingredients, tar, nicotine, and nitrosamine, are potentially associated with oral cancer worldwide.[ 12 , 13 ]

In the developed countries, smoking has been associated with over 85% deaths of all cancer deaths in men. It is estimated that 40–45% of all cancers and 90–95% of all lung cancers have an association with smoking. [ 14 ] Many other diseases, such as chronic pulmonary obstructive disease (COPD) are implicated to cause death in 75% of the people between the age of 35 and 70 years. Many clinical study have established that pipe smoking has been associated with lip cancer.

While smokeless tobacco habits are endemic, oral cancer can account for more than one-third of all cancers.[ 15 ] The prevalence of smoking in teenagers of India is increasing ranging from 19.7% to 34.5%.

ORAL AND SYSTEMIC EFFECTS OF SMOKING

Despite of increasing public awareness of risks associated with tobacco use and education programs to discourage its use, cigarettes and alcohol both are considered significant risk factors for a multitude of health consequences from the long-term and excessive use of either of these two.

It is ubiquitously accepted that smoking is a significant risk factor for cardiovascular diseases, COPD, and some forms of cancers. The use of any such product which is likely to cause health hazards, adversely affects functions of many systems.

Smokers have a characteristic change in color of exposed mucosal surfaces which is primarily due to melanin deposition on the basal cell layer of the mucosa. The relationship of a smoker's melanosis (dark-brown foci) and inflammatory changes that result from heat, smoke, and inhalation with the absorption of exogenous pigments has not been determined. Tobacco-associated white keratosis patches are commonly found in smokers [ Figure 1 ]. Chronic smokers may also develop nicotine stomatitis (smoker's palate). Verrucous carcinoma of Ackerman is a variant of squamous cell carcinoma and has an association with smokeless tobacco.

White keratosis of the buccal and tongue mucosa in a tobacco gutkha user

It has long been established that recurrent aphthous ulcer is a disease, almost exclusively, of nonsmokers. And this is one of the consistent findings. Recurrent aphthous ulcers may start if smoking is abandoned, although reasons are unclear.

Influence on periodontium

Arno et al . examined 1016 individuals for gingivitis and found a significant correlation between tobacco consumption and gingivitis when hygiene and age were kept constant.[ 16 ] Ismail et al . reviewed data from National Health and Nutrition Examination Survey and found that smokers had higher periodontal, debris, calculus, and oral hygiene index scores than non-smokers.[ 17 ]

Smokers have greater susceptibility to periodontitis, and paradoxically less to gingivitis; the explanation given for this paradoxical clinical behavior is that probably smoking interferes with the inflammatory and immune response by activating endothelial and inflammatory cells to induce cytokines’ secretion. The deleterious effects of smoking on the periodontium include alteration in periodontal tissue vasculature, direct alternative effect on bacterial microflora, and the inhibitory effect on immunoglobulin levels and antibody responses to plaque bacteria. Nicotine is a vasoconstrictor, although its effects on gingivae have been proven to be difficult to measure.

It has been documented that tobacco components can have deleterious effects on various neutrophil functions (impaired chemotaxis/phagocytosis or both). Polymorphonuclear leukocytes motility, chemotaxis, and phagocytosis are significantly reduced in smokers. Thus this important first line of defense against subgingival bacteria is compromised in smokers. Antibody production is altered, specially opsonizing IgG2 and immune-regulatory T-cell subset ratio.

In this manner, both innate and acquired immune mechanisms are compromised in current smokers, allowing periodontal bacteria to escape host clearance and establish themselves as subgingival inhabitants.

Cigarette smoking increases bacterial adhesion to epithelial cells and has a differential effect on bacterial colonization, favoring growth of Gram-negative bacteria.

Alternation in the subgingival environment, such as decreased oxygen tension, allows, in turn, the overgrowth of an essentially anaerobic flora and overgrowth of opportunistic pathogenic microbial species. Periodontal pocket oxygen tension partial oxygen pressure (PO 2 ) was significantly less in smokers compared with nonsmokers and was not influenced by gingival oxygen sufficiency.

Smokers are 2.6-6 times more likely to exhibit periodontal destruction than nonsmokers. Exposure to tobacco smoke is associated with an increased risk of adult periodontitis and increased disease severity in smokers compared to nonsmokers.[ 18 ] It has been suggested in many studies that smokers have greater clinical attachment loss (CAL).

Attachment loss severity was increased by 0.5% by smoking 1 cigarette / day, while smoking up to 10-20 cigarettes increased the clinical attachment loss by 5-10%. A positive correlation has been established between serum levels of the nicotine metabolite cotinine and severity of CAL, probing depth, and alveolar crest height, because of which cigarette smoking significantly increases the risk for tooth loss by 70%.

Smokers appear to have a depressed number of helper lymphocytes (Th) which are important for B-cell function and antibody production. This has been manifested by decreased levels of salivary antibodies IgA and serum IgG. In smokers, a diminished serum IgG2 level and an impaired IgG2 response have been hypothesized to increase the risk of periodontitis.

Serum IgG antibodies to Prevotella intermedia and Fusobacterium nucleatum have also been reported to be reduced in smokers.

Pindborg noted that 98% of acute necrotizing ulcerative gingivitis (ANUG) patients studied were smokers. The effect of smoking appears to be complex than a mere reflection of patient stress.[ 19 ] Clarke et al .. have demonstrated that the intra-arterial infusion of epinephrine and nicotine in rabbits resulted in reduced gingival blood flow rates in spite of increased systemic perfusion pressure.[ 20 ]

Smokers who underwent periodontal surgery with either modified Widman flap or mucoperiosteal flap reflection had significantly less reduction in the pocket depth and gain in clinical attachment levels compared with nonsmokers. Root coverage following free gingival graft procedures is reportedly diminished by heavy cigarette smoking. Following regenerative procedures, the clinical attachment gain was les in smokers. Miller has reported a 100% correlation between failure to obtain root coverage and heavy smoking (more than 10 cigarettes/day). Heavy smokers who refrained from smoking during the first 2 weeks of healing had results comparable to nonsmokers.[ 21 ]

Cigarette smokers have also been associated with a reduced healing response, after guided tissue regeneration (GTR) therapy in deep infrabony defects. Nicotine and carbon monoxide in tobacco smoke negatively influence wound healing.

An 80% failure rate in treatment of furcation defects using regenerative therapy has been seen in smokers. Nicotine may inhibit fibroblast-fibronectin and collagen production and increase the fibroblast collagenase activity.

Nicotine can also suppress the proliferation of cultured osteoblasts while stimulating the osteoblast alkaline phosphatase activity.

Tobacco components may also modify the production of cytokines or inflammatory mediators which play a role in periodontal tissue destruction.

Nicotine has been shown to increase the release of interleukin-6 by cultured murine osteoblasts. Smokers also have an increased crevicular fluid tumor necrosis factor-alpha (TNF- α) level.

Implant success rates are reduced in smokers. Smokers are 2.6 times more likely to have an implant failure between the time of implant uncovering and the time of restorative loading. A greater failure rate of implant in smokers has been seen in maxillary anterior teeth. Smoking may influence post-implant surgery healing and the long-term health of the peri-implant tissue. Many clinicians have reported smoking as an absolute risk factor in the selection of implant patients.

The risk of subgingival infection with Bacteroides forsythus in current smokers was 2.3 times that of former smokers or nonsmokers. The proportion of subjects positive for Actinobacillus actinomycetemcomitans , Porphyromonas gingivalis , and Bacteroid forsythss were higher among smokers. Observational studies also report a greater level of plaque, calculus, and oral debris in smokers. This conclusion dominated for nearly two decades of clinical practice.

Cigarette smoking was also associated with increased levels of TNF- α in the crevicular fluid compared with non-smokers. The neutrophil elastase activity and levels of prostaglandin E2 (PGE2) and Matrix meatalloproteinase-8 (MMP8) were raised in smokers.

Nicotine, in addition, up-regulates LPS-mediated monocyte secretion of PGE2 and IL-1B. Free oxygen radicals from neutrophils are increased in smokers. Levels of metallothionine, a free-radical scavenger, are increased in the gingival tissue of smokers. Therefore, smoking appears to favor a pathogenic subgingival flora.

Nicotine has divergent effects on IL-1 and PGE2 secretion, depending upon the cell type and whether or not the bacterial components are present. Such alterations in the host response may affect the reparative and regenerative potential of the periodontium in tobacco users.

From the contemporary studies, a general pattern has emerged:

• Smokers have greater clinical attachment and alveolar bone loss.
• Increased number of deep pockets and calculus formation.
• Variable levels of plaque and inflammation.

A previous history of smoking does not appear to be deleterious to the response to periodontal therapy. It has been observed that occasionally, aphthae start when smoking is given up

Although bias is toward decreased signs of clinical inflammation [ Figure 2 ].

Cigarette smoking - Local and Systemic

CONCLUSION AND COMMENTS

The association of tobacco and its products with several reversible and irreversible oral and systemic diseases and its manifestations have been ubiquitously established.

The adaptation of tobacco by either sex certainly has a familial or cultural impact.

Much has been done to produce, publicize, and popularize tobacco. In contrast negligible efforts are seen to discourage the practice of tobacco use, by the government, and NGOs.

In many countries,the health departments, trusts, and NGOs run voluntary services for smoking cessation at centers with various hospital services. Counseling to give up smoking is done by demonstrating the potential health hazards due to tobacco. Alcohol and tobacco are frequently used together and scientific research supports the popular observation that at large “smokers drink and drinkers smoke.”

Smoking has been identified as one of the major predictive variables for response in periodontal therapy. Studies on non-surgical therapy have shown less probing depth reduction and less attachment gain in smokers as compared to non-smokers. Similar results with less gain in bone height were found in patients’ undergone surgery.

Smoking has been considered as a significant risk factor in implant patients.

Wound healing is delayed in smokers as compared to nonsmokers.

Several studies suggest that smokers show a low response to maintenance therapy compared with non-smokers.

Source of Support: Nil

Conflict of Interest: None declared.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Published: 24 March 2022

Tobacco and nicotine use

• Bernard Le Foll 1 , 2 ,
• Megan E. Piper 3 , 4 ,
• Christie D. Fowler 5 ,
• Serena Tonstad 6 ,
• Laura Bierut 7 ,
• Lin Lu   ORCID: orcid.org/0000-0003-0742-9072 8 , 9 ,
• Prabhat Jha 10 &
• Wayne D. Hall 11 , 12  

Nature Reviews Disease Primers volume  8 , Article number:  19 ( 2022 ) Cite this article

36k Accesses

72 Citations

104 Altmetric

Metrics details

• Disease genetics
• Experimental models of disease
• Preventive medicine

Tobacco smoking is a major determinant of preventable morbidity and mortality worldwide. More than a billion people smoke, and without major increases in cessation, at least half will die prematurely from tobacco-related complications. In addition, people who smoke have a significant reduction in their quality of life. Neurobiological findings have identified the mechanisms by which nicotine in tobacco affects the brain reward system and causes addiction. These brain changes contribute to the maintenance of nicotine or tobacco use despite knowledge of its negative consequences, a hallmark of addiction. Effective approaches to screen, prevent and treat tobacco use can be widely implemented to limit tobacco’s effect on individuals and society. The effectiveness of psychosocial and pharmacological interventions in helping people quit smoking has been demonstrated. As the majority of people who smoke ultimately relapse, it is important to enhance the reach of available interventions and to continue to develop novel interventions. These efforts associated with innovative policy regulations (aimed at reducing nicotine content or eliminating tobacco products) have the potential to reduce the prevalence of tobacco and nicotine use and their enormous adverse impact on population health.

Similar content being viewed by others

Associations between classic psychedelics and nicotine dependence in a nationally representative sample

Use of electronic cigarettes and heated tobacco products during the covid-19 pandemic.

Smoking cessation behaviors and reasons for use of electronic cigarettes and heated tobacco products among Romanian adults

Introduction.

Tobacco is the second most commonly used psychoactive substance worldwide, with more than one billion smokers globally 1 . Although smoking prevalence has reduced in many high-income countries (HICs), tobacco use is still very prevalent in low-income and middle-income countries (LMICs). The majority of smokers are addicted to nicotine delivered by cigarettes (defined as tobacco dependence in the International Classification of Diseases, Tenth Revision (ICD-10) or tobacco use disorder in the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5)). As a result of the neuro-adaptations and psychological mechanisms caused by repeated exposure to nicotine delivered rapidly by cigarettes, cessation can also lead to a well-characterized withdrawal syndrome, typically manifesting as irritability, anxiety, low mood, difficulty concentrating, increased appetite, insomnia and restlessness, that contributes to the difficulty in quitting tobacco use 2 , 3 , 4 .

Historically, tobacco was used in some cultures as part of traditional ceremonies, but its use was infrequent and not widely disseminated in the population. However, since the early twentieth century, the use of commercial cigarettes has increased dramatically 5 because of automated manufacturing practices that enable large-scale production of inexpensive products that are heavily promoted by media and advertising. Tobacco use became highly prevalent in the past century and was followed by substantial increases in the prevalence of tobacco-induced diseases decades later 5 . It took decades to establish the relationship between tobacco use and associated health effects 6 , 7 and to discover the addictive role of nicotine in maintaining tobacco smoking 8 , 9 , and also to educate people about these effects. It should be noted that the tobacco industry disputed this evidence to allow continuing tobacco sales 10 . The expansion of public health campaigns to reduce smoking has gradually decreased the use of tobacco in HICs, with marked increases in adult cessation, but less progress has been achieved in LMICs 1 .

Nicotine is the addictive compound in tobacco and is responsible for continued use of tobacco despite harms and a desire to quit, but nicotine is not directly responsible for the harmful effects of using tobacco products (Box  1 ). Other components in tobacco may modulate the addictive potential of tobacco (for example, flavours and non-nicotine compounds) 11 . The major harms related to tobacco use, which are well covered elsewhere 5 , are linked to a multitude of compounds present in tobacco smoke (such as carcinogens, toxicants, particulate matter and carbon monoxide). In adults, adverse health outcomes of tobacco use include cancer in virtually all peripheral organs exposed to tobacco smoke and chronic diseases such as eye disease, periodontal disease, cardiovascular diseases, chronic obstructive pulmonary disease, stroke, diabetes mellitus, rheumatoid arthritis and disorders affecting immune function 5 . Moreover, smoking during pregnancy can increase the risk of adverse reproductive effects, such as ectopic pregnancy, low birthweight and preterm birth 5 . Exposure to secondhand cigarette smoke in children has been linked to sudden infant death syndrome, impaired lung function and respiratory illnesses, in addition to cognitive and behavioural impairments 5 . The long-term developmental effects of nicotine are probably due to structural and functional changes in the brain during this early developmental period 12 , 13 .

Nicotine administered alone in various nicotine replacement formulations (such as patches, gum and lozenges) is safe and effective as an evidence-based smoking cessation aid. Novel forms of nicotine delivery systems have also emerged (called electronic nicotine delivery systems (ENDS) or e-cigarettes), which can potentially reduce the harmful effects of tobacco smoking for those who switch completely from combustible to e-cigarettes 14 , 15 .

This Primer focuses on the determinants of nicotine and tobacco use, and reviews the neurobiology of nicotine effects on the brain reward circuitry and the functioning of brain networks in ways that contribute to the difficulty in stopping smoking. This Primer also discusses how to prevent tobacco use, screen for smoking, and offer people who smoke tobacco psychosocial and pharmacological interventions to assist in quitting. Moreover, this Primer presents emerging pharmacological and novel brain interventions that could improve rates of successful smoking cessation, in addition to public health approaches that could be beneficial.

Box 1 Tobacco products

Conventional tobacco products include combustible products that produce inhaled smoke (most commonly cigarettes, bidis (small domestically manufactured cigarettes used in South Asia) or cigars) and those that deliver nicotine without using combustion (chewing or dipping tobacco and snuff). Newer alternative products that do not involve combustion include nicotine-containing e-cigarettes and heat-not-burn tobacco devices. Although non-combustion and alternative products may constitute a lesser risk than burned ones 14 , 15 , 194 , no form of tobacco is entirely risk-free.

Epidemiology

Prevalence and burden of disease.

The Global Burden of Disease Project (GBDP) estimated that around 1.14 billion people smoked in 2019, worldwide, increasing from just under a billion in 1990 (ref. 1 ). Of note, the prevalence of smoking decreased significantly between 1990 and 2019, but increases in the adult population meant that the total number of global smokers increased. One smoking-associated death occurs for approximately every 0.8–1.1 million cigarettes smoked 16 , suggesting that the estimated worldwide consumption of about 7.4 trillion cigarettes in 2019 has led to around 7 million deaths 1 .

In most populations, smoking prevalence is much higher among groups with lower levels of education or income 17 and among those with mental health disorders and other co-addictions 18 , 19 . Smoking is also more frequent among men than women (Figs  1 – 3 ). Sexual and/or gender minority individuals have disproportionately high rates of smoking and other addictions 17 , 20 . In addition, the prevalence of smoking varies substantially between regions and ethnicities; smoking rates are high in some regions of Asia, such as China and India, but are lower in North America and Australia. Of note, the prevalence of mental health disorders and other co-addictions is higher in individuals who smoke compared with non-smokers 18 , 19 , 21 . For example, the odds of smoking in people with any substance use disorder is more than five times higher than the odds in people without a substance use disorder 19 . Similarly, the odds of smoking in people with any psychiatric disorder is more than three times higher than the odds of smoking in those without a psychiatric diagnosis 22 . In a study in the USA, compared with a population of smokers with no psychiatric diagnosis, subjects with anxiety, depression and phobia showed an approximately twofold higher prevalence of smoking, and subjects with agoraphobia, mania or hypomania, psychosis and antisocial personality or conduct disorders showed at least a threefold higher prevalence of smoking 22 . Comorbid disorders are also associated with higher rates of smoking 22 , 23 .

a | Number of current male smokers aged 15 years or older per country expressed in millions. b | Former male smokers aged 45–59 years per country expressed in millions. c | Former male smokers aged 45–59 years per country expressed as the percentage of smokers who stopped. The data shown are for male smokers for the period 2015–2019 from countries with direct smoking surveys. The prevalence of smoking among males is less variable than among females. Data from ref. 1 .

a | Number of current female smokers aged 15 years or older per country expressed in millions. b | Former female smokers aged 45–59 years per country expressed in millions. c | Former female smokers aged 45–59 years per country expressed as the percentage of smokers who stopped. The data shown are for female smokers for the period 2015–2019 from countries with direct smoking surveys. The prevalence of smoking among females is much lower in East and South Asia than in Latin America or Eastern Europe. Data from ref. 1 .

a | Number of current male and female smokers aged 15 years or older per country expressed in millions. b | Former male and female smokers aged 45–59 years per country expressed in millions. c | Former male and female smokers aged 45–59 years per country expressed as the percentage of smokers who stopped. The data shown are for the period 2015–2019 from countries with direct smoking surveys. Cessation rates are higher in high-income countries, but also notably high in Brazil. Cessation is far less common in South and East Asia and Russia and other Eastern European countries, and also low in South Africa. Data from ref. 1 .

Age at onset

Most smokers start smoking during adolescence, with almost 90% of smokers beginning between 15 and 25 years of age 24 . The prevalence of tobacco smoking among youths substantially declined in multiple HICs between 1990 and 2019 (ref. 25 ). More recently, the widespread uptake of ENDS in some regions such as Canada and the USA has raised concerns about the long-term effects of prolonged nicotine use among adolescents, including the possible notion that ENDS will increase the use of combustible smoking products 25 , 26 (although some studies have not found much aggregate effect at the population level) 27 .

Smoking that commences in early adolescence or young adulthood and persists throughout life has a more severe effect on health than smoking that starts later in life and/or that is not persistent 16 , 28 , 29 . Over 640 million adults under 30 years of age smoke in 22 jurisdictions alone (including 27 countries in the European Union where central efforts to reduce tobacco dependence might be possible) 30 . In those younger than 30 years of age, at least 320 million smoking-related deaths will occur unless they quit smoking 31 . The actual number of smoking-related deaths might be greater than one in two, and perhaps as high as two in three, long-term smokers 5 , 16 , 29 , 32 , 33 . At least half of these deaths are likely to occur in middle age (30–69 years) 16 , 29 , leading to a loss of two or more decades of life. People who smoke can expect to lose an average of at least a decade of life versus otherwise similar non-smokers 16 , 28 , 29 .

Direct epidemiological studies in several countries paired with model-based estimates have estimated that smoking tobacco accounted for 7.7 million deaths globally in 2020, of which 80% were in men and 87% were current smokers 1 . In HICs, the major causes of tobacco deaths are lung cancer, emphysema, heart attack, stroke, cancer of the upper aerodigestive areas and bladder cancer 28 , 29 . In some lower income countries, tuberculosis is an additional important cause of tobacco-related death 29 , 34 , which could be related to, for example, increased prevalence of infection, more severe tuberculosis/mortality and higher prevalence of treatment-resistant tuberculosis in smokers than in non-smokers in low-income countries 35 , 36 .

Despite substantial reductions in the prevalence of smoking, there were 34 million smokers in the USA, 7 million in the UK and 5 million in Canada in 2017 (ref. 16 ), and cigarette smoking remains the largest cause of premature death before 70 years of age in much of Europe and North America 1 , 16 , 28 , 29 . Smoking-associated diseases accounted for around 41 million deaths in the USA, UK and Canada from 1960 to 2020 (ref. 16 ). Moreover, as smoking-associated diseases are more prevalent among groups with lower levels of education and income, smoking accounts for at least half of the difference in overall mortality between these social groups 37 . Any reduction in smoking prevalence reduces the absolute mortality gap between these groups 38 .

Smoking cessation has become common in HICs with good tobacco control interventions. For example, in France, the number of ex-smokers is four times the number of current smokers among those aged 50 years or more 30 . By contrast, smoking cessation in LMICs remains uncommon before smokers develop tobacco-related diseases 39 . Smoking cessation greatly reduces the risks of smoking-related diseases. Indeed, smokers who quit smoking before 40 years of age avoid nearly all the increased mortality risks 31 , 33 . Moreover, individuals who quit smoking by 50 years of age reduce the risk of death from lung cancer by about two-thirds 40 . More modest hazards persist for deaths from lung cancer and emphysema 16 , 28 ; however, the risks among former smokers are an order of magnitude lower than among those who continue to smoke 33 .

Mechanisms/pathophysiology

Nicotine is the main psychoactive agent in tobacco and e-cigarettes. Nicotine acts as an agonist at nicotinic acetylcholine receptors (nAChRs), which are localized throughout the brain and peripheral nervous system 41 . nAChRs are pentameric ion channels that consist of varying combinations of α 2 –α 7 and β 2 –β 4 subunits, and for which acetylcholine (ACh) is the endogenous ligand 42 , 43 , 44 . When activated by nicotine binding, nAChR undergoes a conformational change that opens the internal pore, allowing an influx of sodium and calcium ions 45 . At postsynaptic membranes, nAChR activation can lead to action potential firing and downstream modulation of gene expression through calcium-mediated second messenger systems 46 . nAChRs are also localized to presynaptic membranes, where they modulate neurotransmitter release 47 . nAChRs become desensitized after activation, during which ligand binding will not open the channel 45 .

nAChRs with varying combinations of α-subunits and β-subunits have differences in nicotine binding affinity, efficacy and desensitization rate, and have differential expression depending on the brain region and cell type 48 , 49 , 50 . For instance, at nicotine concentrations found in human smokers, β 2 -containing nAChRs desensitize relatively quickly after activation, whereas α 7 -containing nAChRs have a slower desensitization profile 48 . Chronic nicotine exposure in experimental animal models or in humans induces an increase in cortical expression of α 4 β 2 -containing nAChRs 51 , 52 , 53 , 54 , 55 , but also increases the expression of β 3 and β 4 nAChR subunits in the medial habenula (MHb)–interpeduncular nucleus (IPN) pathway 56 , 57 . It is clear that both the brain localization and the type of nAChR are critical elements in mediating the various effects of nicotine, but other factors such as rate of nicotine delivery may also modulate addictive effects of nicotine 58 .

Neurocircuitry of nicotine addiction

Nicotine has both rewarding effects (such as a ‘buzz’ or ‘high’) and aversive effects (such as nausea and dizziness), with the net outcome dependent on dose and others factors such as interindividual sensitivity and presence of tolerance 59 . Thus, the addictive properties of nicotine involve integration of contrasting signals from multiple brain regions that process reward and aversion (Fig.  4 ).

During initial use, nicotine exerts both reinforcing and aversive effects, which together determine the likelihood of continued use. As the individual transitions to more frequent patterns of chronic use, nicotine induces pharmacodynamic changes in brain circuits, which is thought to lead to a reduction in sensitivity to the aversive properties of the drug. Nicotine is also a powerful reinforcer that leads to the conditioning of secondary cues associated with the drug-taking experience (such as cigarette pack, sensory properties of cigarette smoke and feel of the cigarette in the hand or mouth), which serves to enhance the incentive salience of these environmental factors and drive further drug intake. When the individual enters into states of abstinence (such as daily during sleep at night or during quit attempts), withdrawal symptomology is experienced, which may include irritability, restlessness, learning or memory deficits, difficulty concentrating, anxiety and hunger. These negative affective and cognitive symptoms lead to an intensification of the individual’s preoccupation to obtain and use the tobacco/nicotine product, and subsequently such intense craving can lead to relapse.

The rewarding actions of nicotine have largely been attributed to the mesolimbic pathway, which consists of dopaminergic neurons in the ventral tegmental area (VTA) that project to the nucleus accumbens and prefrontal cortex 60 , 61 , 62 (Fig.  5 ). VTA integrating circuits and projection regions express several nAChR subtypes on dopaminergic, GABAergic, and glutamatergic neurons 63 , 64 . Ultimately, administration of nicotine increases dopamine levels through increased dopaminergic neuron firing in striatal and extrastriatal areas (such as the ventral pallidum) 65 (Fig.  6 ). This effect is involved in reward and is believed to be primarily mediated by the action of nicotine on α 4 -containing and β 2 -containing nAChRs in the VTA 66 , 67 .

Multiple lines of research have demonstrated that nicotine reinforcement is mainly controlled by two brain pathways, which relay predominantly reward-related or aversion-related signals. The rewarding properties of nicotine that promote drug intake involve the mesolimbic dopamine projection from the ventral tegmental area (VTA) to the nucleus accumbens (NAc). By contrast, the aversive properties of nicotine that limit drug intake and mitigate withdrawal symptoms involve the fasciculus retroflexus projection from the medial habenula (MHb) to the interpeduncular nucleus (IPN). Additional brain regions have also been implicated in various aspects of nicotine dependence, such as the prefrontal cortex (PFC), ventral pallidum (VP), nucleus tractus solitarius (NTS) and insula (not shown here for clarity). All of these brain regions are directly or indirectly interconnected as integrative circuits to drive drug-seeking and drug-taking behaviours.

Smokers received brain PET scans with [ 11 C]PHNO, a dopamine D 2/3 PET tracer that has high sensitivity in detecting fluctuations of dopamine. PET scans were performed during abstinence or after smoking a cigarette. Reduced binding potential (BP ND ) was observed after smoking, indicating increased dopamine levels in the ventral striatum and in the area that corresponds to the ventral pallidum. The images show clusters with statistically significant decreases of [ 11 C]PHNO BP ND after smoking a cigarette versus abstinence condition. Those clusters have been superimposed on structural T1 MRI images of the brain. Reprinted from ref. 65 , Springer Nature Limited.

The aversive properties of nicotine are mediated by neurons in the MHb, which project to the IPN. Studies in rodents using genetic knockdown and knockout strategies demonstrated that the α 5 -containing, α 3 -containing and β 4 -containing nAChRs in the MHb–IPN pathway mediate the aversive properties of nicotine that limit drug intake, especially when animals are given the opportunity to consume higher nicotine doses 68 , 69 , 70 , 71 , 72 . In addition to nAChRs, other signalling factors acting on the MHb terminals in the IPN also regulate the actions of nicotine. For instance, under conditions of chronic nicotine exposure or with optogenetic activation of IPN neurons, a subtype of IPN neurons co-expressing Chrna5 (encoding the α 5 nAChR subunit) and Amigo1 (encoding adhesion molecule with immunoglobulin-like domain 1) release nitric oxide from the cell body that retrogradely inhibits MHb axon terminals 70 . In addition, nicotine activates α 5 -containing nAChR-expressing neurons that project from the nucleus tractus solitarius to the IPN, leading to release of glucagon-like peptide-1 that binds to GLP receptors on habenular axon terminals, which subsequently increases IPN neuron activation and decreases nicotine self-administration 73 . Taken together, these findings suggest a dynamic signalling process at MHb axonal terminals in the IPN, which regulates the addictive properties of nicotine and determines the amount of nicotine that is self-administered.

Nicotine withdrawal in animal models can be assessed by examining somatic signs (such as shaking, scratching, head nods and chewing) and affective signs (such as increased anxiety-related behaviours and conditioned place aversion). Interestingly, few nicotine withdrawal somatic signs are found in mice with genetic knockout of the α 2 , α 5 or β 4 nAChR subunits 74 , 75 . By contrast, β 2 nAChR-knockout mice have fewer anxiety-related behaviours during nicotine withdrawal, with no differences in somatic symptoms compared with wild-type mice 74 , 76 .

In addition to the VTA (mediating reward) and the MHb–IPN pathway (mediating aversion), other brain areas are involved in nicotine addiction (Fig.  5 ). In animals, the insular cortex controls nicotine taking and nicotine seeking 77 . Moreover, humans with lesions of the insular cortex can quit smoking easily without relapse 78 . This finding led to the development of a novel therapeutic intervention modulating insula function (see Management, below) 79 , 80 . Various brain areas (shell of nucleus accumbens, basolateral amygdala and prelimbic cortex) expressing cannabinoid CB 1 receptors are also critical in controlling rewarding effects and relapse 81 , 82 . The α 1 -adrenergic receptor expressed in the cortex also control these effects, probably through glutamatergic afferents to the nucleus accumbens 83 .

Individual differences in nicotine addiction risk

Vulnerability to nicotine dependence varies between individuals, and the reasons for these differences are multidimensional. Many social factors (such as education level and income) play a role 84 . Broad psychological and social factors also modulate this risk. For example, peer smoking status, knowledge on effect of tobacco, expectation on social acceptance, exposure to passive smoking modulate the risk of initiating tobacco use 85 , 86 .

Genetic factors have a role in smoking initiation, the development of nicotine addiction and the likelihood of smoking cessation. Indeed, heritability has been estimated to contribute to approximatively half of the variability in nicotine dependence 87 , 88 , 89 , 90 . Important advances in our understanding of such genetic contributions have evolved with large-scale genome-wide association studies of smokers and non-smokers. One of the most striking findings has been that allelic variation in the CHRNA5 – CHRNA3 – CHRNB4 gene cluster, which encodes α 5 , α 3 and β 4 nAChR subunits, correlates with an increased vulnerability for nicotine addiction, indicated by a higher likelihood of becoming dependent on nicotine and smoking a greater number of cigarettes per day 91 , 92 , 93 , 94 , 95 . The most significant effect has been found for a single-nucleotide polymorphism in CHRNA5 (rs16969968), which results in an amino acid change and reduced function of α 5 -containing nAChRs 92 .

Allelic variation in CYP2A6 (encoding the CYP2A6 enzyme, which metabolizes nicotine) has also been associated with differential vulnerability to nicotine dependence 96 , 97 , 98 . CYP2A6 is highly polymorphic, resulting in variable enzymatic activity 96 , 99 , 100 . Individuals with allelic variation that results in slow nicotine metabolism consume less nicotine per day, experience less-severe withdrawal symptoms and are more successful at quitting smoking than individuals with normal or fast metabolism 101 , 102 , 103 , 104 . Moreover, individuals with slow nicotine metabolism have lower dopaminergic receptor expression in the dopamine D2 regions of the associative striatum and sensorimotor striatum in PET studies 105 and take fewer puffs of nicotine-containing cigarettes (compared with de-nicotinized cigarettes) in a forced choice task 106 . Slower nicotine metabolism is thought to increase the duration of action of nicotine, allowing nicotine levels to accumulate over time, therefore enabling lower levels of intake to sustain activation of nAChRs 107 .

Large-scale genetic studies have identified hundreds of other genetic loci that influence smoking initiation, age of smoking initiation, cigarettes smoked per day and successful smoking cessation 108 . The strongest genetic contributions to smoking through the nicotinic receptors and nicotine metabolism are among the strongest genetic contributors to lung cancer 109 . Other genetic variations (such as those related to cannabinoid, dopamine receptors or other neurotransmitters) may affect certain phenotypes related to smoking (such as nicotine preference and cue-reactivity) 110 , 111 , 112 , 113 , 114 , 115 .

Diagnosis, screening and prevention

Screening for cigarette smoking.

Screening for cigarette smoking should happen at every doctor’s visit 116 . In this regard, a simple and direct question about a person’s tobacco use can provide an opportunity to offer information about its potential risks and treatments to assist in quitting. All smokers should be offered assistance in quitting because even low levels of smoking present a significant health risk 33 , 117 , 118 . Smoking status can be assessed by self-categorization or self-reported assessment of smoking behaviour (Table  1 ). In people who smoke, smoking frequency can be assessed 119 and a combined quantity frequency measure such as pack-year history (that is, average number of cigarettes smoked per day multiplied by the number of years, divided by 20), can be used to estimate cumulative risk of adverse health outcomes. The Association for the Treatment of Tobacco Use and Dependence recommends that all electronic health records should document smoking status using the self-report categories listed in Table  1 .

Owing to the advent of e-cigarettes and heat-not-burn products, and the popularity of little cigars in the US that mimic combustible cigarettes, people who use tobacco may use multiple products concurrently 120 , 121 . Thus, screening for other nicotine and tobacco product use is important in clinical practice. The self-categorization approach can also be used to describe the use of these other products.

Traditionally tobacco use has been classified according to whether the smoker meets criteria for nicotine dependence in one of the two main diagnostic classifications: the DSM 122 (tobacco use disorder) and the ICD (tobacco dependence) 123 . The diagnosis of tobacco use disorder according to DSM-5 criteria requires the presence of at least 2 of 11 symptoms that have produced marked clinical impairment or distress within a 12-month period (Box  2 ). Of note, these symptoms are similar for all substance use disorder diagnoses and may not all be relevant to tobacco use disorder (such as failure to complete life roles). In the ICD-10, codes allow the identification of specific tobacco products used (cigarettes, chewing tobacco and other tobacco products).

Dependence can also be assessed as a continuous construct associated with higher levels of use, greater withdrawal and reduced likelihood of quitting. The level of dependence can be assessed with the Fagerström Test for Nicotine Dependence, a short questionnaire comprising six questions 124 (Box  2 ). A score of ≥4 indicates moderate to high dependence. As very limited time may be available in clinical consultations, the Heaviness of Smoking Index (HSI) was developed, which comprises two questions on the number of cigarettes smoked per day and how soon after waking the first cigarette is smoked 125 . The HSI can guide dosing for nicotine replacement therapy (NRT).

Other measures of cigarette dependence have been developed but are not used in the clinical setting, such as the Cigarette Dependence Scale 126 , Hooked on Nicotine Checklist 127 , Nicotine Dependence Syndrome Scale 128 , the Wisconsin Inventory of Smoking Dependence Motives (Brief) 129 and the Penn State Cigarette Dependence Index 130 . However, in practice, these are not often used, as the most important aspect is to screen for smoking and encourage all smokers to quit smoking regardless of their dependence status.

Box 2 DSM-5 criteria for tobacco use disorder and items of the Fagerström Test for nicotine dependence

DSM-5 (ref. 122 )

Taxonomic and diagnostic tool for tobacco use disorder published by the American Psychiatric Association.

A problematic pattern of tobacco use leading to clinically significant impairment or distress as manifested by at least two of the following, occurring within a 12-month period.

Tobacco often used in larger amounts or over a longer period of time than intended

A persistent desire or unsuccessful efforts to reduce or control tobacco use

A great deal of time spent in activities necessary to obtain or use tobacco

Craving, or a strong desire or urge to use tobacco

Recurrent tobacco use resulting in a failure to fulfil major role obligations at work, school or home

Continued tobacco use despite having persistent or recurrent social or interpersonal problems caused or exacerbated by the effects of tobacco (for example, arguments with others about tobacco use)

Important social, occupational or recreational activities given up or reduced because of tobacco use

Recurrent tobacco use in hazardous situations (such as smoking in bed)

Tobacco use continued despite knowledge of having a persistent or recurrent physical or psychological problem that is likely to have been caused or exacerbated by tobacco use

Tolerance, defined by either of the following.

A need for markedly increased amounts of tobacco to achieve the desired effect

A markedly diminished effect with continued use of the same amount of tobacco

Withdrawal, manifesting as either of the following.

Withdrawal syndrome for tobacco

Tobacco (or a closely related substance, such as nicotine) taken to relieve or avoid withdrawal symptoms

Fagerström Test for Nicotine Dependence 124

A standard instrument for assessing the intensity of physical addiction to nicotine.

How soon after you wake up do you smoke your first cigarette?

Within 5 min (scores 3 points)

5 to 30 min (scores 2 points)

31 to 60 min (scores 1 point)

After 60 min (scores 0 points)

Do you find it difficult not to smoke in places where you should not, such as in church or school, in a movie, at the library, on a bus, in court or in a hospital?

Yes (scores 1 point)

No (scores 0 points)

Which cigarette would you most hate to give up; which cigarette do you treasure the most?

The first one in the morning (scores 1 point)

Any other one (scores 0 points)

How many cigarettes do you smoke each day?

10 or fewer (scores 0 points)

11 to 20 (scores 1 point)

21 to 30 (scores 2 points)

31 or more (scores 3 points)

Do you smoke more during the first few hours after waking up than during the rest of the day?

Do you still smoke if you are so sick that you are in bed most of the day or if you have a cold or the flu and have trouble breathing?

A score of 7–10 points is classified as highly dependent; 4–6 points is classified as moderately dependent; <4 points is classified as minimally dependent.

DSM-5, Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition.

Young people who do not start smoking cigarettes between 15 and 25 years of age have a very low risk of ever smoking 24 , 131 , 132 . This age group provides a critical opportunity to prevent cigarette smoking using effective, evidence-based strategies to prevent smoking initiation and reduce escalation from experimentation to regular use 131 , 132 , 133 , 134 , 135 .

Effective prevention of cigarette uptake requires a comprehensive package of cost-effective policies 134 , 136 , 137 to synergistically reduce the population prevalence of cigarette smoking 131 , 135 . These policies include high rates of tobacco taxation 30 , 134 , 137 , 138 , widespread and rigorously enforced smoke-free policies 139 , bans on tobacco advertising and promotions 140 , use of plain packaging and graphic warnings about the health risks of smoking 135 , 141 , mass media and peer-based education programmes to discourage smoking, and enforcement of laws against the sale of cigarettes to young people below the minimum legal purchase age 131 , 135 . These policies make cigarettes less available and affordable to young people. Moreover, these policies make it more difficult for young people to purchase cigarettes and make smoking a much less socially acceptable practice. Of note, these policies are typically mostly enacted in HICs, which may be related to the declining prevalence of smoking in these countries, compared with the prevalence in LMICs.

Pharmacotherapy

Three evidence-based classes of pharmacotherapy are available for smoking cessation: NRT (using nicotine-based patches, gum, lozenges, mini-lozenges, nasal sprays and inhalers), varenicline (a nAChR partial agonist), and bupropion (a noradrenaline/dopamine reuptake inhibitor that also inhibits nAChR function and is also used as an antidepressant). These FDA-approved and EMA-approved pharmacotherapies are cost-effective smoking cessation treatments that double or triple successful abstinence rates compared with no treatment or placebo controls 116 , 142 .

Combinations of pharmacotherapies are also effective for smoking cessation 116 , 142 . For example, combining NRTs (such as the steady-state nicotine patch and as-needed NRT such as gum or mini-lozenge) is more effective than a single form of NRT 116 , 142 , 143 . Combining NRT and varenicline is the most effective smoking cessation pharmacotherapy 116 , 142 , 143 . Combining FDA-approved pharmacotherapy with behavioural counselling further increases the likelihood of successful cessation 142 . Second-line pharmacotherapies (for example, nortriptyline) have some potential for smoking cessation, but their use is limited due to their tolerability profile.

All smokers should receive pharmacotherapy to help them quit smoking, except those in whom pharmacotherapy has insufficient evidence of effectiveness (among adolescents, smokeless tobacco users, pregnant women or light smokers) or those in whom pharmacotherapy is medically contraindicated 144 . Table  2 provides specific information regarding dosing and duration for each FDA-approved pharmacotherapy. Extended use of pharmacotherapy beyond the standard 12-week regimen after cessation is effective and should be considered 116 . Moreover, preloading pharmacotherapy (that is, initiating cessation medication in advance of a quit attempt), especially with the nicotine patch, is a promising treatment, although further studies are required to confirm efficacy.

Cytisine has been used for smoking cessation in Eastern Europe for a long time and is available in some countries (such as Canada) without prescription 145 . Cytisine is a partial agonist of nAChRs and its structure was the precursor for the development of varenicline 145 . Cytisine is at least as effective as some approved pharmacotherapies for smoking cessation, such as NRT 146 , 147 , 148 , and the role of cytisine in smoking cessation is likely to expand in the future, notably owing to its much lower cost than traditional pharmacotherapies. E-cigarettes also have the potential to be useful as smoking cessation devices 149 , 150 . The 2020 US Surgeon General’s Report concluded that there was insufficient evidence to promote cytisine or e-cigarettes as effective smoking cessation treatments, but in the UK its use is recommended for smoking cessation (see ref. 15 for regularly updated review).

Counselling and behavioural treatments

Psychosocial counselling significantly increases the likelihood of successful cessation, especially when combined with pharmacotherapy. Even a counselling session lasting only 3 minutes can help smokers quit 116 , although the 2008 US Public Health Service guidelines and the Preventive Services Task Force 151 each concluded that more intensive counselling (≥20 min per session) is more effective than less intensive counselling (<20 min per session). Higher smoking cessation rates are obtained by using behavioural change techniques that target associative and self-regulatory processes 152 . In addition, behavioural change techniques that will favour commitment, social reward and identity associated with changed behaviour seems associated with higher success rates 152 . Evidence-based counselling focuses on providing social support during treatment, building skills to cope with withdrawal and cessation, and problem-solving in challenging situations 116 , 153 . Effective counselling can be delivered by diverse providers (such as physicians, nurses, pharmacists, social workers, psychologists and certified tobacco treatment specialists) 116 .

Counselling can be delivered in a variety of modalities. In-person individual and group counselling are effective, as is telephone counselling (quit lines) 142 . Internet and text-based intervention seem to be effective in smoking cessation, especially when they are interactive and tailored to a smoker’s specific circumstances 142 . Over the past several years, the number of smoking cessation smartphone apps has increased, but there the evidence that the use of these apps significantly increases smoking cessation rates is not sufficient.

Contingency management (providing financial incentives for abstinence or engagement in treatment) has shown promising results 154 , 155 but its effects are not sustained once the contingencies are removed 155 , 156 . Other treatments such as hypnosis, acupuncture and laser treatment have not been shown to improve smoking cessation rates compared with placebo treatments 116 . Moreover, no solid evidence supports the use of conventional transcranial magnetic stimulation (TMS) for long-term smoking cessation 157 , 158 .

Although a variety of empirically supported smoking cessation interventions are available, more than two-thirds of adult smokers who made quit attempts in the USA during the past year did not use an evidence-based treatment and the rate is likely to be lower in many other countries 142 . This speaks to the need to increase awareness of, and access to, effective cessation aids among all smokers.

Brain stimulation

The insula (part of the frontal cortex) is a critical brain structure involved in cigarette craving and relapse 78 , 79 . The activity of the insula can be modulated using an innovative approach called deep insula/prefrontal cortex TMS (deep TMS), which is effective in helping people quit smoking 80 , 159 . This approach has now been approved by the FDA as an effective smoking cessation intervention 80 . However, although this intervention was developed and is effective for smoking cessation, the number of people with access to it is limited owing to the limited number of sites equipped and with trained personnel, and the cost of this intervention.

Quality of life

Generic instruments (such as the Short-Form (SF-36) Health Survey) can be used to evaluate quality of life (QOL) in smokers. People who smoke rate their QOL lower than people who do not smoke both before and after they become smokers 160 , 161 . QOL improves when smokers quit 162 . Mental health may also improve on quitting smoking 163 . Moreover, QOL is much poorer in smokers with tobacco-related diseases, such as chronic respiratory diseases and cancers, than in individuals without tobacco-related diseases 161 , 164 . The dimensions of QOL that show the largest decrements in people who smoke are those related to physical health, day-to-day activities and mental health such as depression 160 . Smoking also increases the risk of diabetes mellitus 165 , 166 , which is a major determinant of poor QOL for a wide range of conditions.

The high toll of premature death from cigarette smoking can obscure the fact that many of the diseases that cause these deaths also produce substantial disability in the years before death 1 . Indeed, death in smokers is typically preceded by several years of living with the serious disability and impairment of everyday activities caused by chronic respiratory disease, heart disease and cancer 2 . Smokers’ QOL in these years may also be adversely affected by the adverse effects of the medical treatments that they receive for these smoking-related diseases (such as major surgery and radiotherapy).

Expanding cessation worldwide

The major global challenge is to consider individual and population-based strategies that could increase the substantially low rates of adult cessation in most LMICs and indeed strategies to ensure that even in HICs, cessation continues to increase. In general, the most effective tools recommended by WHO to expand cessation are the same tools that can prevent smoking initiation, notably higher tobacco taxes, bans on advertising and promotion, prominent warning labels or plain packaging, bans on public smoking, and mass media and educational efforts 29 , 167 . The effective use of these policies, particularly taxation, lags behind in most LMICs compared with most HICs, with important exceptions such as Brazil 167 . Access to effective pharmacotherapies and counselling as well as support for co-existing mental health conditions would also be required to accelerate cessation in LMICs. This is particularly important as smokers living in LMICs often have no access to the full range of effective treatment options.

Regulating access to e-cigarettes

How e-cigarettes should be used is debated within the tobacco control field. In some countries (for example, the UK), the use of e-cigarettes as a cigarette smoking cessation aid and as a harm reduction strategy is supported, based on the idea that e-cigarette use will lead to much less exposure to toxic compounds than tobacco use, therefore reducing global harm. In other countries (for example, the USA), there is more concern with preventing the increased use of e-cigarettes by youths that may subsequently lead to smoking 25 , 26 . Regulating e-cigarettes in nuanced ways that enable smokers to access those products whilst preventing their uptake among youths is critical.

Regulating nicotine content in tobacco products

Reducing the nicotine content of cigarettes could potentially produce less addictive products that would allow a gradual reduction in the population prevalence of smoking. Some clinical studies have found no compensatory increase in smoking whilst providing access to low nicotine tobacco 168 . Future regulation may be implemented to gradually decrease the nicotine content of combustible tobacco and other nicotine products 169 , 170 , 171 .

Tobacco end games

Some individuals have proposed getting rid of commercial tobacco products this century or using the major economic disruption arising from the COVID-19 pandemic to accelerate the demise of the tobacco industry 172 , 173 . Some tobacco producers have even proposed this strategy as an internal goal, with the idea of switching to nicotine delivery systems that are less harmful ( Philip Morris International ). Some countries are moving towards such an objective; for example, in New Zealand, the goal that fewer than 5% of New Zealanders will be smokers in 2025 has been set (ref. 174 ). The tobacco end-game approach would overall be the best approach to reduce the burden of tobacco use on society, but it would require coordination of multiple countries and strong public and private consensus on the strategy to avoid a major expansion of the existing illicit market in tobacco products in some countries.

Innovative interventions

The COVID-19 pandemic has shown that large-scale investment in research can lead to rapid development of successful therapeutic interventions. By contrast, smoking cessation has been underfunded compared with the contribution that it makes to the global burden of disease. In addition, there is limited coordination between research teams and most studies are small-scale and often underpowered 79 . It is time to fund an ambitious, coordinated programme of research to test the most promising therapies based on an increased understanding of the neurobiological basis of smoking and nicotine addiction (Table  3 ). Many of those ideas have not yet been tested properly and this could be carried out by a coordinated programme of research at the international level.

GBD 2019 Tobacco Collaborators. Spatial, temporal, and demographic patterns in prevalence of smoking tobacco use and attributable disease burden in 204 countries and territories, 1990-2019: a systematic analysis from the Global Burden of Disease Study 2019. Lancet 397 , 2337–2360 (2021). This study summarizes the burden of disease induced by tobacco worldwide .

Google Scholar  

West, R. Tobacco smoking: health impact, prevalence, correlates and interventions. Psychol. Health 32 , 1018–1036 (2017).

PubMed   PubMed Central   Google Scholar  

West, R. The multiple facets of cigarette addiction and what they mean for encouraging and helping smokers to stop. COPD 6 , 277–283 (2009).

PubMed   Google Scholar  

Fagerström, K. Determinants of tobacco use and renaming the FTND to the Fagerström test for cigarette dependence. Nicotine Tob. Res. 14 , 75–78 (2012).

National Center for Chronic Disease Prevention and Health Promotion (US) Office on Smoking and Health. The Health Consequences of Smoking: 50 Years of Progress. A Report of the Surgeon General (Centers for Disease Control and Prevention, 2014).

Doll, R. & Hill, A. B. Smoking and carcinoma of the lung; preliminary report. Br. Med. J. 2 , 739–748 (1950).

CAS   PubMed   PubMed Central   Google Scholar  

Royal College of Physicians. Smoking and health. Summary of a report of the Royal College of Physicians of London on smoking in relation to cancer of the lung and other diseases (Pitman Medical Publishing, 1962).

Henningfield, J. E., Smith, T. T., Kleykamp, B. A., Fant, R. V. & Donny, E. C. Nicotine self-administration research: the legacy of Steven R. Goldberg and implications for regulation, health policy, and research. Psychopharmacology 233 , 3829–3848 (2016).

Le Foll, B. & Goldberg, S. R. Effects of nicotine in experimental animals and humans: an update on addictive properties. Hand. Exp. Pharmacol. https://doi.org/10.1007/978-3-540-69248-5_12 (2009).

Article   Google Scholar  

Proctor, R. N. The history of the discovery of the cigarette–lung cancer link: evidentiary traditions, corporate denial, global toll. Tob. Control. 21 , 87–91 (2012).

Hall, B. J. et al. Differential effects of non-nicotine tobacco constituent compounds on nicotine self-administration in rats. Pharmacol. Biochem. Behav. 120 , 103–108 (2014).

Musso, F. et al. Smoking impacts on prefrontal attentional network function in young adult brains. Psychopharmacology 191 , 159–169 (2007).

CAS   PubMed   Google Scholar  

Goriounova, N. A. & Mansvelder, H. D. Short- and long-term consequences of nicotine exposure during adolescence for prefrontal cortex neuronal network function. Cold Spring Harb. Perspect. Med. 2 , a012120 (2012).

Fagerström, K. O. & Bridgman, K. Tobacco harm reduction: the need for new products that can compete with cigarettes. Addictive Behav. 39 , 507–511 (2014).

Hartmann-Boyce, J. et al. Electronic cigarettes for smoking cessation. Cochrane Database Syst. Rev. 9 , CD010216 (2021).

Jha, P. The hazards of smoking and the benefits of cessation: a critical summation of the epidemiological evidence in high-income countries. eLife https://doi.org/10.7554/eLife.49979 (2020).

Article   PubMed   PubMed Central   Google Scholar  

Palipudi, K. M. et al. Social determinants of health and tobacco use in thirteen low and middle income countries: evidence from Global Adult Tobacco Survey. PLoS ONE 7 , e33466 (2012).

Goodwin, R. D., Pagura, J., Spiwak, R., Lemeshow, A. R. & Sareen, J. Predictors of persistent nicotine dependence among adults in the United States. Drug Alcohol. Depend. 118 , 127–133 (2011).

Weinberger, A. H. et al. Cigarette use is increasing among people with illicit substance use disorders in the United States, 2002-14: emerging disparities in vulnerable populations. Addiction 113 , 719–728 (2018).

Evans-Polce, R. J., Kcomt, L., Veliz, P. T., Boyd, C. J. & McCabe, S. E. Alcohol, tobacco, and comorbid psychiatric disorders and associations with sexual identity and stress-related correlates. Am. J. Psychiatry 177 , 1073–1081 (2020).

Hassan, A. N. & Le Foll, B. Survival probabilities and predictors of major depressive episode incidence among individuals with various types of substance use disorders. J. Clin. Psychiatry https://doi.org/10.4088/JCP.20m13637 (2021).

Article   PubMed   Google Scholar  

Smith, P. H., Mazure, C. M. & McKee, S. A. Smoking and mental illness in the U.S. population. Tob. Control. 23 , e147–e153 (2014).

Bourgault, Z., Rubin-Kahana, D. S., Hassan, A. N., Sanches, M. & Le Foll, B. Multiple substance use disorders and self-reported cognitive function in U.S. adults: associations and sex-differences in a nationally representative sample. Front. Psychiatry https://doi.org/10.3389/fpsyt.2021.797578 (2022).

Reitsma, M. B. et al. Spatial, temporal, and demographic patterns in prevalence of smoking tobacco use and initiation among young people in 204 countries and territories, 1990-2019. Lancet Public Health 6 , e472–e481 (2021).

Warner, K. E. How to think–not feel–about tobacco harm reduction. Nicotine Tob. Res. 21 , 1299–1309 (2019).

Soneji, S. et al. Association between initial use of e-cigarettes and subsequent cigarette smoking among adolescents and young adults: a systematic review and meta-analysis. JAMA Pediatr. 171 , 788–797 (2017).

Levy, D. T. et al. Examining the relationship of vaping to smoking initiation among US youth and young adults: a reality check. Tob. Control. 28 , 629–635 (2019).

National Center for Chronic Disease Prevention and Health Promotion (US) Office on Smoking and Health. The health consequences of smoking — 50 years of progress: a report of the Surgeon General (Centers for Disease Control and Prevention, 2014).

Jha, P. & Peto, R. Global effects of smoking, of quitting, and of taxing tobacco. N. Engl. J. Med. 370 , 60–68 (2014). This review covers the impact of tobacco, of quitting smoking and the importance of taxation to impact prevalence of smoking .

Jha, P. & Peto., R. in Tobacco Tax Reform: At the Crossroads of Health and Development . (eds Marquez, P. V. & Moreno-Dodson, B.) 55–72 (World Bank Group, 2017).

Jha, P. et al. 21st-century hazards of smoking and benefits of cessation in the United States. N. Engl. J. Med. 368 , 341–350 (2013).

Banks, E. et al. Tobacco smoking and all-cause mortality in a large Australian cohort study: findings from a mature epidemic with current low smoking prevalence. BMC Med. 13 , 38 (2015).

Pirie, K. et al. The 21st century hazards of smoking and benefits of stopping: a prospective study of one million women in the UK. Lancet 381 , 133–141 (2013).

Jha, P. et al. A nationally representative case-control study of smoking and death in India. N. Engl. J. Med. 358 , 1137–1147 (2008).

Chan, E. D. et al. Tobacco exposure and susceptibility to tuberculosis: is there a smoking gun? Tuberculosis 94 , 544–550 (2014).

Wang, M. G. et al. Association between tobacco smoking and drug-resistant tuberculosis. Infect. Drug Resist. 11 , 873–887 (2018).

Jha, P. et al. Social inequalities in male mortality, and in male mortality from smoking: indirect estimation from national death rates in England and Wales, Poland, and North America. Lancet 368 , 367–370 (2006).

Jha, P., Gelband, H, Irving, H. & Mishra, S. in Reducing Social Inequalities in Cancer: Evidence and Priorities for Research (eds Vaccarella, S et al.) 161–166 (IARC, 2018).

Jha, P. Expanding smoking cessation world-wide. Addiction 113 , 1392–1393 (2018).

Jha, P. Avoidable global cancer deaths and total deaths from smoking. Nat. Rev. Cancer 9 , 655–664 (2009).

Wittenberg, R. E., Wolfman, S. L., De Biasi, M. & Dani, J. A. Nicotinic acetylcholine receptors and nicotine addiction: a brief introduction. Neuropharmacology 177 , 108256 (2020).

Boulter, J. et al. Functional expression of two neuronal nicotinic acetylcholine receptors from cDNA clones identifies a gene family. Proc. Natl Acad. Sci. USA 84 , 7763–7767 (1987).

Couturier, S. et al. A neuronal nicotinic acetylcholine receptor subunit (α7) is developmentally regulated and forms a homo-oligomeric channel blocked by α-BTX. Neuron 5 , 847–856 (1990).

Picciotto, M. R., Addy, N. A., Mineur, Y. S. & Brunzell, D. H. It is not “either/or”: activation and desensitization of nicotinic acetylcholine receptors both contribute to behaviors related to nicotine addiction and mood. Prog. Neurobiol. 84 , 329–342 (2008).

Changeux, J. P. Structural identification of the nicotinic receptor ion channel. Trends Neurosci. 41 , 67–70 (2018).

McKay, B. E., Placzek, A. N. & Dani, J. A. Regulation of synaptic transmission and plasticity by neuronal nicotinic acetylcholine receptors. Biochem. Pharmacol. 74 , 1120–1133 (2007).

Wonnacott, S. Presynaptic nicotinic ACh receptors. Trends Neurosci. 20 , 92–98 (1997).

Wooltorton, J. R., Pidoplichko, V. I., Broide, R. S. & Dani, J. A. Differential desensitization and distribution of nicotinic acetylcholine receptor subtypes in midbrain dopamine areas. J. Neurosci. 23 , 3176–3185 (2003).

Gipson, C. D. & Fowler, C. D. Nicotinic receptors underlying nicotine dependence: evidence from transgenic mouse models. Curr. Top. Behav. Neurosci. 45 , 101–121 (2020).

Hamouda, A. K. et al. Potentiation of (α4)2(β2)3, but not (α4)3(β2)2, nicotinic acetylcholine receptors reduces nicotine self-administration and withdrawal symptoms. Neuropharmacology 190 , 108568 (2021).

Lallai, V. et al. Nicotine acts on cholinergic signaling mechanisms to directly modulate choroid plexus function. eNeuro https://doi.org/10.1523/ENEURO.0051-19.2019 (2019).

Benwell, M. E., Balfour, D. J. & Anderson, J. M. Evidence that tobacco smoking increases the density of (-)-[3H]nicotine binding sites in human brain. J. Neurochem. 50 , 1243–1247 (1988).

Perry, D. C., Davila-Garcia, M. I., Stockmeier, C. A. & Kellar, K. J. Increased nicotinic receptors in brains from smokers: membrane binding and autoradiography studies. J. Pharmacol. Exp. Ther. 289 , 1545–1552 (1999).

Marks, M. J. et al. Nicotine binding and nicotinic receptor subunit RNA after chronic nicotine treatment. J. Neurosci. 12 , 2765–2784 (1992).

Le Foll, B. et al. Impact of short access nicotine self-administration on expression of α4β2* nicotinic acetylcholine receptors in non-human primates. Psychopharmacology 233 , 1829–1835 (2016).

Meyers, E. E., Loetz, E. C. & Marks, M. J. Differential expression of the beta4 neuronal nicotinic receptor subunit affects tolerance development and nicotinic binding sites following chronic nicotine treatment. Pharmacol. Biochem. Behav. 130 , 1–8 (2015).

Zhao-Shea, R., Liu, L., Pang, X., Gardner, P. D. & Tapper, A. R. Activation of GABAergic neurons in the interpeduncular nucleus triggers physical nicotine withdrawal symptoms. Curr. Biol. 23 , 2327–2335 (2013).

Jensen, K. P., Valentine, G., Gueorguieva, R. & Sofuoglu, M. Differential effects of nicotine delivery rate on subjective drug effects, urges to smoke, heart rate and blood pressure in tobacco smokers. Psychopharmacology 237 , 1359–1369 (2020).

Villanueva, H. F., James, J. R. & Rosecrans, J. A. Evidence of pharmacological tolerance to nicotine. NIDA Res. Monogr. 95 , 349–350 (1989).

Corrigall, W. A., Coen, K. M. & Adamson, K. L. Self-administered nicotine activates the mesolimbic dopamine system through the ventral tegmental area. Brain Res. 653 , 278–284 (1994).

Nisell, M., Nomikos, G. G., Hertel, P., Panagis, G. & Svensson, T. H. Condition-independent sensitization of locomotor stimulation and mesocortical dopamine release following chronic nicotine treatment in the rat. Synapse 22 , 369–381 (1996).

Rice, M. E. & Cragg, S. J. Nicotine amplifies reward-related dopamine signals in striatum. Nat. Neurosci. 7 , 583–584 (2004).

Mameli-Engvall, M. et al. Hierarchical control of dopamine neuron-firing patterns by nicotinic receptors. Neuron 50 , 911–921 (2006).

Picciotto, M. R., Higley, M. J. & Mineur, Y. S. Acetylcholine as a neuromodulator: cholinergic signaling shapes nervous system function and behavior. Neuron 76 , 116–129 (2012).

Le Foll, B. et al. Elevation of dopamine induced by cigarette smoking: novel insights from a [11C]-+-PHNO PET study in humans. Neuropsychopharmacology 39 , 415–424 (2014). This brain imaging study identified the brain areas in which smoking elevates dopamine levels .

Maskos, U. et al. Nicotine reinforcement and cognition restored by targeted expression of nicotinic receptors. Nature 436 , 103–107 (2005). This article discusses the implication of the β 2 - containing nAChRs in the VTA in mammalian cognitive function .

Picciotto, M. R. et al. Acetylcholine receptors containing the beta2 subunit are involved in the reinforcing properties of nicotine. Nature 391 , 173–177 (1998). This article discusses the implication of the β 2 - containing nAChRs in addictive effects of nicotine .

Fowler, C. D., Lu, Q., Johnson, P. M., Marks, M. J. & Kenny, P. J. Habenular alpha5 nicotinic receptor subunit signalling controls nicotine intake. Nature 471 , 597–601 (2011). This article discusses the implication of the α5 nicotinic receptor located in the MHb in a mechanism mediating the aversive effects of nicotine .

Elayouby, K. S. et al. α3* Nicotinic acetylcholine receptors in the habenula-interpeduncular nucleus circuit regulate nicotine intake. J. Neurosci. https://doi.org/10.1523/JNEUROSCI.0127-19.2020 (2020).

Ables, J. L. et al. Retrograde inhibition by a specific subset of interpeduncular α5 nicotinic neurons regulates nicotine preference. Proc. Natl Acad. Sci. USA 114 , 13012–13017 (2017).

Frahm, S. et al. Aversion to nicotine is regulated by the balanced activity of β4 and α5 nicotinic receptor subunits in the medial habenula. Neuron 70 , 522–535 (2011).

Jackson, K. J. et al. Role of α5 nicotinic acetylcholine receptors in pharmacological and behavioral effects of nicotine in mice. J. Pharmacol. Exp. Ther. 334 , 137–146 (2010).

Tuesta, L. M. et al. GLP-1 acts on habenular avoidance circuits to control nicotine intake. Nat. Neurosci. 20 , 708–716 (2017).

Salas, R., Pieri, F. & De Biasi, M. Decreased signs of nicotine withdrawal in mice null for the β4 nicotinic acetylcholine receptor subunit. J. Neurosci. 24 , 10035–10039 (2004).

Salas, R., Sturm, R., Boulter, J. & De Biasi, M. Nicotinic receptors in the habenulo-interpeduncular system are necessary for nicotine withdrawal in mice. J. Neurosci. 29 , 3014–3018 (2009).

Jackson, K. J., Martin, B. R., Changeux, J. P. & Damaj, M. I. Differential role of nicotinic acetylcholine receptor subunits in physical and affective nicotine withdrawal signs. J. Pharmacol. Exp. Ther. 325 , 302–312 (2008).

Le Foll, B. et al. Translational strategies for therapeutic development in nicotine addiction: rethinking the conventional bench to bedside approach. Prog. Neuropsychopharmacol. Biol. Psychiatry 52 , 86–93 (2014).

Naqvi, N. H., Rudrauf, D., Damasio, H. & Bechara, A. Damage to the insula disrupts addiction to cigarette smoking. Science 315 , 531–534 (2007). This article discusses the implication of the insular cortex in tobacco addiction .

Ibrahim, C. et al. The insula: a brain stimulation target for the treatment of addiction. Front. Pharmacol. 10 , 720 (2019).

Zangen, A. et al. Repetitive transcranial magnetic stimulation for smoking cessation: a pivotal multicenter double-blind randomized controlled trial. World Psychiatry 20 , 397–404 (2021). This study validated the utility of deep insula/prefrontal cortex rTMS for smoking cessation .

Le Foll, B., Forget, B., Aubin, H. J. & Goldberg, S. R. Blocking cannabinoid CB1 receptors for the treatment of nicotine dependence: insights from pre-clinical and clinical studies. Addict. Biol. 13 , 239–252 (2008).

Kodas, E., Cohen, C., Louis, C. & Griebel, G. Cortico-limbic circuitry for conditioned nicotine-seeking behavior in rats involves endocannabinoid signaling. Psychopharmacology 194 , 161–171 (2007).

Forget, B. et al. Noradrenergic α1 receptors as a novel target for the treatment of nicotine addiction. Neuropsychopharmacology 35 , 1751–1760 (2010).

Garrett, B. E., Dube, S. R., Babb, S. & McAfee, T. Addressing the social determinants of health to reduce tobacco-related disparities. Nicotine Tob. Res. 17 , 892–897 (2015).

Polanska, K., Znyk, M. & Kaleta, D. Susceptibility to tobacco use and associated factors among youth in five central and eastern European countries. BMC Public Health 22 , 72 (2022).

Volkow, N. D. Personalizing the treatment of substance use disorders. Am. J. Psychiatry 177 , 113–116 (2020).

Li, M. D., Cheng, R., Ma, J. Z. & Swan, G. E. A meta-analysis of estimated genetic and environmental effects on smoking behavior in male and female adult twins. Addiction 98 , 23–31 (2003).

Carmelli, D., Swan, G. E., Robinette, D. & Fabsitz, R. Genetic influence on smoking–a study of male twins. N. Engl. J. Med. 327 , 829–833 (1992).

Broms, U., Silventoinen, K., Madden, P. A. F., Heath, A. C. & Kaprio, J. Genetic architecture of smoking behavior: a study of Finnish adult twins. Twin Res. Hum. Genet. 9 , 64–72 (2006).

Kendler, K. S., Thornton, L. M. & Pedersen, N. L. Tobacco consumption in Swedish twins reared apart and reared together. Arch. Gen. Psychiat 57 , 886–892 (2000).

Saccone, N. L. et al. The CHRNA5-CHRNA3-CHRNB4 nicotinic receptor subunit gene cluster affects risk for nicotine dependence in African-Americans and in European-Americans. Cancer Res. 69 , 6848–6856 (2009).

Bierut, L. J. et al. Variants in nicotinic receptors and risk for nicotine dependence. Am. J. Psychiatry 165 , 1163–1171 (2008). This study demonstrates that nAChR gene variants are important in nicotine addiction .

Bierut, L. J. et al. Novel genes identified in a high-density genome wide association study for nicotine dependence. Hum. Mol. Genet. 16 , 24–35 (2007).

Berrettini, W. et al. α-5/α-3 nicotinic receptor subunit alleles increase risk for heavy smoking. Mol. Psychiatry 13 , 368–373 (2008).

Sherva, R. et al. Association of a single nucleotide polymorphism in neuronal acetylcholine receptor subunit alpha 5 (CHRNA5) with smoking status and with ‘pleasurable buzz’ during early experimentation with smoking. Addiction 103 , 1544–1552 (2008).

Thorgeirsson, T. E. et al. Sequence variants at CHRNB3-CHRNA6 and CYP2A6 affect smoking behavior. Nat. Genet. 42 , 448–453 (2010).

Ray, R., Tyndale, R. F. & Lerman, C. Nicotine dependence pharmacogenetics: role of genetic variation in nicotine-metabolizing enzymes. J. Neurogenet. 23 , 252–261 (2009).

Bergen, A. W. et al. Drug metabolizing enzyme and transporter gene variation, nicotine metabolism, prospective abstinence, and cigarette consumption. PLoS ONE 10 , e0126113 (2015).

Mwenifumbo, J. C. et al. Identification of novel CYP2A6*1B variants: the CYP2A6*1B allele is associated with faster in vivo nicotine metabolism. Clin. Pharmacol. Ther. 83 , 115–121 (2008).

Raunio, H. & Rahnasto-Rilla, M. CYP2A6: genetics, structure, regulation, and function. Drug Metab. Drug Interact. 27 , 73–88 (2012).

CAS   Google Scholar  

Patterson, F. et al. Toward personalized therapy for smoking cessation: a randomized placebo-controlled trial of bupropion. Clin. Pharmacol. Ther. 84 , 320–325 (2008).

Rodriguez, S. et al. Combined analysis of CHRNA5, CHRNA3 and CYP2A6 in relation to adolescent smoking behaviour. J. Psychopharmacol. 25 , 915–923 (2011).

Strasser, A. A., Malaiyandi, V., Hoffmann, E., Tyndale, R. F. & Lerman, C. An association of CYP2A6 genotype and smoking topography. Nicotine Tob. Res. 9 , 511–518 (2007).

Liakoni, E. et al. Effects of nicotine metabolic rate on withdrawal symptoms and response to cigarette smoking after abstinence. Clin. Pharmacol. Ther. 105 , 641–651 (2019).

Di Ciano, P. et al. Influence of nicotine metabolism ratio on [11C]-(+)-PHNO PET binding in tobacco smokers. Int. J. Neuropsychopharmacol. 21 , 503–512 (2018).

Butler, K. et al. Impact of Cyp2a6 activity on nicotine reinforcement and cue-reactivity in daily smokers. Nicotine Tob. Res. https://doi.org/10.1093/ntr/ntab064 (2021).

Benowitz, N. L., Swan, G. E., Jacob, P. 3rd, Lessov-Schlaggar, C. N. & Tyndale, R. F. CYP2A6 genotype and the metabolism and disposition kinetics of nicotine. Clin. Pharmacol. Ther. 80 , 457–467 (2006).

Liu, M. et al. Association studies of up to 1.2 million individuals yield new insights into the genetic etiology of tobacco and alcohol use. Nat. Genet. 51 , 237–244 (2019).

McKay, J. D. et al. Large-scale association analysis identifies new lung cancer susceptibility loci and heterogeneity in genetic susceptibility across histological subtypes. Nat. Genet. 49 , 1126–1132 (2017).

Chukwueke, C. C. et al. The CB1R rs2023239 receptor gene variant significantly affects the reinforcing effects of nicotine, but not cue reactivity, in human smokers. Brain Behav. 11 , e01982 (2021).

Ahrens, S. et al. Modulation of nicotine effects on selective attention by DRD2 and CHRNA4 gene polymorphisms. Psychopharmacology 232 , 2323–2331 (2015).

Harrell, P. T. et al. Dopaminergic genetic variation moderates the effect of nicotine on cigarette reward. Psychopharmacology 233 , 351–360 (2016).

Lerman, C. et al. Role of functional genetic variation in the dopamine D2 receptor (DRD2) in response to bupropion and nicotine replacement therapy for tobacco dependence: results of two randomized clinical trials. Neuropsychopharmacology 31 , 231–242 (2006).

Le Foll, B., Gallo, A., Le Strat, Y., Lu, L. & Gorwood, P. Genetics of dopamine receptors and drug addiction: a comprehensive review. Behav. Pharmacol. 20 , 1–17 (2009).

Chukwueke, C. C. et al. Exploring the role of the Ser9Gly (rs6280) dopamine D3 receptor polymorphism in nicotine reinforcement and cue-elicited craving. Sci. Rep. 10 , 4085 (2020).

The Clinical Practice Guideline Treating Tobacco Use and Dependence 2008 Update Panel, Liaisons, and Staff A clinical practice guideline for treating tobacco use and dependence: 2008 update: a U.S. Public Health Service report. Am. J. Prev. Med. 35 , 158–176 (2008).

Hackshaw, A., Morris, J. K., Boniface, S., Tang, J. L. & Milenković, D. Low cigarette consumption and risk of coronary heart disease and stroke: meta-analysis of 141 cohort studies in 55 study reports. BMJ 360 , j5855 (2018).

Qin, W. et al. Light cigarette smoking increases risk of all-cause and cause-specific mortality: findings from the NHIS cohort study. Int. J. Env. Res. Public Health https://doi.org/10.3390/ijerph17145122 (2020).

Rodu, B. & Plurphanswat, N. Mortality among male smokers and smokeless tobacco users in the USA. Harm Reduct. J. 16 , 50 (2019).

Kasza, K. A. et al. Tobacco-product use by adults and youths in the United States in 2013 and 2014. N. Engl. J. Med. 376 , 342–353 (2017).

Richardson, A., Xiao, H. & Vallone, D. M. Primary and dual users of cigars and cigarettes: profiles, tobacco use patterns and relevance to policy. Nicotine Tob. Res. 14 , 927–932 (2012).

American Psychiatric Association. Diagnostic and Statistical Manual of Mental disorders 5th edn (American Psychiatric Association, 2013).

World Health Organization. Tobacco fact sheet. WHO https://www.who.int/news-room/fact-sheets/detail/tobacco (2021).

Heatherton, T. F., Kozlowski, L. T., Frecker, R. C. & Fagerström, K. O. The Fagerström test for nicotine dependence: a revision of the Fagerström tolerance questionnaire. Br. J. Addict. 86 , 1119–1127 (1991).

Heatherton, T. F., Kozlowski, L. T., Frecker, R. C., Rickert, W. & Robinson, J. Measuring the heaviness of smoking: using self-reported time to the first cigarette of the day and number of cigarettes smoked per day. Br. J. Addict. 84 , 791–799 (1989).

Etter, J. F., Le Houezec, J. & Perneger, T. V. A self-administered questionnaire to measure dependence on cigarettes: the cigarette dependence scale. Neuropsychopharmacology 28 , 359–370 (2003).

DiFranza, J. R. et al. Measuring the loss of autonomy over nicotine use in adolescents: the DANDY (Development and Assessment of Nicotine Dependence in Youths) study. Arch. Pediatr. Adolesc. Med. 156 , 397–403 (2002).

Shiffman, S., Waters, A. & Hickcox, M. The Nicotine Dependence Syndrome Scale: a multidimensional measure of nicotine dependence. Nicotine Tob. Res. 6 , 327–348 (2004).

Smith, S. S. et al. Development of the Brief Wisconsin Inventory of Smoking Dependence Motives. Nicotine Tob. Res. 12 , 489–499 (2010).

Foulds, J. et al. Development of a questionnaire for assessing dependence on electronic cigarettes among a large sample of ex-smoking E-cigarette users. Nicotine Tob. Res. 17 , 186–192 (2015).

National Center for Chronic Disease Prevention and Health Promotion (US) Office on Smoking and Health. Preventing tobacco use among youth and young adults: a report of the Surgeon General (Centers for Disease Control and Prevention, 2012).

World Health Organization. Tobacco control to improve child health and development. Thematic brief (WHO, 2021).

Lantz, P. M. et al. Investing in youth tobacco control: a review of smoking prevention and control strategies. Tob. Control. 9 , 47–63 (2000).

Leão, T., Kunst, A. E. & Perelman, J. Cost-effectiveness of tobacco control policies and programmes targeting adolescents: a systematic review. Eur. J. Public Health 28 , 39–43 (2018).

Royal College of Physicians. Smoking and health 2021: a coming of age for tobacco control? (RCP, 2021).

Higashi, H. et al. Cost effectiveness of tobacco control policies in Vietnam: the case of population-level interventions. Appl. Health Econ. Health Policy 9 , 183–196 (2011).

Ranson, M. K., Jha, P., Chaloupka, F. J. & Nguyen, S. N. Global and regional estimates of the effectiveness and cost-effectiveness of price increases and other tobacco control policies. Nicotine Tob. Res. 4 , 311–319 (2002).

International Agency for Research on Cancer. I ARC Handbooks of Cancer Prevention: Tobacco control Vol. 14 (IARC, 2011).

Frazer, K. et al. Legislative smoking bans for reducing harms from secondhand smoke exposure, smoking prevalence and tobacco consumption. Cochrane Database Syst. Rev. 2 , CD005992 (2016).

Hoffman, S. J. & Tan, C. Overview of systematic reviews on the health-related effects of government tobacco control policies. BMC Public Health 15 , 744 (2015).

McNeill, A. et al. Tobacco packaging design for reducing tobacco use. Cochrane Database Syst. Rev. 4 , CD011244 (2017).

National Center for Chronic Disease Prevention and Health Promotion (US) Office on Smoking and Health. Smoking cessation: a report of the Surgeon General (Department of Health and Human Services, 2020).

Lindson, N. et al. Different doses, durations and modes of delivery of nicotine replacement therapy for smoking cessation. Cochrane Database Syst. Rev. 4 , CD013308 (2019).

Krist, A. H. et al. Interventions for tobacco smoking cessation in adults, including pregnant persons: US Preventive Services Task Force recommendation statement. JAMA 325 , 265–279 (2021).

Tutka, P. & Zatonski, W. Cytisine for the treatment of nicotine addiction: from a molecule to therapeutic efficacy. Pharmacol. Rep. 58 , 777–798 (2006).

Courtney, R. J. et al. Effect of cytisine vs varenicline on smoking cessation: a randomized clinical trial. JAMA 326 , 56–64 (2021).

Walker, N. et al. Cytisine versus nicotine for smoking cessation. N. Engl. J. Med. 371 , 2353–2362 (2014). This study validated the utility of cytisine for smoking cessation .

West, R. et al. Placebo-controlled trial of cytisine for smoking cessation. N. Engl. J. Med. 365 , 1193–1200 (2011).

Hajek, P. et al. E-cigarettes compared with nicotine replacement therapy within the UK Stop Smoking Services: the TEC RCT. Health Technol. Assess. 23 , 1–82 (2019).

Walker, N. et al. Nicotine patches used in combination with e-cigarettes (with and without nicotine) for smoking cessation: a pragmatic, randomised trial. Lancet Respir. Med. 8 , 54–64 (2020).

Siu, A. L., U.S. Preventive Services Task Force. Behavioral and pharmacotherapy interventions for tobacco smoking cessation in adults, including pregnant women: U.S. Preventive Services Task Force recommendation statement. Ann. Intern. Med. 163 , 622–634 (2015).

Black, N. et al. Behaviour change techniques associated with smoking cessation in intervention and comparator groups of randomized controlled trials: a systematic review and meta-regression. Addiction 115 , 2008–2020 (2020).

Center for Substance Abuse and Treatment. Detoxification and Substance Abuse Treatment (Center for Substance Abuse and Treatment, 2006).

Cahill, K., Hartmann-Boyce, J. & Perera, R. Incentives for smoking cessation. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.CD004307.pub5 (2015).

Secades-Villa, R., Aonso-Diego, G., García-Pérez, Á. & González-Roz, A. Effectiveness of contingency management for smoking cessation in substance users: a systematic review and meta-analysis. J. Consult. Clin. Psychol. 88 , 951–964 (2020).

Cahill, K. & Perera, R. Competitions and incentives for smoking cessation. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.CD004307.pub4 (2011).

Trojak, B. et al. Transcranial magnetic stimulation combined with nicotine replacement therapy for smoking cessation: a randomized controlled trial. Brain Stimul. 8 , 1168–1174 (2015).

Wing, V. C. et al. Brain stimulation methods to treat tobacco addiction. Brain Stimul. 6 , 221–230 (2013).

Dinur-Klein, L. et al. Smoking cessation induced by deep repetitive transcranial magnetic stimulation of the prefrontal and insular cortices: a prospective, randomized controlled trial. Biol. Psychiatry 76 , 742–749 (2014).

Goldenberg, M., Danovitch, I. & IsHak, W. W. Quality of life and smoking. Am. J. Addict. 23 , 540–562 (2014).

Heikkinen, H., Jallinoja, P., Saarni, S. I. & Patja, K. The impact of smoking on health-related and overall quality of life: a general population survey in Finland. Nicotine Tob. Res. 10 , 1199–1207 (2008).

Moayeri, F., Hsueh, Y. A., Dunt, D. & Clarke, P. Smoking cessation and quality of life: insights from analysis of longitudinal Australian data, an application for economic evaluations. Value Health 24 , 724–732 (2021).

Taylor, G. M. et al. Smoking cessation for improving mental health. Cochrane Database Syst. Rev. 3 , CD013522 (2021).

López-Nicolás, Á., Trapero-Bertran, M. & Muñoz, C. Smoking, health-related quality of life and economic evaluation. Eur. J. Health Econ. 19 , 747–756 (2018).

Morris, A. Linking nicotine addiction and T2DM. Nat. Rev. Endocrinol. 16 , 6 (2020).

Willi, C., Bodenmann, P., Ghali, W. A., Faris, P. D. & Cornuz, J. Active smoking and the risk of type 2 diabetes: a systematic review and meta-analysis. Jama 298 , 2654–2664 (2007).

World Health Organization. WHO report on the global tobacco epidemic (WHO, 2019).

Donny, E. C. et al. Randomized trial of reduced-nicotine standards for cigarettes. N. Engl. J. Med. 373 , 1340–1349 (2015). This study tested the impact of reducing the quantity of nicotine present in cigarettes on smoking .

Benowitz, N. L. & Henningfield, J. E. Establishing a nicotine threshold for addiction. The implications for tobacco regulation. N. Engl. J. Med. 331 , 123–125 (1994).

Benowitz, N. L. & Henningfield, J. E. Reducing the nicotine content to make cigarettes less addictive. Tob. Control. 22 , i14–i17 (2013).

Gottlieb, S. & Zeller, M. A nicotine-focused framework for public health. N. Engl. J. Med. 377 , 1111–1114 (2017).

Hall, W. & West, R. Thinking about the unthinkable: a de facto prohibition on smoked tobacco products. Addiction 103 , 873–874 (2008).

Ioannidis, J. P. A. & Jha, P. Does the COVID-19 pandemic provide an opportunity to eliminate the tobacco industry? Lancet Glob. Health 9 , e12–e13 (2021).

Smokefree. Smokefree 2025. Smokefree https://www.smokefree.org.nz/smokefree-in-action/smokefree-aotearoa-2025 (2021).

Morgan, C. J., Das, R. K., Joye, A., Curran, H. V. & Kamboj, S. K. Cannabidiol reduces cigarette consumption in tobacco smokers: preliminary findings. Addict. Behav. 38 , 2433–2436 (2013).

Elsaid, S., Kloiber, S. & Le Foll, B. Effects of cannabidiol (CBD) in neuropsychiatric disorders: a review of pre-clinical and clinical findings. Prog. Mol. Biol. Transl. Sci. 167 , 25–75 (2019).

Butler, K. & Le Foll, B. Novel therapeutic and drug development strategies for tobacco use disorder: endocannabinoid modulation. Expert Opin. Drug Discov. 15 , 1065–1080 (2020).

D’Souza, D. C. et al. Efficacy and safety of a fatty acid amide hydrolase inhibitor (PF-04457845) in the treatment of cannabis withdrawal and dependence in men: a double-blind, placebo-controlled, parallel group, phase 2a single-site randomised controlled trial. Lancet Psychiatry 6 , 35–45 (2019).

Robinson, J. D. et al. Pooled analysis of three randomized, double-blind, placebo controlled trials with rimonabant for smoking cessation. Addict. Biol. 23 , 291–303 (2018).

Gueye, A. B. et al. The CB1 neutral antagonist AM4113 retains the therapeutic efficacy of the inverse agonist rimonabant for nicotine dependence and weight loss with better psychiatric tolerability. Int. J. Neuropsychopharmacol. https://doi.org/10.1093/ijnp/pyw068 (2016).

Yammine, L. et al. Exenatide adjunct to nicotine patch facilitates smoking cessation and may reduce post-cessation weight gain: a pilot randomized controlled trial. Nicotine Tob. Res. 23 , 1682–1690 (2021).

Eren-Yazicioglu, C. Y., Yigit, A., Dogruoz, R. E. & Yapici-Eser, H. Can GLP-1 be a target for reward system related disorders? A qualitative synthesis and systematic review analysis of studies on palatable food, drugs of abuse, and alcohol. Front. Behav. Neurosci. 14 , 614884 (2020).

Vanderkam, P. et al. Effectiveness of drugs acting on adrenergic receptors in the treatment for tobacco or alcohol use disorders: systematic review and meta-analysis. Addiction 116 , 1011–1020 (2021).

Sokoloff, P. & Le Foll, B. The dopamine D3 receptor, a quarter century later. Eur. J. Neurosci. 45 , 2–19 (2017).

David, S. P., Lancaster, T., Stead, L. F., Evins, A. E. & Prochaska, J. J. Opioid antagonists for smoking cessation. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.CD003086.pub3 (2013).

Ray, L. A. et al. Efficacy of combining varenicline and naltrexone for smoking cessation and drinking reduction: a randomized clinical trial. Am. J. Psychiatry 178 , 818–828 (2021).

Mooney, M. E. et al. Bupropion and naltrexone for smoking cessation: a double-blind randomized placebo-controlled clinical trial. Clin. Pharmacol. Ther. 100 , 344–352 (2016).

Justinova, Z., Le Foll, B., Redhi, G. H., Markou, A. & Goldberg, S. R. Differential effects of the metabotropic glutamate 2/3 receptor agonist LY379268 on nicotine versus cocaine self-administration and relapse in squirrel monkeys. Psychopharmacology 233 , 1791–1800 (2016).

Le Foll, B., Wertheim, C. E. & Goldberg, S. R. Effects of baclofen on conditioned rewarding and discriminative stimulus effects of nicotine in rats. Neurosci. Lett. 443 , 236–240 (2008).

Franklin, T. R. et al. The GABA B agonist baclofen reduces cigarette consumption in a preliminary double-blind placebo-controlled smoking reduction study. Drug Alcohol. Depend. 103 , 30–36 (2009).

Lotfy, N., Elsawah, H. & Hassan, M. Topiramate for smoking cessation: systematic review and meta-analysis. Tob. Prev. Cessat. 6 , 14 (2020).

Shanahan, W. R., Rose, J. E., Glicklich, A., Stubbe, S. & Sanchez-Kam, M. Lorcaserin for smoking cessation and associated weight gain: a randomized 12-week clinical trial. Nicotine Tob. Res. 19 , 944–951 (2017).

Higgins, G. A., Fletcher, P. J. & Shanahan, W. R. Lorcaserin: a review of its preclinical and clinical pharmacology and therapeutic potential. Pharmacol. Ther. 205 , 107417 (2020).

Stead, L. F. & Lancaster, T. Interventions to reduce harm from continued tobacco use. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.CD005231.pub2 (2007).

Download references

Acknowledgements

B.Le F. is supported by a clinician-scientist award from the Department of Family and Community Medicine at the University of Toronto and the Addiction Psychiatry Chair from the University of Toronto. The funding bodies had no role in the study design, collection, analysis or interpretation of the data, writing the manuscript, or the decision to submit the paper for publication. The authors thank H. Fu (University of Toronto) for assistance with Figs 1–3.

Author information

Authors and affiliations.

Translational Addiction Research Laboratory, Campbell Family Mental Health Research Institute, Centre for Addiction and Mental Health, University of Toronto, Toronto, Ontario, Canada

Bernard Le Foll

Departments of Family and Community Medicine, Psychiatry, Pharmacology and Toxicology, University of Toronto, Toronto, Ontario, Canada

Department of Medicine, University of Wisconsin, Madison, WI, USA

Megan E. Piper

University of Wisconsin Center for Tobacco Research and Intervention, Madison, WI, USA

Department of Neurobiology and Behaviour, University of California Irvine, Irvine, CA, USA

Christie D. Fowler

Section for Preventive Cardiology, Department of Endocrinology, Morbid Obesity and Preventive Medicine, Oslo University Hospital, Oslo, Norway

Serena Tonstad

Department of Psychiatry, Washington University School of Medicine, St. Louis, MO, USA

Laura Bierut

Institute of Mental Health, Peking University Sixth Hospital, Peking University, Beijing, China

National Institute on Drug Dependence, Peking University Health Science Center, Beijing, China

Centre for Global Health Research, Unity Health Toronto, University of Toronto, Toronto, Ontario, Canada

• Prabhat Jha

National Centre for Youth Substance Use Research, The University of Queensland, St Lucia, Queensland, Australia

Wayne D. Hall

Queensland Alliance for Environmental Health Sciences, The University of Queensland, Woolloongabba, Queensland, Australia

You can also search for this author in PubMed   Google Scholar

Contributions

Introduction (B.Le F.); Epidemiology (P.J. and W.D.H.); Mechanisms/pathophysiology (C.D.F., L.B., L.L. and B.Le F.); Diagnosis, screening and prevention (P.J., M.E.P., S.T. and B.Le F.); Management (M.E.P., S.T., W.D.H., L.L. and B.Le F.); Quality of life (P.J. and W.D.H.); Outlook (all); Conclusions (all). All authors contributed substantially to the review and editing of the manuscript.

Corresponding author

Correspondence to Bernard Le Foll .

Ethics declarations

Competing interests.

B.Le F. has obtained funding from Pfizer (GRAND Awards, including salary support) for investigator-initiated projects. B.Le F. has received some in-kind donations of cannabis product from Aurora and medication donation from Pfizer and Bioprojet and was provided a coil for TMS study from Brainsway. B.Le F. has obtained industry funding from Canopy (through research grants handled by CAMH or the University of Toronto), Bioprojet, ACS, Indivior and Alkermes. B.Le F. has received in-kind donations of nabiximols from GW Pharma for past studies funded by CIHR and NIH. B.Le F. has been an advisor to Shinoghi. S.T. has received honoraria from Pfizer the manufacturer of varenicline for lectures and advice. All other authors declare no competing interests.

Peer review

Peer reviewer information.

Nature Reviews Disease Primers thanks Jamie Brown, Elisardo Iglesias and Ming Li for their contribution to the peer review of this work.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Related links

CTRI website: https://d3futrf33lk36a.cloudfront.net/wp-content/uploads/sites/240/2019/04/Meds-Chart.pdf

Philip Morris International: https://www.pmi.com/

Rights and permissions

Reprints and permissions

About this article

Cite this article.

Le Foll, B., Piper, M.E., Fowler, C.D. et al. Tobacco and nicotine use. Nat Rev Dis Primers 8 , 19 (2022). https://doi.org/10.1038/s41572-022-00346-w

Download citation

Accepted : 07 February 2022

Published : 24 March 2022

DOI : https://doi.org/10.1038/s41572-022-00346-w

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

This article is cited by

Integrated mrna- and mirna-sequencing analyses unveil the underlying mechanism of tobacco pollutant-induced developmental toxicity in zebrafish embryos.

• Jiasheng Chen
• Xiaoping Zhong

Journal of Translational Medicine (2024)

Influence of substance use on male reproductive health and offspring outcomes

• Jamie O. Lo
• Jason C. Hedges
• Charles A. Easley

Nature Reviews Urology (2024)

Reductions in smoking due to ratification of the Framework Convention for Tobacco Control in 171 countries

• Guillermo Paraje
• Mauricio Flores Muñoz

Nature Medicine (2024)

Impact of benzoic acid and 2,2’-methylenebis (6-tert-butyl-4-methylphenol) on the metabolome of flue-cured tobacco and rhizosphere microbial communities: implications for continuous cropping obstacles

• Qiulian Peng
• Jiayan Zhang

Plant and Soil (2024)

Nicotinic regulation of microglia: potential contributions to addiction

• Alexa R. Soares
• Marina R. Picciotto

Journal of Neural Transmission (2024)

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Animals self-medicate with plants − behavior people have observed and emulated for millennia

Research Scholar, Classics and History and Philosophy of Science, Stanford University

Disclosure statement

Adrienne Mayor does not work for, consult, own shares in or receive funding from any company or organisation that would benefit from this article, and has disclosed no relevant affiliations beyond their academic appointment.

View all partners

When a wild orangutan in Sumatra recently suffered a facial wound, apparently after fighting with another male, he did something that caught the attention of the scientists observing him.

The animal chewed the leaves of a liana vine – a plant not normally eaten by apes. Over several days, the orangutan carefully applied the juice to its wound, then covered it with a paste of chewed-up liana. The wound healed with only a faint scar. The tropical plant he selected has antibacterial and antioxidant properties and is known to alleviate pain, fever, bleeding and inflammation.

The striking story was picked up by media worldwide. In interviews and in their research paper , the scientists stated that this is “the first systematically documented case of active wound treatment by a wild animal” with a biologically active plant. The discovery will “provide new insights into the origins of human wound care.”

To me, the behavior of the orangutan sounded familiar. As a historian of ancient science who investigates what Greeks and Romans knew about plants and animals, I was reminded of similar cases reported by Aristotle, Pliny the Elder, Aelian and other naturalists from antiquity. A remarkable body of accounts from ancient to medieval times describes self-medication by many different animals. The animals used plants to treat illness, repel parasites, neutralize poisons and heal wounds.

The term zoopharmacognosy – “animal medicine knowledge” – was invented in 1987. But as the Roman natural historian Pliny pointed out 2,000 years ago, many animals have made medical discoveries useful for humans. Indeed, a large number of medicinal plants used in modern drugs were first discovered by Indigenous peoples and past cultures who observed animals employing plants and emulated them.

What you can learn by watching animals

Some of the earliest written examples of animal self-medication appear in Aristotle’s “ History of Animals ” from the fourth century BCE, such as the well-known habit of dogs to eat grass when ill, probably for purging and deworming.

Aristotle also noted that after hibernation, bears seek wild garlic as their first food. It is rich in vitamin C, iron and magnesium, healthful nutrients after a long winter’s nap. The Latin name reflects this folk belief: Allium ursinum translates to “bear lily,” and the common name in many other languages refers to bears.

Pliny explained how the use of dittany , also known as wild oregano, to treat arrow wounds arose from watching wounded stags grazing on the herb. Aristotle and Dioscorides credited wild goats with the discovery. Vergil, Cicero, Plutarch, Solinus, Celsus and Galen claimed that dittany has the ability to expel an arrowhead and close the wound. Among dittany’s many known phytochemical properties are antiseptic, anti-inflammatory and coagulating effects.

According to Pliny, deer also knew an antidote for toxic plants: wild artichokes . The leaves relieve nausea and stomach cramps and protect the liver. To cure themselves of spider bites, Pliny wrote, deer ate crabs washed up on the beach, and sick goats did the same. Notably, crab shells contain chitosan , which boosts the immune system.

When elephants accidentally swallowed chameleons hidden on green foliage, they ate olive leaves, a natural antibiotic to combat salmonella harbored by lizards . Pliny said ravens eat chameleons, but then ingest bay leaves to counter the lizards’ toxicity. Antibacterial bay leaves relieve diarrhea and gastrointestinal distress. Pliny noted that blackbirds, partridges, jays and pigeons also eat bay leaves for digestive problems.

Weasels were said to roll in the evergreen plant rue to counter wounds and snakebites. Fresh rue is toxic. Its medical value is unclear, but the dried plant is included in many traditional folk medicines. Swallows collect another toxic plant, celandine , to make a poultice for their chicks’ eyes. Snakes emerging from hibernation rub their eyes on fennel. Fennel bulbs contain compounds that promote tissue repair and immunity.

According to the naturalist Aelian , who lived in the third century BCE, the Egyptians traced much of their medical knowledge to the wisdom of animals. Aelian described elephants treating spear wounds with olive flowers and oil . He also mentioned storks, partridges and turtledoves crushing oregano leaves and applying the paste to wounds.

The study of animals’ remedies continued in the Middle Ages. An example from the 12th-century English compendium of animal lore, the Aberdeen Bestiary , tells of bears coating sores with mullein . Folk medicine prescribes this flowering plant to soothe pain and heal burns and wounds, thanks to its anti-inflammatory chemicals.

Ibn al-Durayhim’s 14th-century manuscript “ The Usefulness of Animals ” reported that swallows healed nestlings’ eyes with turmeric , another anti-inflammatory. He also noted that wild goats chew and apply sphagnum moss to wounds, just as the Sumatran orangutan did with liana. Sphagnum moss dressings neutralize bacteria and combat infection.

Nature’s pharmacopoeia

Of course, these premodern observations were folk knowledge, not formal science. But the stories reveal long-term observation and imitation of diverse animal species self-doctoring with bioactive plants. Just as traditional Indigenous ethnobotany is leading to lifesaving drugs today , scientific testing of the ancient and medieval claims could lead to discoveries of new therapeutic plants.

Animal self-medication has become a rapidly growing scientific discipline. Observers report observations of animals, from birds and rats to porcupines and chimpanzees , deliberately employing an impressive repertoire of medicinal substances. One surprising observation is that finches and sparrows collect cigarette butts . The nicotine kills mites in bird nests. Some veterinarians even allow ailing dogs, horses and other domestic animals to choose their own prescriptions by sniffing various botanical compounds.

Mysteries remain . No one knows how animals sense which plants cure sickness, heal wounds, repel parasites or otherwise promote health. Are they intentionally responding to particular health crises? And how is their knowledge transmitted? What we do know is that we humans have been learning healing secrets by watching animals self-medicate for millennia.

• Zoopharmacognosy
• Animal behavior
• Self-medication
• Phytochemicals
• Ancient world

Head of School, School of Arts & Social Sciences, Monash University Malaysia

Chief Operating Officer (COO)

Clinical Teaching Fellow

Data Manager

Director, Social Policy

• Search Menu
• Sign in through your institution
• Advance articles
• Collections
• Author Guidelines
• Submission Site
• Open Access Options
• About ISME Communications
• About the International Society for Microbial Ecology
• Editorial Board
• Self-Archiving Policy
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

Introduction, materials and methods, acknowledgements, conflicts of interest, data availability.

• < Previous

Widespread horizontal gene transfer between plants and bacteria

• Article contents
• Figures & tables
• Supplementary Data

Shelly Haimlich, Yulia Fridman, Hitaishi Khandal, Sigal Savaldi-Goldstein, Asaf Levy, Widespread horizontal gene transfer between plants and bacteria, ISME Communications , Volume 4, Issue 1, January 2024, ycae073, https://doi.org/10.1093/ismeco/ycae073

• Permissions Icon Permissions

Plants host a large array of commensal bacteria that interact with the host. The growth of both bacteria and plants is often dependent on nutrients derived from the cognate partners, and the bacteria fine-tune host immunity against pathogens. This ancient interaction is common in all studied land plants and is critical for proper plant health and development. We hypothesized that the spatial vicinity and the long-term relationships between plants and their microbiota may promote cross-kingdom horizontal gene transfer (HGT), a phenomenon that is relatively rare in nature. To test this hypothesis, we analyzed the Arabidopsis thaliana genome and its extensively sequenced microbiome to detect events of horizontal transfer of full-length genes that transferred between plants and bacteria. Interestingly, we detected 75 unique genes that were horizontally transferred between plants and bacteria. Plants and bacteria exchange in both directions genes that are enriched in carbohydrate metabolism functions, and bacteria transferred to plants genes that are enriched in auxin biosynthesis genes. Next, we provided a proof of concept for the functional similarity between a horizontally transferred bacterial gene and its Arabidopsis homologue in planta . The Arabidopsis DET2 gene is essential for biosynthesis of the brassinosteroid phytohormones, and loss of function of the gene leads to dwarfism. We found that expression of the DET2 homologue from Leifsonia bacteria of the Actinobacteria phylum in the Arabidopsis det2 background complements the mutant and leads to normal plant growth. Together, these data suggest that cross-kingdom HGT events shape the metabolic capabilities and interactions between plants and bacteria.

Plants form intimate associations with microbes, collectively called the plant microbiota. Microbes mostly have commensal lifestyles with the plant. However, the microbial molecular mechanisms used to interface with the host molecular network are mostly elusive. Successful isolation and subsequent genome sequencing of hundreds of bacterial strains that are associated with diverse plant species and tissues enabled the elucidation of some of the microbial genes that are responsible for plant adaptation [ 1–6 ]. Transcriptome and proteome studies detected which bacterial genes are active in planta [ 7–9 ]. As part of the interaction between plants and their microbiota different molecules are being exchanged, including simple carbohydrates, organic acids, signaling molecules, antimicrobials, and bacterial effector proteins that change plant physiology [ 10–17 ].

One mechanism that may establish a stable interface between plants and their microbiota is cross-kingdom horizontal gene transfer (HGT) from the host to the microbe or vice versa. HGT provides the acceptor with the donor’s biological functions, such as new metabolic capacity and quick adaptation to the shared environment. The close proximity between the organisms, the selective pressure caused by immense microbial competition in the rhizosphere and by microbial interaction with the plant immunity, and the inherent ability of microbes to integrate foreign DNA may drive DNA transfer from plants into their microbiome [ 18 ]. Several plant-microbe HGT events were described. The pathogen Pseudomonas syringae acquired a eukaryotic E3 ubiquitin ligase domain as part of an effector protein AvrPtoB that degrades a host kinase, leading to host disease susceptibility [ 19 ]. The commensal Bacillus subtilis encodes a remote homologue of plant expansin proteins that was acquired through HGT. The bacterial expansin promotes plant cell wall extension and is critical for root colonization [ 20–22 ]. Gene transfer events from bacteria into plant germ cells have an unclear mechanism. However, such events were reported in the past and were described as mostly ancient HGT events from bacteria into the ancestors of land plants [ 23–26 ]. Several fern species contain an insecticidal chitin-binding protein that confers resistance to whitefly. It was suggested that the plant gene was acquired from bacteria as it has no close homolog in any other land plants, and the fern branch in the gene tree is nested within the bacterial branch [ 27 , 28 ]. Agrobacterium spp. was shown to transfer tumor-inducing genes (T-DNAs) into the germline of different plant species including Nicotiana , Linaria , and Ipomoea [ 29 ]. A recent study estimated that bacteria were the most common gene donors to plants (much more than fungi and viruses), and identified two major episodes of HGT events corresponding to the early evolution of streptophytes and the origin of land plants [ 30 ].

We hypothesized that the genomes of plants and their root and shoot microbiome could uncover the extent and nature of cross-kingdom HGT events between plants and bacteria. In the current study, we performed a systematic search for potential cross-kingdom HGT events between the model plant A. thaliana and its extensively isolated and sequenced microbiome and bacteria which were isolated from different environments. Using phylogenetic analysis of proteins from 1766 organisms including plants, bacteria, archaea, animals, fungi, algae, SAR, and others, we could detect 75 HGT events between plants and bacteria. However, we could not detect a clear preference for HGT between plants and plant-associated (PA) bacteria. We could also detect 111 genes that were transferred between bacteria and eukaryotes (not exclusively to plants). In addition, we found that genes transferred from plants to bacteria are enriched in carbohydrate metabolism functions, such as cell wall degradation. In comparison, genes transferred from bacteria to plants are enriched in similar functions and also in auxin biosynthesis and response to hormones. Finally, we showed that a hormone biosynthesis gene transferred from plants to bacteria maintains its function in planta despite its divergence from the plant homologue through mutations. Our data suggest that cross-kingdom HGT events are frequent for plants and bacteria and likely facilitated efficient carbohydrate metabolism.

Data sources and genome screening

Full genomic sequence of A. thaliana was downloaded from TAIR website ( https://www.arabidopsis.org/ ). Additionally, a collection of 582 microbiota was prepared. These bacteria from the roots and shoots of A. thaliana were extensively isolated by different groups, and their genomes were previously sequenced. A list of 581 NPA bacteria was prepared following the PA bacteria list so that each class has a similar number of PA and NPA bacteria. The group of PA bacteria including 139 Actinobacteria, 271 Alphaproteobacteria, 49 Bacilli, 55 Betaproteobacteria, 1 Unknown, 1 Cytophagia, 13 Flavobacteria, 49 Gammaproteobacteria and 4 Sphingobacteria. When the group of NPA bacteria including 178 Actinobacteria, 188 Alphaproteobacteria, 57 Bacilli, 64 Betaproteobacteria, 3 Cytophagia, 18 Flavobacteria, 68 Gammaproteobacteria, and 5 Sphingobacteria.

Using BLASTP [ 65 ] version 2.8.1+ (standard settings), a comparison was made between the 582 PA bacteria and 581 NPA bacteria to Arabidopsis proteins. The hits were filtered of at least 35% amino acid sequence identity across > 80% protein length of the plant and the bacterial proteins. Protein sequences shared by bacteria and plant organelles, which themselves originate from bacteria, were filtered out. We filtered nuclear-encoded genes with association to plasticity and mitochondria in addition to plastid and mitochondria-encoded genes. Information on plant organelles origin is taken from ATH_GO_GOSLIM.txt file on the TAIR website ( https://www.arabidopsis.org/download/GO and PO Annotations/Gene Ontology Annotations/ATH_GO_GOSLIM.txt. gz), In the “relationship type” column, we filtered out all the genes that are “located in” mitochondrion/chloroplast/etioplast/amyloplast/proplastid/chromoplast. At the end of this analysis, we identified 870 Arabidopsis proteins that were mapped to 110 315 bacterial proteins ( Supplementary Table 2 ).

Initial phylogenetic comparative methods to find HGT

A dataset that contains fully sequenced diverse organisms was created. The dataset contained 1191 genomes, including 1163 bacteria (582 PA bacteria, 581 NPA bacteria), 10 monocot and dicot plants, 8 fungi, 2 archaea, and 8 additional eukaryotes ( Supplementary Table 1 ). Automatically, multiple sequence alignment was performed using Clustal Omega [ 66 ] version 1.2.4 using standard settings, and each of the 870 phylogenetic trees was constructed using FastTree [ 38 ] version 2.1.11 SSE3 using standard settings ( Supplementary Data 1 ). Display, annotation, and management of phylogenetic trees were performed with Interactive Tree Of Life [ 67 ] (ITOL version 6.5).

Each of the phylogenetic trees was examined manually, and all the trees were divided into eight categories according to the inheritance pattern observed in the tree: (1) HGT from bacteria to plants, (2) HGT from plants to bacteria, (3) HGT from bacteria to eukaryotes, (4) HGT from eukaryotes to bacteria, (5) unclear phylogenetic, and (6) no HGT detection ( Supplementary Table 3 ).

Thorough phylogenetic comparative methods to find HGT

The genes from the aforementioned first four groups were examined in a stringent phylogenetic approach. Each group underwent comprehensive phylogenetic analysis, with the exception of the “HGT from bacteria to eukaryotes” group, for which a subset of 29 genes was randomly chosen for examination. Consequently, a total of 313 genes were tested again. For a comprehensive analysis of the phylogenetic trees, an additional 575 organisms were downloaded from the NCBI website with an “Assembly Level” of Complete Genome/Chromosome/Scaffold. The additional 575 organisms included 133 genomes of Amorphea (including animals, fungi, amoeba), 247 Archaea, 137 vascular plants, 18 Algae (green and red), 36 SAR (stramenopiles, alveolates, and rhizarians) clade genomes, 2 Bryophyta, and 2 Cryptista ( Supplementary Fig. 4 ). Overall, genes from 1766 organisms were used in the analysis.

Multiple sequence alignment was performed using Clustal Omega [ 66 ] version 1.2.4 using standard settings, and each of the 313 phylogenetic trees was constructed using IQ-TREE [ 39 ] version 2.1.2 using customized settings (-mset LG,WAG,JTT,JTTDCMut -T AUTO -B 2000). The trees were rooted using MAD [ 40 ] ( Supplementary Data 1 ). Display, annotation, and management of phylogenetic trees were performed with ITOL version 6.5 [ 67 ].

Each phylogenetic tree underwent a thorough manual examination to scrutinize evidence of HGT. When the tree included mostly bacterial genes and a bacterial branch shared a common ancestor with the plant branch, such trees were categorized as HGT from bacteria to plants. Conversely, in instances where the tree was predominantly eukaryotic and the plant branch shared a common ancestor with the bacterial branch, these trees were classified as HGT from plants to bacteria. Similar evaluations were conducted for transitions between bacteria and eukaryotes. We also inspected the ultrafast bootstrap approximation values (uf-bootstrap) to assess branch reliability. Trees wherein the branch shared by bacteria and plants/eukaryotes exhibited a uf-bootstrap value lower than 80 were denoted as having either a “Low bootstrap value” or “No bootstrap value,” as detailed in Supplementary Table 5 .

Gene ontology enrichment analysis

Functional information about the gene was performed using R packages clusterProfiler [ 68 ] on the Arabidopsis genes in four different groups: HGT from bacteria to plants, HGT from plants to bacteria, HGT from bacteria to eukaryotes, and HGT from eukaryotes to bacteria.

Genomic neighborhood, structure, and function prediction and structure comparison

A pattern of genes present/absent was created by using the IMG website [ 69 ], using the option “Show neighborhood regions with the same top COG hit (via top homolog).” The structure prediction of the Arabidopsis proteins was downloaded from UniProt website ( https://www.uniprot.org/ ), and the prediction structure of the bacterial protein was created using AlphaFold2 [ 70 , 71 ] The structures comparison was created using PyMOL version 2.4.1 ( https://pymol.org/2/ ). Structural similarity searches were done using the AlphaFold2 model of Arabidopsis proteins in UniProt and proteins were compared using Foldseek all protein databases [ 72 ].

Graphs and figures

Various R packages are used to create graphs: ggplot2 [ 73 ], reshape2 [ 74 ], dplyr ( https://dplyr.tidyverse.org ), tidyverse ( https://www.tidyverse.org/ ), and RColorBrewer ( https://cran.r-project.org/web/packages/RColorBrewer/index.html ).

BioRender ( https://biorender.com /) was used to create Figs 1 and 3 .

Analysis pipeline to detect cross-kingdom HGT events between bacteria and plants or eukaryotes in general. (A) An outline of the bioinformatic analysis we performed to detect cross-kingdom HGT events between plants and bacteria. Following comparison between proteins of 1163 bacteria and Arabidopsis we performed two rounds of phylogenetic analysis to detect HGT. The first analysis was performed with proteins from 27 additional control organisms, and yielded 246 putative HGT events between bacteria and plants. We improved this analysis by using a more stringent tree construction method with proteins from 575 additional organisms. Overall, genes from 1766 organisms were used in the analysis. (B) Classification of cross-kingdom HGT events into four different classes based on their predicted HGT directionality. Circles indicate the number of trees found from each category. PA bacteria, plant-associated bacteria; NPA bacteria, NPA bacteria.

Growth conditions, molecular cloning and transformation

For overexpression of lfDET2 , the bacterial gene sequence underwent codon optimization for A. thaliana . The constructs were generated using the Golden Gate MoClo Plant Tool Kit [ 75 ]. For the DET2 promoter ( pDET2 ), 550-bp fragment upstream to the first DET2 ATG was used. pDET2 and p35S in level 0 (in pICH41295) were then subcloned along with additional level 0 parts: lfDET2 (in pAGM1287), mNeonGreen (NG, in pAGM1301), and the RBCS terminator (in pICH41276) into level 1 (pICH47742). For overexpression of the Arabidopsis DET2 ( atDET2 ), a similar cloning procedure was used except that the DET2 terminator was used. The constructed level 1 was then subcloned into a level 2 construct (pAGM4723), together with a level 1 kanamycin resistance gene (pICH47732). Plant transformation to wild-type (WT) Col-0 and det2 backgrounds was performed using the Agrobacterium tumefaciens (GV3101)-mediated floral dip transformation method. Transgenic lines were screened on selective 0.5 MS plates supplied with 50 mg/l kanamycin (Duchefa Biochemie). Homozygous lines were selected according to mendelian segregation of the selection marker. For each construct used, two to three independent transgenic lines were generated. Presented here are line 6 ( det2;pDET2:lfDET2 ), line 3 ( det2;p35S:lfDET2 ), and line 4 ( pDET2:atDET2 ) . Plant growth conditions were as described by Fridman et al. [ 76 ]. Briefly, seeds were surface sterilized and germinated on one-half-strength (0.5) Murashige and Skoog (MS) medium supplemented with 0.8% plant agar, 0.46 g/l MES pH 5.8, 0.2% (w/v) sucrose. Plates with sterilized seeds were stratified at 4°C for 2 days in the dark before transfer to the growth chamber with 16-h light/8-h dark cycles, at 22°C. Irradiance conditions of ∼70 μmol m −2  s −1 .

Confocal microscopy

Confocal microscopy was performed using a Zeiss LSM 510 (Zeiss, Jena, Germany) confocal laser scanning microscope with a LD LCI Plan-Apochromat 25x water immersion objective (NA-0.8), or LSM 710 (Zeiss, Jena, Germany) using a Plan-Apochromat 20x objective (NA-0.8). Roots were imaged in water, or with water supplemented with propidium iodide (PI, 10 μg/mL). The green fluorescent proteins NeonGreen (NG) and PI were excited by an argon laser (488 nm) and by DPSS laser (561 nm), respectively. For PI detection in LSM 710, solid state laser (543 nm) was used. In LSM 510, fluorescence emission signals for NG and for PI were collected by PMT detectors, with a band-pass filter (500–530 nm) and a long-pass filter (575 nm), respectively. In LSM 710, fluorescence emission signals for NG and for PI were collected by BIG detectors (GaAsP) with a band-pass filter (500–550 nm) and a band-pass filter (570–620 nm), respectively.

lfDET2 sequence after codon optimization

ATGCCCGACGGTCCGTATCGCTGGTTCGTGTATGCCGAGATCGCCCTCGCGGTGGTCACCTTCGTCGCTCTGTGCTTCGTGGTAGCGCCGTACGGACGGCACGGCCGCTCCGGATGGGGGCCGACCGTGCCCGCGCGGGTCGGCTGGGTCGTGATGGAGAGTCCAGCATCCATCGTCTTCCTGCTGTTCTACCTGCTCGGCGACCACCGGTTCGAGCTGGTGCCTCTGCTGTTCCTCGCGCTGTGGCAGCTCCACTACGTGCAGCGTGCCTTCGTCTACCCGTTCCTGATGCGCACCGGGTCCAGGATGCCCGTGTCCGTCGTGGGGATGGCGATCCTGTTCAACCTGCTCAACGCGTGGGTGAATGCGCGGTGGATCTCGCAGTACGGCCAGTACGCGAACAGCTGGCTCGCCGACCCTCGGTTCTGGATCGGCGTGGTCGTGTTCATCGCCGGGTTCTCGCTCAACCTCGGTTCCGACCGCATCCTGCGCAGACTGCGGGGTGCGCGATCCGGCGGGTACAGCATCCCGCGCGGTGGCGGATACCGCTGGGTGTCCAGCCCGAACTACCTGGGCGAGATGGTGGAGTGGACCGGCTGGGCGATCGCGACCTGGTCGCTCGCCGGGCTGGCGTTCGCGCTGTACACGATCGCGAACCTCGCACCGCGGGCGATGGCGAACCACCGCTGGTACCTGGAGACGTTCGACGACTATCCGCCGGAGCGAAAAGCGATCATCCCCTATCTGCTCTGA.

Identification of genes that share high amino acid sequence similarity between A. thaliana and its microbiome

To quantify the extent of HGT events between plants and microbiome we focused on the plant A. thaliana that serves as a model for plant-microbe interactions [ 31 , 32 ]. The microbiota of Arabidopsis have been extensively isolated from roots and shoots by different groups and their genomes were previously sequenced [ 1 , 2 , 4 ]. We compared the genes of A. thaliana against the genes of 582 fully sequenced PA bacteria that were isolated from A. thaliana ( Supplementary Table 1 ). Our current analysis includes commensal Arabidopsis-associated bacteria which were isolated from roots and shoots of healthy plants in the US, Germany, and Switzerland. As a control group, we used 581 non-plant associated (NPA) bacteria, which were isolated from diverse non-plant environments such as animals and aquatic environments ( Supplementary Table 1 ). The NPA bacteria group does not contain bacteria that were isolated from soil which may also colonize plants. To serve as a control group, a list of 581 NPA bacteria was prepared following the PA bacteria list so that each class has a similar number of PA and NPA bacteria. PA and NPA bacteria belong to Actinobacteria, Proteobacteria, Firmicutes, and Bacteroidetes phyla, and their classification to PA and NPA is based on their original isolation site, which we previously manually curated [ 2 ]. We used the BLASTp program to detect identity between the set of 48 149 proteins encoded by Arabidopsis, 2 909 309 proteins from PA bacteria, and 2 489 944 proteins from NPA bacteria ( Fig. 1a ). We focused on identity between full-length protein sequences, as these proteins are relatively poorly studied in comparison to horizontally transferred protein domains, which are extensively studied in the context of effectors of pathogenic bacteria [ 33 , 34 ]. These sequences were later subjected to an extensive phylogenetic analysis to suggest the existence of HGT based on inconsistency within gene trees (see below). According to some definitions two protein sequences are considered homologous if they are > 30–35% identical over their entire lengths [ 35 , 36 ]. Therefore, we used only BLASTP hits of at least 35% amino acid sequence identity across at least 80% of the coverage of both the Arabidopsis and the bacterial proteins.

Next, we filtered out what we termed “trivial hit,s” which are protein sequences shared by bacteria and plant organelles, i.e. mitochondria and chloroplast, which themselves originate in bacteria [ 37 ], and their proteome may maintain homology to their original bacterial proteome. This analysis resulted in a list of 870 Arabidopsis proteins that are mapped to 110 315 bacterial proteins and likely play similar functions ( Fig. 1A , Supplementary Table 2 ). One concern is that protein sequence similarity-based search will result in detection of Arabidopsis or bacterial DNA contaminants that were mistakenly assembled in bacterial or Arabidopsis genomes, respectively. However, we did not identify bacterial-Arabidopsis homologous protein pairs with amino acid identity above 76%, rejecting the possibility of hypothetical DNA contamination that was introduced during the genome assembly process, which would result in highly similar protein sequences.

Phylogenetic analysis leads to detection of 75 genes that demonstrate cross-kingdom horizontal transfer between plants and bacteria

The proteins we identified as sharing high sequence identity between plants and bacteria can be the result of various evolutionary scenarios. For example, the genes can be ancient and conserved between eukaryotes and prokaryotes. We specifically searched for phylogenetic evidence supportive of direct gene transfer between plants and bacteria, with a focus on the plant microbiota. To this end we compiled a dataset that contained 1191 genomes ( Supplementary Table 1 ), including the aforementioned 1163 PA and NPA bacteria, 10 monocot and dicot plants, 8 fungi, 2 archaea, and 8 additional eukaryotes (animals, parasites, and a mold).

For each of the 870 Arabidopsis genes with a high resemblance to the PA or NPA bacteria genes, we constructed a phylogenetic gene tree, using FastTree [ 38 ], based on multiple sequence alignment of all gene hits within our genome dataset ( Supplementary Data 1 ). We defined an event of cross-kingdom HGT from plants to bacteria or vice versa when a subset of organisms from both groups shared the same branch in the gene tree demonstrating an inconsistency between the genome tree and the gene tree ( Fig. 1B ). Specifically, we verified that the branch that is composed of homologues from plants and bacteria did not include homologues from animals or fungi. Similarly, we also defined HGT between plants and PA bacteria (or NPA bacteria as control) to examine whether there is an enrichment in the gene transfer between plants and their microbiota, compared to bacteria from other environments. To increase accuracy, we ignored cases where the transfer occurred between plants and only a single bacterium to reject the possibility of hypothetical DNA contamination.

We detected 246 HGT events between bacteria and plants. Nonetheless, we suspected that some of these were false positives due to inaccurate phylogenetic analysis. To provide additional support for the detection of HGT events, we used a more stringent phylogenetic approach applied to 313/870 trees from the previous stage, including all 246 events in which we detected HGT between plants and bacteria and for 67 of the cases in which we detected HGT between bacteria and eukaryotes. We added to the phylogenetic analysis 575 additional control eukaryotic and prokaryotic genomes to fill missing gaps in the evolutionary trees, used the more accurate and rigorous IQ-TREE method [ 39 ] for phylogenetic tree reconstruction, and rooted the trees using MAD [ 40 ]. The additional 575 organisms included 133 genomes of Amorphea (mostly animals, fungi, amoeba), 247 Archaea, 137 vascular plants, 18 Algae (green and red), 36 SAR (stramenopiles, alveolates, and rhizarians) clade genomes, 2 Bryophyta, and 2 Cryptista, ( Supplementary Fig. 4 ). Indeed, this stringent phylogenetic analysis led to discarding of most previous HGT calls.

We determined the direction of the HGT by examining the organisms within the tree leaves. For example, in case the tested gene was present in most of the examined bacteria and was present in only the plant group within the eukaryotic domain, nested within a bacterial branch, it is more parsimonious to assume that the gene was transferred from bacteria to plants and no massive deletion occurred in all the eukaryotes in our dataset. However, we cannot rule out more complex evolutionary scenarios. We defined the donor domain (e.g. bacteria) based on the organisms in the closest sister clades of the branch that contains plants and bacteria.

Overall, we identified 59 genes that were likely transferred from bacteria to plants ( Supplementary Table 5 , Supplementary Figs 1 – 3 ). For example, homologues of gene AT4G24350 are found in multiple bacterial branches and in one of them there is a branch, nested within a bacterial branch, and contains only genes from vascular plants ( Supplementary Fig. 1 ). Nearly all these genes are ancient and are conserved in nearly all vascular plants and at least one of the groups Bryophyta or algae ( Supplementary Table 5 ). In this group, we found five HGT events that are from PA bacteria to plants ( Table 1 ) and three HGT events that are from NPA bacteria to plants. One of the genes transferred from PA bacteria to plants is ARR17, which is responsible for sex determination in poplar trees [ 41 ] and acts as a cytokinin response regulator [ 42 ]. We also identified 16 genes that were likely transferred from plants to bacteria ( Supplementary Table 5 , Supplementary Figs 4 –6). In this group, we found two HGT events from plants to PA bacteria ( Table 1 ) and six HGT events from plants to NPA bacteria. The genes that were transferred into PA bacteria are the homologues GH9C2 and GH9C3, encoding endoglucanase glycosyl hydrolases [ 43 ]. It is clearly observed that only a small number of bacterial genomes acquired the GH9C2 gene from plants ( Supplemental Fig. 4 ). GH9C2 and GH9C3 are present in four (three Bacillaceae and one Streptomycetaceae) and five (three Bacillaceae, one Sphingomonadaceae, and one Streptomycetaceae) bacterial genomes, respectively.

Genes exchanged between PA bacteria and plants.

Overall, 75 existing Arabidopsis unique proteins were horizontally transferred to or acquired from bacteria based on our phylogenomic analysis, in addition to organelle genes, 79% of which were acquired by plants. Considering the number of gene transfers between plants and PA or NPA bacteria, these findings refute our hypothesis that plant microbiota, or at least the microbiota of A. thaliana , are more likely to donate or acquire plant genes than other control (NPA) bacteria, despite the close plant-microbiome proximity. In general, the genes transferred to or from PA bacteria are poorly studied with relatively little information about their functions. It would be interesting to study what has led to fixation of these plant genes in bacterial genomes.

In addition, we identified 50 genes that were horizontally transferred from bacteria to the eukaryotic domain ( Supplementary Table 5 , Supplementary Figs 7–9 ). For example, RNR1 (AT2G21790) is a prokaryotic gene, present in bacteria and archaea, that was transferred into a large number of eukaryotes, including many plants ( Supplementary Fig. 8 ). We found two HGT events that are from PA bacteria to eukaryotes and one HGT event that is from NPA bacteria to eukaryotes. Additionally, we identified 61 genes that were horizontally transferred from eukaryotes to bacteria ( Supplementary Table 3 , Supplementary Figs 10–12 ). For example, MIOX4 (AT4G26260) is a bacterial gene that was transferred to bacteria from Amorphea ( Supplementary Fig. 12 ). In this group, we found seven HGT events from eukaryotes to PA bacteria and three HGT events from eukaryotes to NPA bacteria.

Genes that were transferred between plants and bacteria are enriched in carbohydrate metabolism processes

We wondered if certain gene functions are more likely to undergo cross-kingdom HGT due to an adaptive function conferred to the acceptor organism. To address this question we performed a functional enrichment analysis of the genes that have been horizontally transferred (Materials and Methods).

The genes transferred from bacteria to plants are enriched in genes encoding auxin biosynthesis, nucleoside metabolism, and glycosyl compound metabolism ( Fig. 2A ). The glycosyl compound meatbolism proteins include for example 3-Deoxy-D-manno-octulosonate 8-phosphate synthase, aldolase like protein (AT4G24080), alpha-amylase-like, Sugar isomerase (SIS) family proteins (AT5G52190, AT5G42740), and glycosyl hydrolase family protein 43. Auxin biosynthesis genes that were acquired from bacteria included many of the YUCCA genes: YUC1, YUC3, YUC5, YUC6, YUC7, YUC8, YUC9, and YUC11. Previous works also suggested that these genes were acquired from bacteria, as a consequence of plant interaction with microbes [ 24 , 44 ]. Another gene acquired from bacteria is IAMH2: an Indole-3-acetamide hydrolase gene that is required for the auxin effects of Indole-3-acetamide [ 45 ].

Gene ontology (GO) enrichment analysis of the different groups that have signatures of HGT. GO enrichment analysis using R packages clusterProfiler. The 25 most significantly ( P < 0.05, after false discovery rate correction) enriched GO terms. q-values are printed on the bars. (A) GO functional analysis of Arabidopsis genes ( n = 59) with an HGT pattern from bacteria to plants. (B) GO functional analysis of Arabidopsis genes ( n = 16) with an HGT pattern from plants to bacteria. (C) GO functional analysis of Arabidopsis genes ( n = 50) with an HGT pattern from bacteria to eukaryotic domain. (D) GO functional analysis of Arabidopsis genes ( n = 61) with an HGT pattern from eukaryotic domain to bacteria.

The genes transferred from plants to bacteria are strongly enriched in carbohydrate catabolic processes ( P  = 2.14 × 10 −8 , 6 out of 16 transferred genes) ( Fig. 2B ). The transferred genes encode enzymes like pectin esterase or glycosidase activity and they likely target the plant cell wall or exploit carbohydrates from the root exudates [ 46 ]. These genes include, for example, various genes encoding chitinases (e.g. CHI, AT2G43570), glycosyl hydrolases such as an endo beta mannanase (XCD1, AT3G10890) and glycosyl hydrolase 9C2 (GH9C2, AT1G64390, see Supplemental Fig. 4 ), pectin lyases (AT1G05310, AT1G11370, AT5G07420, AT5G61680), and pectin methylesterases (AT3G29090, AT5G47500). The chitinase (CHI) gene also serves as a defense gene that is induced in plants during Systemic Acquired Resistance [ 47 , 48 ] and its transfer to bacteria may be used to manipulate plant defense response or to directly degrade chitin from fungi or insects that are present in the plant environment.

Genes transferred from bacteria to eukaryotes are enriched in functions related to inorganic transmembrane transport ( Fig. 2C ), and genes transferred from eukaryotes to bacteria are enriched in carbohydrate catabolism ( Fig. 2D ), such as the endo-beta-mannanase family.

Signatures of recent HGTs into bacterial genomes can be detected

In several cases, we identified trans-kingdom HGT events into bacteria that likely occurred relatively recently. These events were characterized by insertion into a narrow bacterial taxon. In addition, through the inspection of the genomic neighborhood of the acquired gene we observed that the gene had a patchy presence/absence pattern between members of the same genus and was located in a relatively variable genomic region compared to its flanking regions. One example is the bacterial homologue of the plant-specific CHI gene (AT2G43570), encoding a putative basic chitinase. CHI gene is a defense gene that is strongly upregulated in plants in response to butterfly oviposition [ 49 ]. The CHI gene is present mostly in Streptomyces genomes (22/25 bacterial genomes) but not in other Actinobacteria that we analyzed, suggestive of a relatively recent gene acquisition/loss event ( Fig. 3B ). Not even all Streptomyces genomes encode the CHI gene (note Streptomyces atratus OK008 in Fig. 3A ). Comparison of the predicted protein structures of the plant and bacterial CHI homologues demonstrate a striking similarity with root-mean-square-deviation (RMSD) = 0.791 ( Fig. 3C ). The N-terminus of CHI protein presented the largest difference between the two structures.

Examples of likely recent HGT from plants or other eukaryotes to bacteria. (a) Pattern of the presence/absence of the CHI homologue gene (marked with a circle) in PA Streptomyces genomes. (b) A phylogenetic tree that presents CHI protein found mainly in plants and also found in a small group of PA Streptomyces . The bootstrap value of the clade that is shared by plants and their bacteria is 0.99 (marked with an arrow). (C) Structure comparison of CHI plant protein (green) and bacterial protein (blue), RMSD = 0.791. The top part represents the N-terminus. (D) Pattern of presence/absence of the DET2 homologue gene (marked with a circle) in Leifsonia genomes. (E) A phylogenetic tree that presents DET2 proteins found mainly in the eukaryotic domain and in a small group of Actinomycetia, including Leifsonia bacteria. The bootstrap value of the clade that is shared by plants and their bacteria is 0.98 (marked with an arrow). (F) Structure comparison of DET2 plant protein (green) with bacterial protein (blue), RMSD = 0.727.

Another interesting example is of the bacterial homologue of DET2, a steroid-5-alpha-reductase which is one of the key genes in the brassinosteroid biosynthetic pathway [ 50 ]. DET2 is the only gene from the brassinosteroid biosynthetic pathway that we detected in bacteria. The plant DET2 gene is shared with other eukaryotes from the Amorphea taxonomic supergroup (animals, fungi, amoeba, choanoflagellates) and there are some bacterial orthologues of this gene ( Fig. 3E ), all of which are from the Actinomycetia class (phylum Actinobacteria). Interestingly, within the bacterial kingdom the plant DET2 is most closely related by sequence to bacterial DET2 orthologs encoded by the Leifsonia genus from Actinomycetia class. The Arabidopsis DET2 protein is 46% identical to the Leifsonia Det2 homologue. Strikingly, this level of sequence identity is shared between the Arabidopsis DET2 and its homologues from rice and barley. Importantly, the DET2 proteins from other eukaryotic plant pathogens such as the oomycetes Phytophthora and Pythium share weaker identity (maximum 41% identity) to the Arabidopsis protein than the Leifsonia -Arabidopsis DET2 similarity. Given the strong plant-bacteria protein identity, we suggest a member of the Actinomycetia class was a direct gene acceptor of a eukaryotic gene, and the donor was a member of Amorphea and not a plant. The bacterial gene is located in a patchy distribution (namely, present in only some genomes) within a variable genomic region downstream to a tRNA gene ( Fig. 3D ) that may mediate foreign DNA integration into the locus [ 51 ]. Although the plant and bacterial DET2 homologues share <50% sequence identity their predicted structures are strikingly similar with RMSD = 0.727, suggestive of a similar biochemical function ( Fig. 3f ).

Horizontally transferred bacterial gene can functionally replace its homologous plant gene

We tested if the bacterial genes we identified as being horizontally transferred from eukaryotes can replace their homologous plant genes. As a proof-of-concept we selected DET2 ( Fig. 3D–F ). The A. thaliana det2 mutant has a severe dwarf phenotype including a wider root meristem with altered cell wall orientation, typical to brassinosteroid (BR) deficient mutants ( Fig. 4 A–C) [ 52 , 53 ]. We transformed this mutant background with Leifsonia Det2 (lfDET2) fused to a fluorescent protein (lfDET2-NG), driven by the constitutive 35S or the Arabidopsis DET2 promoters and observed a rescue of these BR phenotypic defects ( Fig. 4 A–C). The rescued root length remained slightly shorter than WT, similar to an equivalent transformation with the Arabidopsis DET2 ( atDET2 ) [ 54 ]. In agreement with the atDET2-like functionality in planta , lfDET2 localized to the endoplasmic reticulum, similar to atDET2 ( Fig. 4 D–F). To conclude, lfDET2 is functionally similar to its Arabidopsis homologue.

Complementation of det2 Arabidopsis by a det2 bacterial homologue reveals functional similarity between bacterial and Arabidopsis homologous genes. A comparison between WT, det2 , and transgenic det2 lines harboring pDET2:lfDET2-NG and p35S:lfDET2-NG ( det2 expressed from two promoters). (A) Adult developmental stage of det2 , WT, and p35S:lfDET2-NG . Note the WT-like phenotype of the rescued det2 . (B) 7-day-old seedlings of WT, det2 , pDET2:lfDET2-NG , and p35S:lfDET2-NG. Scale bar = 1 cm c. root meristem of lines as in (A). Note the wide and aberrant morphology of the det2 meristem and its rescue by lfDET. mNeonGreen(NG) is shown in green and propidium iodide (PI) that marks cell borders in magenta. (D–F) Subcellular localization of atDET2 and lfDET2 in epidermal root cells. Note their similar localization in the endoplasmic reticulum. Scale bars = 20 um.

In this work we looked closely on the effect of HGT on the evolution of plants and bacteria, with a focus on A. thaliana and its extensively sampled microbiome. The effect of HGT on plant evolution was described in several works in recent years. Analysis of the moss Physcomitrella patens identified 44 families of nuclear genes that were acquired from bacteria in comparison to only 12 gene families that were acquired from either fungi, archaea or viruses [ 24 ]. These findings include two gene families that are involved in auxin biosynthesis. Green plants acquired from bacteria genes related to biosynthetic and metabolic pathways, adaptation, exaptation, and stress response [ 55 ]. These include, for example, genes involved in xylan degradation, plant vascular system development, and stress response to cold and cadmium. Genome analysis of subaerial Zygnematophyceae algae concluded that gene families that increase resistance to biotic and abiotic stresses in land plants, in particular desiccation through abscisic acid (ABA), were acquired by HGT from soil bacteria [ 56 ]. A recent work analyzed HGT patterns in 12 representative plant species [ 30 ]. The authors identified two major HGT episodes in plant evolution, each of which contributed > 100 gene families. The first occurred during early evolution of streptophytes and the second at the origin of land plants. Most of the contributing organisms were described as bacteria, with some contribution from fungi. These results also support our current results that nearly all transfers into Arabidopsis are ancient and are shared by monocots and dicots. We could not detect a bacterial gene that was transferred directly to Brassicaceae and is absent from other dicots.

Previous works could not specifically determine which microbes were gene donors or acceptors. We reasoned that the microbiome of a plant is the natural partner for HGT with the plant. We focused on bacteria and not on fungi and archaea because there is a high number of sequenced Arabidopsis-associated bacteria and because previous works showed that they are the most common gene donors to plants [ 24 ]. Another innovation of our method is the separation between bacteria according to their isolation sites to PA and NPA with the latter serving as a control group. This distinction allowed us to suggest a direct bi-directional HGT path between plants and their microbiome that affected at least seven genes ( Table 1 ). However, interestingly, we could not observe evidence that this path is more common than HGT between plants and NPA bacteria which do not share a niche. We do not know the precise mechanism of HGT between plants and NPA bacteria. One explanation could be that some PA organisms (bacteria or eukaryotes) that are missing from our analysis served as the mediators to transfer the genes to plants or NPA bacteria. An alternative would be that these genes are ancient and have undergone gene loss except in plants and NPA bacteria. Previously, it was reported that HGT occurs much more frequently between bacteria that share the same ecological niche (e.g. inhabit the same human body site) than between bacteria from different niches [ 57 ]. However, our data indicate that shared ecology of a host and its microbiome is not a critical indicator for cross-kingdom HGT, at least in the case of A. thaliana serving as a host. It would be interesting to test this finding in the context of other plants, animals or humans and their microbiomes. Some animal-bacteria cross-kingdom HGT events were described before such as the citrullinating genes that were transferred to animals from Cyanobacteria [ 58 ], peptidoglycan biosynthesis genes that were transferred into mealybugs [ 59 ] and peptidoglycan degradation genes acquired by the deer tick [ 60 ]. Another finding from our analysis is that we identified much fewer plant to bacteria gene transfer events ( n  = 16) than in the opposite direction ( n  = 59). This is, in our view, quite surprising as bacteria are much more amenable than plant cells to acquiring genes from the environment via transformation of environmental DNA, combined with a much faster generation time to allow natural selection and gene fixation.

The observed enrichment of carbohydrate catabolism functions, specifically of plant sugars such as pectin, which have moved from plants to bacteria, is fascinating. These genes, including the genes for pectin lyases and methylesterases, increased plant-dependent bacterial growth and likely the ability to colonize plant tissues by breaking down the plant cell wall. Pectate lyases enzymes were also shown to be critical for endophytic Arabidopsis root colonization by fungi, and they reduced plant performance [ 61 ]. Interestingly, in a previous study we revealed that genomes of PA bacteria have a higher number of carbohydrate metabolism genes than the genomes of the NPA group from the same taxon [ 2 ]. This trend was reproducible when we examined groups of bacteria from four different phyla. In the current work, we propose a model that actually a small number of these genes were transferred directly from plants to their microbiome. For example, we identified that glycosyl hydrolase 9C2 and 9C3 were directly transferred into PA bacteria.

Several phytohormone pathways have previously been described as transferred between plants and associated microbes. Agrobacterium naturally transfers its auxin biosynthesis genes into its host plant [ 62 ]. It was suggested that the YUC genes that are involved in Auxin biosynthesis were transferred from bacteria to the most recent common ancestor of land plants [ 24 ]. Agrobacterium also encodes and transfers into plants genes required for production of cytokinin [ 63 ]. On the other hand, as part of the interaction with plants, rhizobia evolved an independent pathway for gibberellin production [ 64 ]. In the current work, we suggest that det2 , a gene from the brassinosteroid biosynthetic pathway, has laterally transferred from eukaryotes to bacteria from the Leifsonia genus, including several PA bacteria. We showed that the gene can replace its plant homologue in brassinosteroid production but the role of this gene in bacteria remains unknown. We performed Arabidopsis root colonization experiments with Leifsonia strains that are naturally positive or negative for det2 and could not detect a phenotypic effect that correlates with the gene presence, at least when Arabidopsis were grown on agar. Together, our results suggest that cross-kingdom HGT shaped the genomes of both plants and bacteria, and that specific gene functions were acquired by bacteria, likely to break down the unique set of sugars that plants are capable of producing.

We thank the Life Sciences and Engineering Infrastructure Center (N. Dahan, Y. Lupu-Haber) and the Russell Barrie Nanotechnology Institute at the Technion. We thank O. Erlichman for helping with the last stages of the det2 experiments. We thank Dr. Omri Finkel, Prof. Uri Gophna, and Prof. Itay Mayrose for their useful insights about the research.

The research was funded by the Israeli Ministry of Agriculture (grant number 12-12-0002 to A.L. and S.S.-G) and by the Israel Science Foundation (no. 1725/18 to S.S.-G.). S.H. is supported by an excellence scholarship from the Faculty of Agriculture, Food, and Environment of the Hebrew University of Jerusalem. A.L. is also supported by the Alon Fellowship of the Israeli Council of Higher Education and the Israeli Science Foundation (grants 1535/20, 3300/20); Hebrew University - University of Illinois Urbana-Champaign seed grant; ICA in Israel.

All data generated or analysed during this study are included in this published article and its supplementary information files.

Bai   Y , Müller   DB , Srinivas   G  et al.    Functional overlap of the Arabidopsis leaf and root microbiota . Nature   2015 ; 528 : 364 – 9 . https://doi.org/10.1038/nature16192

• Google Scholar

Levy   A , Gonzalez   IS , Mittelviefhaus   M  et al.    Genomic features of bacterial adaptation to plants . Nat Genet   2018 ; 50 : 138 – 50 . https://doi.org/10.1038/s41588-017-0012-9

Karasov   TL , Almario   J , Friedemann   C  et al.    Arabidopsis thaliana and pseudomonas pathogens exhibit stable associations over evolutionary timescales . Cell Host Microbe   2018 ; 24 : 168 – 179.e4 . https://doi.org/10.1016/j.chom.2018.06.011

Garrido-Oter   R , Nakano   RT , Dombrowski   N  et al.    Modular traits of the Rhizobiales root microbiota and their evolutionary relationship with symbiotic rhizobia . Cell Host Microbe   2018 ; 24 : 155 – 167.e5 .

Cole   BJ , Feltcher   ME , Waters   RJ  et al.    Genome-wide identification of bacterial plant colonization genes . PLoS Biol   2017 ; 15 :e2002860. https://doi.org/10.1371/journal.pbio.2002860

Helmann   TC , Deutschbauer   AM , Lindow   SE . Genome-wide identification of genes required for fitness during colonization of the leaf surface and apoplast . Proc Natl Acad Sci USA   2019 ; 116 : 18900 – 10 . https://doi.org/10.1073/pnas.1908858116

Nobori   T , Velásquez   AC , Wu   J  et al.    Transcriptome landscape of a bacterial pathogen under plant immunity . Proc Natl Acad Sci USA   2018 ; 115 : E3055 – 64 . https://doi.org/10.1073/pnas.1800529115

Nobori   T , Wang   Y , Wu   J  et al.    Multidimensional gene regulatory landscape of a bacterial pathogen in plants . Nat Plants   2020 ; 6 : 883 – 96 . https://doi.org/10.1038/s41477-020-0690-7

Nobori   T , Cao   Y , Entila   F  et al.    Dissecting the cotranscriptome landscape of plants and their microbiota . EMBO Rep   2022 ; 23 :e55380. https://doi.org/10.15252/embr.202255380

Bais   HP , Weir   TL , Perry   LG  et al.    The role of root exudates in rhizosphere interactions with plants and other organisms . Annu Rev Plant Biol   2006 ; 57 : 233 – 66 . https://doi.org/10.1146/annurev.arplant.57.032905.105159

Marks   BB , Megías   M , Ollero   FJ  et al.    Maize growth promotion by inoculation with Azospirillum brasilense and metabolites of rhizobium tropici enriched on lipo-chitooligosaccharides (LCOs) . AMB Express   2015 ; 5 : 71 . https://doi.org/10.1186/s13568-015-0154-z

Venturi   V , Keel   C . Signaling in the rhizosphere . Trends Plant Sci   2016 ; 21 : 187 – 98 . https://doi.org/10.1016/j.tplants.2016.01.005

Stringlis   IA , Yu   K , Feussner   K  et al.    MYB72-dependent coumarin exudation shapes root microbiome assembly to promote plant health . Proc Natl Acad Sci USA   2018 ; 115 : E5213 – 22 . https://doi.org/10.1073/pnas.1722335115

Bernal   P , Llamas   MA , Filloux   A . Type VI secretion systems in plant-associated bacteria . Environ Microbiol   2018 ; 20 : 1 – 15 . https://doi.org/10.1111/1462-2920.13956

Zhalnina   K , Louie   KB , Hao   Z  et al.    Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly . Nat Microbiol   2018 ; 3 : 470 – 80 . https://doi.org/10.1038/s41564-018-0129-3

Lucke   M , Correa   MG , Levy   A . The role of secretion systems, effectors, and secondary metabolites of beneficial Rhizobacteria in interactions with plants and microbes . Front Plant Sci   2020 ; 11 :589416. https://doi.org/10.3389/fpls.2020.589416

Xin   X-F , Nomura   K , Aung   K  et al.    Bacteria establish an aqueous living space in plants crucial for virulence . Nature   2016 ; 539 : 524 – 9 . https://doi.org/10.1038/nature20166

Pontiroli   A , Rizzi   A , Simonet   P  et al.    Visual evidence of horizontal gene transfer between plants and bacteria in the phytosphere of transplastomic tobacco . Appl Environ Microbiol   2009 ; 75 : 3314 – 22 . https://doi.org/10.1128/AEM.02632-08

Rosebrock   TR , Zeng   L , Brady   JJ  et al.    A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity . Nature   2007 ; 448 : 370 – 4 . https://doi.org/10.1038/nature05966

Kerff   F , Amoroso   A , Herman   R  et al.    Crystal structure and activity of Bacillus subtilis YoaJ (EXLX1), a bacterial expansin that promotes root colonization . Proc Natl Acad Sci USA   2008 ; 105 : 16876 – 81 . https://doi.org/10.1073/pnas.0809382105

Nikolaidis   N , Doran   N , Cosgrove   DJ . Plant expansins in bacteria and fungi: evolution by horizontal gene transfer and independent domain fusion . Mol Biol Evol   2014 ; 31 : 376 – 86 . https://doi.org/10.1093/molbev/mst206

Georgelis   N , Nikolaidis   N , Cosgrove   DJ . Bacterial expansins and related proteins from the world of microbes . Appl Microbiol Biotechnol   2015 ; 99 : 3807 – 23 . https://doi.org/10.1007/s00253-015-6534-0

Ambrose   BA , Purugganan   MD . Annual Plant Reviews: The Evolution of Plant Form . USA: John Wiley & Sons , 2012 .

Google Preview

Yue   J , Hu   X , Sun   H  et al.    Widespread impact of horizontal gene transfer on plant colonization of land . Nat Commun   2012 ; 3 : 1152 . https://doi.org/10.1038/ncomms2148

Fang   H , Huangfu   L , Chen   R  et al.    Ancestor of land plants acquired the DNA-3-methyladenine glycosylase (MAG) gene from bacteria through horizontal gene transfer . Sci Rep   2017 ; 7 : 9324 . https://doi.org/10.1038/s41598-017-05066-w

Cai   H , Liu   Y , Guo   C . Contribution of plant–bacteria interactions to horizontal gene transfer in plants . Biotechnol Biotechnol Equip   2021 ; 35 : 1587 – 92 . https://doi.org/10.1080/13102818.2021.1985612

Shukla   AK , Upadhyay   SK , Mishra   M  et al.    Expression of an insecticidal fern protein in cotton protects against whitefly . Nat Biotechnol   2016 ; 34 : 1046 – 51 . https://doi.org/10.1038/nbt.3665

Li   F-W , Brouwer   P , Carretero-Paulet   L  et al.    Fern genomes elucidate land plant evolution and cyanobacterial symbioses . Nat Plants   2018 ; 4 : 460 – 72 . https://doi.org/10.1038/s41477-018-0188-8

Quispe-Huamanquispe   DG , Gheysen   G , Kreuze   JF . Horizontal gene transfer contributes to plant evolution: the case of T-DNAs . Front Plant Sci   2017 ; 8 : 2015 . https://doi.org/10.3389/fpls.2017.02015

Ma   J , Wang   S , Zhu   X  et al.    Major episodes of horizontal gene transfer drove the evolution of land plants . Mol Plant   2022 ; 15 : 857 – 71 . https://doi.org/10.1016/j.molp.2022.02.001

Lundberg   DS , Lebeis   SL , Paredes   SH  et al.    Defining the core Arabidopsis thaliana root microbiome . Nature   2012 ; 488 : 86 – 90 . https://doi.org/10.1038/nature11237

Bulgarelli   D , Rott   M , Schlaeppi   K  et al.    Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota . Nature   2012 ; 488 : 91 – 5 . https://doi.org/10.1038/nature11336

Kado   CI . Horizontal gene transfer: sustaining pathogenicity and optimizing host-pathogen interactions . Mol Plant Pathol   2009 ; 10 : 143 – 50 . https://doi.org/10.1111/j.1364-3703.2008.00518.x

Ramachandran   P , Beslin Joshi   J , Maupin-Furlow   JA  et al.    Bacterial effectors mimicking ubiquitin-proteasome pathway tweak plant immunity . Microbiol Res   2021 ; 250 : 126810 . https://doi.org/10.1016/j.micres.2021.126810

Memisevic   V , Milenkovic   T , Przulj   N . Complementarity of network and sequence information in homologous proteins . J Integr Bioinform   2010 ; 7 : 275 – 89 . https://doi.org/10.1515/jib-2010-135

Pearson   WR . An introduction to sequence similarity (‘homology’) searching . Curr Protoc Bioinformatics   2013 Chapter 3: Unit3.1 ; 42 : 3.1.1 – 8 . https://doi.org/10.1002/0471250953.bi0301s42

Archibald   J . One Plus One Equals One: Symbiosis and the Evolution of Complex Life . USA : Oxford University Press , 2014 .

Price   MN , Dehal   PS , Arkin   AP . FastTree 2--approximately maximum-likelihood trees for large alignments . PLoS One   2010 ; 5 : e9490 . https://doi.org/10.1371/journal.pone.0009490

Nguyen   L-T , Schmidt   HA , von Haeseler   A  et al.    IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies . Mol Biol Evol   2015 ; 32 : 268 – 74 . https://doi.org/10.1093/molbev/msu300

Tria   FDK , Landan   G , Dagan   T . Phylogenetic rooting using minimal ancestor deviation . Nat Ecol Evol   2017 ; 1 : 193 . https://doi.org/10.1038/s41559-017-0193

Müller   NA , Kersten   B , Leite Montalvão   AP  et al.    A single gene underlies the dynamic evolution of poplar sex determination . Nat Plants   2020 ; 6 : 630 – 7 . https://doi.org/10.1038/s41477-020-0672-9

Chang   J , Li   X , Fu   W  et al.    Asymmetric distribution of cytokinins determines root hydrotropism in Arabidopsis thaliana . Cell Res   2019 ; 29 : 984 – 93 . https://doi.org/10.1038/s41422-019-0239-3

Glass   M , Barkwill   S , Unda   F  et al.    Endo-β-1,4-glucanases impact plant cell wall development by influencing cellulose crystallization . J Integr Plant Biol   2015 ; 57 : 396 – 410 . https://doi.org/10.1111/jipb.12353

Yue   J , Hu   X , Huang   J . Origin of plant auxin biosynthesis . Trends Plant Sci   2014 ; 19 : 764 – 70 .

Gao   Y , Dai   X , Aoi   Y  et al.    Two homologous INDOLE-3-ACETAMIDE (IAM) HYDROLASE genes are required for the auxin effects of IAM in Arabidopsis . J Genet Genomics   2020 ; 47 : 157 – 65 . https://doi.org/10.1016/j.jgg.2020.02.009

Prescott   CE , Grayston   SJ , Helmisaari   H-S  et al.    Surplus carbon drives allocation and plant–soil interactions . Trends Ecol Evol   2020 ; 35 : 1110 – 8 . https://doi.org/10.1016/j.tree.2020.08.007

Wang   D , Weaver   ND , Kesarwani   M  et al.    Induction of protein secretory pathway is required for systemic acquired resistance . Science   2005 ; 308 : 1036 – 40 . https://doi.org/10.1126/science.1108791

Carella   P , Merl-Pham   J , Wilson   DC  et al.    Comparative proteomics analysis of phloem exudates collected during the induction of systemic acquired resistance . Plant Physiol   2016 ; 171 : 1495 – 510 . https://doi.org/10.1104/pp.16.00269

Little   D , Gouhier-Darimont   C , Bruessow   F  et al.    Oviposition by pierid butterflies triggers defense responses in Arabidopsis . Plant Physiol   2007 ; 143 : 784 – 800 . https://doi.org/10.1104/pp.106.090837

Fujioka   S , Li   J , Choi   YH  et al.    The Arabidopsis deetiolated2 mutant is blocked early in brassinosteroid biosynthesis . Plant Cell   1997 ; 9 : 1951 – 62 .

Williams   KP . Integration sites for genetic elements in prokaryotic tRNA and tmRNA genes: sublocation preference of integrase subfamilies . Nucleic Acids Res   2002 ; 30 : 866 – 75 . https://doi.org/10.1093/nar/30.4.866

Chory   J , Nagpal   P , Peto   CA . Phenotypic and genetic analysis of det2, a new mutant that affects light-regulated seedling development in Arabidopsis . Plant Cell   1991 ; 3 : 445 – 59 . https://doi.org/10.2307/3869351

Li   Z , Sela   A , Fridman   Y  et al.    Optimal BR signalling is required for adequate cell wall orientation in the Arabidopsis root meristem . Development   2021 ; 148 . https://doi.org/10.1242/dev.199504

Park   CH , Jang   M-S , Yun   JH  et al.    Effects of secondary mutation in det2-1 on root growth and development in Arabidopsis . J Plant Biol   2014 ; 57 : 255 – 63 . https://doi.org/10.1007/s12374-014-0096-z

Chen   R , Huangfu   L , Lu   Y  et al.    Adaptive innovation of green plants by horizontal gene transfer . Biotechnol Adv   2021 ; 46 :107671. https://doi.org/10.1016/j.biotechadv.2020.107671

Cheng   S , Xian   W , Fu   Y  et al.    Genomes of subaerial zygnematophyceae provide insights into land plant evolution . Cell   2019 ; 179 : 1057 – 1067.e14 . https://doi.org/10.1016/j.cell.2019.10.019

Smillie   CS , Smith   MB , Friedman   J  et al.    Ecology drives a global network of gene exchange connecting the human microbiome . Nature   2011 ; 480 : 241 – 4 . https://doi.org/10.1038/nature10571

Cummings   TFM , Gori   K , Sanchez-Pulido   L  et al.    Citrullination was introduced into animals by horizontal gene transfer from cyanobacteria . Mol Biol Evol   2022 ; 39 . https://doi.org/10.1093/molbev/msab317

Bublitz   DC , Chadwick   GL , Magyar   JS  et al.    Peptidoglycan production by an insect-bacterial mosaic . Cell   2019 ; 179 : 703 – 712.e7 . https://doi.org/10.1016/j.cell.2019.08.054

Chou   S , Daugherty   MD , Peterson   SB  et al.    Transferred interbacterial antagonism genes augment eukaryotic innate immune function . Nature   2015 ; 518 : 98 – 101 . https://doi.org/10.1038/nature13965

Mesny   F , Miyauchi   S , Thiergart   T  et al.    Genetic determinants of endophytism in the Arabidopsis root mycobiome . Nat Commun   2021 ; 12 : 7227 . https://doi.org/10.1038/s41467-021-27479-y

Kyndt   T , Quispe   D , Zhai   H  et al.    The genome of cultivated sweet potato contains agrobacterium T-DNAs with expressed genes: an example of a naturally transgenic food crop . Proc Natl Acad Sci USA   2015 ; 112 : 5844 – 9 . https://doi.org/10.1073/pnas.1419685112

Akiyoshi   DE , Klee   H , Amasino   RM  et al.    T-DNA of agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis . Proc Natl Acad Sci USA   1984 ; 81 : 5994 – 8 . https://doi.org/10.1073/pnas.81.19.5994

Nett   RS , Montanares   M , Marcassa   A  et al.    Elucidation of gibberellin biosynthesis in bacteria reveals convergent evolution . Nat Chem Biol   2017 ; 13 : 69 – 74 . https://doi.org/10.1038/nchembio.2232

Altschul   SF , Gish   W , Miller   W  et al.    Basic local alignment search tool . J Mol Biol   1990 ; 215 : 403 – 10 . https://doi.org/10.1016/S0022-2836(05)80360-2

Sievers   F , Wilm   A , Dineen   D  et al.    Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal omega . Mol Syst Biol   2011 ; 7 : 539 . https://doi.org/10.1038/msb.2011.75

Letunic   I , Bork   P . Interactive tree of life (iTOL) v4: recent updates and new developments . Nucleic Acids Res   2019 ; 47 : W256 – 9 . https://doi.org/10.1093/nar/gkz239

Yu   G , Wang   L-G , Han   Y  et al.    clusterProfiler: an R package for comparing biological themes among gene clusters . OMICS   2012 ; 16 : 284 – 7 . https://doi.org/10.1089/omi.2011.0118

Chen   I-MA , Chu   K , Palaniappan   K  et al.    IMG/M v.5.0: an integrated data management and comparative analysis system for microbial genomes and microbiomes . Nucleic Acids Res   2018 ; 47 : D666 – 77 . https://doi.org/10.1093/nar/gky901

Mirdita   M , Schütze   K , Moriwaki   Y  et al.    ColabFold: making protein folding accessible to all . Nat Methods   2022 ; 19 : 679 – 82 . https://doi.org/10.1038/s41592-022-01488-1

Jumper   J , Evans   R , Pritzel   A  et al.    Highly accurate protein structure prediction with AlphaFold . Nature   2021 ; 596 : 583 – 9 . https://doi.org/10.1038/s41586-021-03819-2

van Kempen   M , Kim   SS , Tumescheit   C  et al.    Fast and accurate protein structure search with Foldseek . Nat Biotechnol   2024 ; 42 :243–6.

Wilkinson   L . ggplot2: elegant graphics for data analysis by WICKHAM, H . Biometrics   2011 ; 67 : 678 – 9 . https://doi.org/10.1111/j.1541-0420.2011.01616.x

Wickham   H . Reshaping data with the reshape Package . J Stat Softw   2007 ; 21 :1–20. https://doi.org/10.18637/jss.v021.i12

Engler   C , Youles   M , Gruetzner   R  et al.    A golden gate modular cloning toolbox for plants . ACS Synth Biol   2014 ; 3 : 839 – 43 . https://doi.org/10.1021/sb4001504

Fridman   Y , Strauss   S , Horev   G  et al.    The root meristem is shaped by brassinosteroid control of cell geometry . Nat Plants   2021 ; 7 : 1475 – 84 . https://doi.org/10.1038/s41477-021-01014-9

Supplementary data

Email alerts

Related articles in, citing articles via.

• Advertising & Corporate Services
• Journals Career Network

Affiliations

• Online ISSN 2730-6151
• Copyright © 2024 International Society for Microbial Ecology
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Advertising
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Parasitic plants—potential vectors of phytopathogens.

1. Parasitism in Plants

1.1. variety of parasitic plants, 1.2. haustorium properties, 2. phytopathogens and parasitic plants, 2.1. major phytopathogens, 2.1.1. viruses, 2.1.2. phytoplasma, 2.1.3. bacteria, 2.1.4. fungi, 2.2. symptomatics, 2.3. detection methods, 3. putative routes of transmission, 3.1. plant-to-plant transmission, 3.2. arthropod-to-plant transmission, 3.3. seed transmission, 4. phytopathogens as biocontrol agents of parasitic plants, 5. conclusions and future perspectives, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

• Heide-Jørgensen, H. Parasitic Flowering Plants ; Brill: Leiden, The Netherlands, 2008. [ Google Scholar ]
• Nickrent, D.L. Parasitic angiosperms: How often and how many? Taxon 2020 , 69 , 5–27. [ Google Scholar ] [ CrossRef ]
• Teixeira-Costa, L.; Davis, C.C. Life history, diversity, and distribution in parasitic flowering plants. Plant Physiol. 2021 , 187 , 32–51. [ Google Scholar ] [ CrossRef ]
• Wicaksono, A.; Mursidawati, S.; Sukamto, L.A.; Teixeira da Silva, J.A. Rafflesia spp.: Propagation and conservation. Planta 2016 , 244 , 289–296. [ Google Scholar ] [ CrossRef ]
• Park, I.; Song, J.-H.; Yang, S.; Kim, W.J.; Choi, G.; Moon, B.C. Cuscuta species identification based on the morphology of reproductive organs and complete chloroplast genome sequences. Int. J. Mol. Sci. 2019 , 20 , 2726. [ Google Scholar ] [ CrossRef ]
• Fernández-Aparicio, M.; Yoneyama, K.; Rubiales, D. The role of strigolactones in host specificity of Orobanche and Phelipanche seed germination. Seed Sci. Res. 2011 , 21 , 55–61. [ Google Scholar ] [ CrossRef ]
• Dor, E.; Plakhine, D.; Joel, D.M.; Larose, H.; Westwood, J.H.; Smirnov, E.; Ziadna, H.; Hershenhorn, J. A new race of sunflower broomrape ( Orobanche cumana ) with a wider host range due to changes in seed response to strigolactones. Weed Sci. 2020 , 68 , 134–142. [ Google Scholar ] [ CrossRef ]
• Krasylenko, Y.A.; Janošíková, K.; Kukushkin, O.V. Juniper dwarf mistletoe ( Arceuthobium oxycedri ) in the Crimean Peninsula: Novel insights into its morphology, hosts, and distribution. Botany 2017 , 95 , 897–911. [ Google Scholar ] [ CrossRef ]
• Barath, K.; Csiky, J. Host range and host choice of Cuscuta species in Hungary. Acta Bot. Croat. 2012 , 71 , 215–227. [ Google Scholar ] [ CrossRef ]
• David, O.G.; Ayangbenro, A.S.; Odhiambo, J.J.; Babalola, O.O. Striga hermonthica : A highly destructive pathogen in maize production. Environ. Chall. 2022 , 8 , 100590. [ Google Scholar ] [ CrossRef ]
• Dafaallah, A.B. Biology and physiology of witchweed ( Striga spp.): A review. Int. J. Acad. Multidiscip. 2019 , 3 , 42–51. [ Google Scholar ]
• Parker, C. Observations on the current status of Orobanche and Striga problems worldwide. Pest Manag. Sci. Former. Pestic. Sci. 2009 , 65 , 453–459. [ Google Scholar ] [ CrossRef ]
• Parker, C. Parasitic weeds: A world challenge. Weed Sci. 2012 , 60 , 269–276. [ Google Scholar ] [ CrossRef ]
• Jeschke, W.D.; Bäumel, P.; Räth, N.; Czygan, F.-C.; Proksch, P. Modelling of the flows and partitioning of carbon and nitrogen in the holoparasite Cuscuta reflexa Roxb. and its host Lupinus albus L. II. Flows between host and parasite and within the parasitized host. J. Exp. Bot. 1994 , 45 , 801–812. [ Google Scholar ] [ CrossRef ]
• Bardgett, R.D.; Smith, R.S.; Shiel, R.S.; Peacock, S.; Simkin, J.M.; Quirk, H.; Hobbs, P.J. Parasitic plants indirectly regulate below-ground properties in grassland ecosystems. Nature 2006 , 439 , 969–972. [ Google Scholar ] [ CrossRef ]
• Cameron, D.D.; Geniez, J.-M.; Seel, W.E.; Irving, L.J. Suppression of host photosynthesis by the parasitic plant Rhinanthus minor . Ann. Bot. 2008 , 101 , 573–578. [ Google Scholar ] [ CrossRef ]
• Gurney, A.L.; Press, M.C.; Ransom, J.K. The parasitic angiosperm Striga hermonthica can reduce photosynthesis of its sorghum and maize hosts in the field. J. Exp. Bot. 1995 , 46 , 1817–1823. [ Google Scholar ] [ CrossRef ]
• Shen, H.; Hong, L.; Ye, W.; Cao, H.; Wang, Z. The influence of the holoparasitic plant Cuscuta campestris on the growth and photosynthesis of its host Mikania micrantha . J. Exp. Bot. 2007 , 58 , 2929–2937. [ Google Scholar ] [ CrossRef ]
• Runo, S.; Kuria, E.K. Habits of a highly successful cereal killer, Striga . PLoS Pathog. 2018 , 14 , e1006731. [ Google Scholar ] [ CrossRef ]
• Fujioka, H.; Samejima, H.; Mizutani, M.; Okamoto, M.; Sugimoto, Y. How does Striga hermonthica Bewitch its hosts? Plant Signal. Behav. 2019 , 14 , 1605810. [ Google Scholar ] [ CrossRef ]
• Kokla, A.; Melnyk, C.W. Developing a thief: Haustoria formation in parasitic plants. Dev. Biol. 2018 , 442 , 53–59. [ Google Scholar ] [ CrossRef ]
• Yoshida, S.; Cui, S.; Ichihashi, Y.; Shirasu, K. The haustorium, a specialized invasive organ in parasitic plants. Annu. Rev. Plant Biol. 2016 , 67 , 643–667. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ishida, J.K.; Wakatake, T.; Yoshida, S.; Takebayashi, Y.; Kasahara, H.; Wafula, E.; de Pamphilis, C.W.; Namba, S.; Shirasu, K. Local Auxin Biosynthesis Mediated by a YUCCA Flavin Monooxygenase Regulates Haustorium Development in the Parasitic Plant Phtheirospermum japonicum . Plant Cell 2016 , 28 , 1795–1814. [ Google Scholar ] [ CrossRef ]
• Cui, S.; Wakatake, T.; Hashimoto, K.; Saucet, S.B.; Toyooka, K.; Yoshida, S.; Shirasu, K. Haustorial hairs are specialized root hairs that support parasitism in the facultative parasitic plant Phtheirospermum japonicum . Plant Physiol. 2016 , 170 , 1492–1503. [ Google Scholar ] [ CrossRef ]
• Westwood, J.H.; Yoder, J.I.; Timko, M.P.; Depamphilis, C.W. The evolution of parasitism in plants. Trends Plant Sci. 2010 , 15 , 227–235. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kirschner, G.K.; Xiao, T.T.; Jamil, M.; Al-Babili, S.; Lube, V.; Blilou, I. A roadmap of haustorium morphogenesis in parasitic plants. J. Exp. Bot. 2023 , 74 , 7034–7044. [ Google Scholar ] [ CrossRef ]
• Xiao, T.T.; Kirschner, G.K.; Kountche, B.A.; Jamil, M.; Savina, M.; Lube, V.; Mironova, V.; Al Babili, S.; Blilou, I. A PLETHORA/PIN-FORMED/auxin network mediates prehaustorium formation in the parasitic plant Striga hermonthica . Plant Physiol. 2022 , 189 , 2281–2297. [ Google Scholar ] [ CrossRef ]
• Weber, H.C. Evolution of the secondary haustoria to a primary haustorium in the parasitic Scrophulariaceae/Orobanchaceae . Plant Syst. Evol. 1987 , 156 , 127–131. [ Google Scholar ] [ CrossRef ]
• Tsuchiya, Y.; Yoshimura, M.; Sato, Y.; Kuwata, K.; Toh, S.; Holbrook-Smith, D.; Zhang, H.; McCourt, P.; Itami, K.; Kinoshita, T. Probing strigolactone receptors in Striga hermonthica with fluorescence. Science 2015 , 349 , 864–868. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Toh, S.; Holbrook-Smith, D.; Stogios, P.J.; Onopriyenko, O.; Lumba, S.; Tsuchiya, Y.; Savchenko, A.; McCourt, P. Structure-function analysis identifies highly sensitive strigolactone receptors in Striga . Science 2015 , 350 , 203–207. [ Google Scholar ] [ CrossRef ]
• Yoneyama, K.; Awad, A.A.; Xie, X.; Yoneyama, K.; Takeuchi, Y. Strigolactones as germination stimulants for root parasitic plants. Plant Cell Physiol. 2010 , 51 , 1095–1103. [ Google Scholar ] [ CrossRef ]
• Furuhashi, K.; Iwase, K.; Furuhashi, T. Role of Light and Plant Hormones in Stem Parasitic Plant ( Cuscuta and Cassytha ) Twining and Haustoria Induction. Photochem. Photobiol. 2021 , 97 , 1054–1062. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Johnson, B.I.; De Moraes, C.M.; Mescher, M.C. Manipulation of light spectral quality disrupts host location and attachment by parasitic plants in the genus Cuscuta . J. Appl. Ecol. 2016 , 53 , 794–803. [ Google Scholar ] [ CrossRef ]
• Runyon, J.B.; Mescher, M.C.; De Moraes, C.M. Volatile chemical cues guide host location and host selection by parasitic plants. Science 2006 , 313 , 1964–1967. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Goyet, V.; Wada, S.; Cui, S.; Wakatake, T.; Shirasu, K.; Montiel, G.; Simier, P.; Yoshida, S. Haustorium inducing factors for parasitic Orobanchaceae. Front. Plant Sci. 2019 , 10 , 1056. [ Google Scholar ] [ CrossRef ]
• Fernández-Aparicio, M.; Masi, M.; Cimmino, A.; Evidente, A. Effects of benzoquinones on radicles of Orobanche and Phelipanche species. Plants 2021 , 10 , 746. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jhu, M.-Y.; Sinha, N.R. Cuscuta species: Model organisms for haustorium development in stem holoparasitic plants. Front. Plant Sci. 2022 , 13 , 1086384. [ Google Scholar ] [ CrossRef ]
• Teixeira-Costa, L. A living bridge between two enemies: Haustorium structure and evolution across parasitic flowering plants. Braz. J. Bot. 2021 , 44 , 165–178. [ Google Scholar ] [ CrossRef ]
• Okayasu, K.; Aoki, K.; Kurotani, K.-I.; Notaguchi, M. Tissue adhesion between distant plant species in parasitism and grafting. Commun. Integr. Biol. 2021 , 14 , 21–23. [ Google Scholar ] [ CrossRef ]
• Gaut, B.S.; Miller, A.J.; Seymour, D.K. Living with two genomes: Grafting and its implications for plant genome-to-genome interactions, phenotypic variation, and evolution. Annu. Rev. Genet. 2019 , 53 , 195–215. [ Google Scholar ] [ CrossRef ]
• Kim, G.; Westwood, J.H. Macromolecule exchange in Cuscuta –host plant interactions. Curr. Opin. Plant Biol. 2015 , 26 , 20–25. [ Google Scholar ] [ CrossRef ]
• Mower, J.P.; Stefanović, S.; Hao, W.; Gummow, J.S.; Jain, K.; Ahmed, D.; Palmer, J.D. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes. BMC Biol. 2010 , 8 , 150. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Park, S.-Y.; Shimizu, K.; Brown, J.; Aoki, K.; Westwood, J.H. Mobile host mRNAs are translated to protein in the associated parasitic plant Cuscuta campestris . Plants 2021 , 11 , 93. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Westwood, J.H.; Kim, G. RNA mobility in parasitic plant–host interactions. RNA Biol. 2017 , 14 , 450–455. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Haupt, S.; Oparka, K.J.; Sauer, N.; Neumann, S. Macromolecular trafficking between Nicotiana tabacum and the holoparasite Cuscuta reflexa . J. Exp. Bot. 2001 , 52 , 173–177. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aly, R. Trafficking of molecules between parasitic plants and their hosts. Weed Res. 2013 , 53 , 231–241. [ Google Scholar ] [ CrossRef ]
• LeBlanc, M.; Kim, G.; Westwood, J.H. RNA trafficking in parasitic plant systems. Front. Plant Sci. 2012 , 3 , 203. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Förste, F.; Mantouvalou, I.; Kanngießer, B.; Stosnach, H.; Lachner, L.A.M.; Fischer, K.; Krause, K. Selective mineral transport barriers at Cuscuta -host infection sites. Physiol. Plant. 2020 , 168 , 934–947. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Sastry, K.S.; Zitter, T.A. Management of virus and viroid diseases of crops in the tropics. In Plant Virus and Viroid Diseases in the Tropics: Volume 2: Epidemiology and Management ; Springer: Dordrecht, The Netherlands, 2014; pp. 149–480. [ Google Scholar ]
• Bhat, A.I.; Rao, G.P. Isolation and Diagnosis of Virus Through Indicator Hosts. In Characterization of Plant Viruses ; Springer Protocols Handbooks; Humana: New York, NY, USA, 2020; pp. 23–27. [ Google Scholar ]
• Scholthof, K.B.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011 , 12 , 938–954. [ Google Scholar ] [ CrossRef ]
• Rybicki, E.P. A Top Ten list for economically important plant viruses. Arch. Virol. 2015 , 160 , 17–20. [ Google Scholar ] [ CrossRef ]
• Hosford, R.M. Transmission of plant viruses by dodder. Bot. Rev. 1967 , 33 , 387–406. [ Google Scholar ] [ CrossRef ]
• Teofanova, D.; Lozanova, Y.; Lambovska, K.; Pachedjieva, K.; Tosheva, A.; Odjakova, M.; Zagorchev, L. Cuscuta spp. populations as potential reservoirs and vectors of four plant viruses. Phytoparasitica 2022 , 50 , 555–566. [ Google Scholar ] [ CrossRef ]
• Birschwilks, M.; Haupt, S.; Hofius, D.; Neumann, S. Transfer of phloem-mobile substances from the host plants to the holoparasite Cuscuta sp. J. Exp. Bot. 2006 , 57 , 911–921. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gal-On, A.; Naglis, A.; Leibman, D.; Ziadna, H.; Kathiravan, K.; Papayiannis, L.; Holdengreber, V.; Guenoune-Gelbert, D.; Lapidot, M.; Aly, R. Broomrape can acquire viruses from its hosts. Phytopathology 2009 , 99 , 1321–1329. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Choi, D.; Shin, C.; Shirasu, K.; Hahn, Y. Two novel poty-like viruses identified from the transcriptome data of purple witchweed ( Striga hermonthica ). Acta Virol. 2021 , 65 , 365. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dikova, B. Establishment of Tobacco rattle virus (TRV) in weeds and Cuscuta . Biotechnol. Biotechnol. Equip. 2006 , 20 , 42–48. [ Google Scholar ] [ CrossRef ]
• Mikona, C.; Jelkmann, W. Replication of Grapevine leafroll-associated virus-7 (GLRaV-7) by Cuscuta species and its transmission to herbaceous plants. Plant Dis. 2010 , 94 , 471–476. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Jelkmann, W.; Hergenhahn, F.; Berwarth, C. Transmission of Little cherry virus-1 (LChV-1) by Cuscuta europea to herbaceous host plants. In Proceedings of the 21st International Conference on Virus and other Graft Transmissible Diseases of Fruit Crops, Neustadt, Germany, 5–10 July 2009. [ Google Scholar ]
• Vachev, T.; Ivanova, D.; Minkov, I.; Tsagris, M.; Gozmanova, M. Trafficking of the Potato spindle tuber viroid between tomato and Orobanche ramosa . Virology 2010 , 399 , 187–193. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ivanova, D.; Vachev, T.; Baev, V.; Minkov, I.; Gozmanova, M. Identification of Potato Spindle Tuber Viroid Small RNA in Orobanche ramosa by Microarray. Biotechnol. Biotechnol. Equip. 2010 , 24 , 144–146. [ Google Scholar ] [ CrossRef ]
• Lee, I.-M.; Davis, R.E.; Gundersen-Rindal, D.E. Phytoplasma: Phytopathogenic mollicutes. Annu. Rev. Microbiol. 2000 , 54 , 221–255. [ Google Scholar ] [ CrossRef ]
• Bertaccini, A.; Duduk, B. Phytoplasma and phytoplasma diseases: A review of recent research. Phytopathol. Mediterr. 2009 , 48 , 355–378. [ Google Scholar ]
• IRPCM Phytoplasma/Spiroplasma Working Team–Phytoplasma Taxonomy Group. ‘ Candidatus Phytoplasma’, a taxon for the wall-less, non-helical prokaryotes that colonize plant phloem and insects. Int. J. Syst. Evol. Microbiol. 2004 , 54 , 1243–1255. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kumari, S.; Nagendran, K.; Rai, A.B.; Singh, B.; Rao, G.P.; Bertaccini, A. Global status of phytoplasma diseases in vegetable crops. Front. Microbiol. 2019 , 10 , 441347. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Přibylová, J.; Špak, J. Dodder transmission of phytoplasmas. Phytoplasma Methods Protoc. 2013 , 938 , 41–46. [ Google Scholar ]
• Marcone, C.; Hergenhahn, F.; Ragozzino, A.; Seemüller, E. Dodder transmission of pear decline, European stone fruit yellows, rubus stunt, picris echioides yellows and cotton phyllody phytoplasmas to periwinkle. J. Phytopathol. 1999 , 147 , 187–192. [ Google Scholar ] [ CrossRef ]
• Ãzdemir, N.; Saygili, H.; Sahin, F.; Karsavuran, Y.; Bayrak, O.; Oral, B. Host range and genetic characterization of a phytoplasma causing tomato stolbur disease in Turkey. Acta Hortic. 2007 , 808 , 255–262. [ Google Scholar ] [ CrossRef ]
• Shokri, M.; Jafary, H.; Moghadam, M.A. Molecular detection and survey of tomato big bud phytoplasma in Zanjan province. Genet. Eng. Biosaf. J. 2023 , 12 , 123–130. [ Google Scholar ]
• Sarab, R.T.; Bakhsh, M.S.; Motlagh, M.A. First report of a phytoplasma associated with Orobanche spp. in Iran. In Proceedings of the 22nd Iranian Plant Protection Congress, Karaj, Iran, 27–30 August 2016. [ Google Scholar ]
• Borkar, S.G.; Yumlembam, R.A. Bacterial Diseases of Crop Plants ; CRC Press: Boca Raton, FL, USA, 2016. [ Google Scholar ]
• Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012 , 13 , 614–629. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Eichenlaub, R.; Gartemann, K.-H.; Burger, A. Clavibacter michiganensis, a group of Gram-positive phytopathogenic bacteria. In Plant-Associated Bacteria ; Springer: Dordrecht, The Netherlands, 2006; pp. 385–421. [ Google Scholar ]
• Evseev, P.; Lukianova, A.; Tarakanov, R.; Tokmakova, A.; Shneider, M.; Ignatov, A.; Miroshnikov, K. Curtobacterium spp. and Curtobacterium flaccumfaciens : Phylogeny, genomics-based taxonomy, pathogenicity, and diagnostics. Curr. Issues Mol. Biol. 2022 , 44 , 889–927. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Iasur Kruh, L.; Lahav, T.; Abu-Nassar, J.; Achdari, G.; Salami, R.; Freilich, S.; Aly, R. Host-parasite-bacteria triangle: The microbiome of the parasitic weed Phelipanche aegyptiaca and tomato- Solanum lycopersicum (Mill.) as a host. Front. Plant Sci. 2017 , 8 , 269. [ Google Scholar ] [ CrossRef ]
• Ali, A.; Haider, M.S.; Muhammad, A. Biological control of fruit lesions caused by Xanthomonas campestris pathovars from Cuscuta pedicellata Ledeb. in vitro. J. Pure Appl. Microbiol. 2013 , 7 , 3149–3153. [ Google Scholar ]
• Islam, R.; Rahman, M.S.; Rahman, S.M. GC-MS analysis and antibacterial activity of Cuscuta reflexa against bacterial pathogens. Asian Pac. J. Trop. Dis. 2015 , 5 , 399–403. [ Google Scholar ] [ CrossRef ]
• Saadoun, I.M.; Hameed, K.M.; Al-Momani, F.; Ababneh, Q. Effect of three Orobanche spp. extracts on some local phytopathogens, Agrobacterium and Erwinia. Turk. J. Biol. 2008 , 32 , 113–117. [ Google Scholar ]
• Ahmad, A.; Tandon, S.; Xuan, T.D.; Nooreen, Z. A Review on Phytoconstituents and Biological activities of Cuscuta species. Biomed. Pharmacother. 2017 , 92 , 772–795. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Genovese, C.; D’Angeli, F.; Attanasio, F.; Caserta, G.; Scarpaci, K.S.; Nicolosi, D. Phytochemical composition and biological activities of Orobanche crenata Forssk.: A review. Nat. Prod. Res. 2021 , 35 , 4579–4595. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Augustine, R.; Maikasuwa, B.; Etonihu, A. Phytochemical Screening, Thin Layer Chromatography and Antibacterial Activity of the Leaf Extracts of Striga hermonthica . Chem. Res. J. 2020 , 5 , 192. [ Google Scholar ]
• Moore, D.; Robson, G.D.; Trinci, A.P. 21st Century Guidebook to Fungi ; Cambridge University Press: Cambridge, UK, 2020. [ Google Scholar ]
• Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012 , 13 , 414–430. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gosling, P.; Hodge, A.; Goodlass, G.; Bending, G. Arbuscular mycorrhizal fungi and organic farming. Agric. Ecosyst. Environ. 2006 , 113 , 17–35. [ Google Scholar ] [ CrossRef ]
• Akram, S.; Ahmed, A.; He, P.; He, P.; Liu, Y.; Wu, Y.; Munir, S.; He, Y. Uniting the role of endophytic fungi against plant pathogens and their interaction. J. Fungi 2023 , 9 , 72. [ Google Scholar ] [ CrossRef ]
• Leake, J.R. The biology of myco-heterotrophic (‘saprophytic’) plants. New Phytol. 1994 , 127 , 171–216. [ Google Scholar ] [ CrossRef ]
• Suryanarayanan, T.; Senthilarasu, G.; Muruganandam, V. Endophytic fungi from Cuscuta reflexa and its host plants. Fungal Divers. 2000 , 4 , 117–123. [ Google Scholar ]
• Khare, E.; Vishwakarma, A.; Maurya, V.; Kaistha, S.D. Endophytic fungi from parasitic-plant Cuscuta , and their potential for producing L-asparaginase of pharmaceutical significance. Environ. Sustain. 2024 , 7 , 93–101. [ Google Scholar ] [ CrossRef ]
• Ruraż, K.; Przemieniecki, S.W.; Piwowarczyk, R. Interspecies and temporal dynamics of bacterial and fungal microbiomes of pistil stigmas in flowers in holoparasitic plants of the Orobanche series Alsaticae (Orobanchaceae). Sci. Rep. 2023 , 13 , 6749. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Gafar, N.Y.; Hassan, M.M.; Ahmed, M.M.; Osman, A.G.; Abdelgani, M.E.; Babiker, A.E. In vitro study of endophytic bacteria, carbohydrates and their combination on early developmental stages of Striga hermonthica (Del.) Benth. Adv. Environ. Biol. 2016 , 10 , 66–74. [ Google Scholar ]
• Lombard, L.; van Doorn, R.; Groenewald, J.; Tessema, T.; Kuramae, E.; Etolo, D.; Raaijmakers, J.; Crous, P. Fusarium diversity associated with the Sorghum- Striga interaction in Ethiopia. Fungal Syst. Evol. 2022 , 10 , 177–215. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dor, E.; Hershenhorn, J.; Andolfi, A.; Cimmino, A.; Evidente, A. Fusarium verticillioides as a new pathogen of the parasitic weed Orobanche spp. Phytoparasitica 2009 , 37 , 361–370. [ Google Scholar ] [ CrossRef ]
• Gibot-Leclerc, S.; Guinchard, L.; Edel-Hermann, V.; Dessaint, F.; Cartry, D.; Reibel, C.; Gautheron, N.; Bernaud, E.; Steinberg, C. Screening for potential mycoherbicides within the endophyte community of Phelipanche ramosa parasitizing tobacco. FEMS Microbiol. Ecol. 2022 , 98 , fiac024. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ibdah, M.; Dubey, N.K.; Eizenberg, H.; Dabour, Z.; Abu-Nassar, J.; Gal-On, A.; Aly, R. Cucumber Mosaic Virus as a carotenoid inhibitor reducing Phelipanche aegyptiaca infection in tobacco plants. Plant Signal. Behav. 2014 , 9 , e972146. [ Google Scholar ] [ CrossRef ]
• Bangar, V.; Joshi, M.; Valvi, H. Isolation and pathogenicity of pathogen causing diseases on dodder ( Cuscuta gronovii ). IJCS 2019 , 7 , 1769–1773. [ Google Scholar ]
• Cook, J.C.; Charudattan, R.; Zimmerman, T.W.; Rosskopf, E.N.; Stall, W.M.; MacDonald, G.E. Effects of Alternaria destruens , glyphosate, and ammonium sulfate individually and integrated for control of dodder ( Cuscuta pentagona ). Weed Technol. 2009 , 23 , 550–555. [ Google Scholar ] [ CrossRef ]
• Idris, A.E.; Abouzeid, M.A.; Boari, A.; Vurro, M.; Evidente, A. Identification of phytotoxic metabolites of a new Fusarium sp. inhibiting germination of Striga hermonthica seeds. Phytopathol. Mediterr. 2003 , 42 , 65–70. [ Google Scholar ]
• Khakimov, A.; Salakhutdinov, I.; Omolikov, A.; Utaganov, S. Traditional and current-prospective methods of agricultural plant diseases detection: A review. IOP Conf. Ser. Earth Environ. Sci. 2022 , 951 , 012002. [ Google Scholar ] [ CrossRef ]
• Mehetre, G.T.; Leo, V.V.; Singh, G.; Sorokan, A.; Maksimov, I.; Yadav, M.K.; Upadhyaya, K.; Hashem, A.; Alsaleh, A.N.; Dawoud, T.M. Current Developments and Challenges in Plant Viral Diagnostics: A Systematic Review. Viruses 2021 , 13 , 412. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Nair, S.; Manimekalai, R. Phytoplasma diseases of plants: Molecular diagnostics and way forward. World J. Microbiol. Biotechnol. 2021 , 37 , 102. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Boari, A.; Vurro, M. Evaluation of Fusarium spp. and other fungi as biological control agents of broomrape ( Orobanche ramosa ). Biol. Control 2004 , 30 , 212–219. [ Google Scholar ] [ CrossRef ]
• Durlik, K.; Żarnowiec, P.; Piwowarczyk, R.; Kaca, W. Culturable endophytic bacteria from Phelipanche ramosa (Orobanchaceae) seeds. Seed Sci. Res. 2021 , 31 , 69–75. [ Google Scholar ] [ CrossRef ]
• Kamińska, M.; Korbin, M. Graft and dodder transmission of phytoplasma affecting lily to experimental hosts. Acta Physiol. Plant. 1999 , 21 , 21–26. [ Google Scholar ] [ CrossRef ]
• van der Wolf, J.; De Boer, S.H. Phytopathogenic bacteria. In Principles of Plant-Microbe Interactions: Microbes for Sustainable Agriculture ; Springer: Cham, Switzerland, 2014; pp. 65–77. [ Google Scholar ]
• Hettenhausen, C.; Li, J.; Zhuang, H.; Sun, H.; Xu, Y.; Qi, J.; Zhang, J.; Lei, Y.; Qin, Y.; Sun, G. Stem parasitic plant Cuscuta australis (dodder) transfers herbivory-induced signals among plants. Proc. Natl. Acad. Sci. USA 2017 , 114 , E6703–E6709. [ Google Scholar ] [ CrossRef ]
• Avila, A.T.; Van Laar, T.A.; Constable, J.V.; Waselkov, K. 16S rRNA Gene Diversity of Bacterial Endophytes in Parasitic Cuscuta campestris and Its Helianthus annuus Host. Microbiol. Resour. Announc. 2020 , 9 , e00968-20. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Hogenhout, S.A.; Ammar, E.-D.; Whitfield, A.E.; Redinbaugh, M.G. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 2008 , 46 , 327–359. [ Google Scholar ] [ CrossRef ]
• Sarwar, M. Mite (Acari Acarina) vectors involved in transmission of plant viruses. In Applied Plant Virology ; Elsevier: Amsterdam, The Netherlands, 2020; pp. 257–273. [ Google Scholar ]
• de Lillo, E.; Freitas-Astúa, J.; Watanabe Kitajima, E.; Ramos-González, P.L.; Simoni, S.; Tassi, A.D.; Valenzano, D. Phytophagous mites transmitting plant viruses: Update and perspectives. Entomol. Gen. 2021 , 41 , 439. [ Google Scholar ] [ CrossRef ]
• Singh, S.; Awasthi, L.; Jangre, A.; Nirmalkar, V.K. Transmission of plant viruses through soil-inhabiting nematode vectors. In Applied Plant Virology ; Elsevier: Amsterdam, The Netherlands, 2020; pp. 291–300. [ Google Scholar ]
• Weintraub, P.G.; Beanland, L. Insect vectors of phytoplasmas. Annu. Rev. Entomol. 2006 , 51 , 91–111. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Alma, A.; Lessio, F.; Nickel, H. Insects as phytoplasma vectors: Ecological and epidemiological aspects. In Phytoplasmas: Plant Pathogenic Bacteria-II: Transmission and Management of Phytoplasma-Associated Diseases ; Springer: Singapore, 2019; pp. 1–25. [ Google Scholar ]
• Bini, A.P.; Serra, M.C.D.; Pastore, I.F.; Brondi, C.V.; Camargo, L.E.A.; Monteiro-Vitorello, C.B.; van Sluys, M.-A.; Rossi, G.D.; Creste, S. Transmission of Xanthomonas albilineans by the spittlebug, Mahanarva fimbriolata (Hemiptera: Cercopidae), in Brazil: First report of an insect vector for the causal agent of sugarcane leaf scald. J. Insect Sci. 2023 , 23 , 28. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kisera Kwach, J.; Nyakomitta, P.S. Diversity of Insects Associated with Banana in Banana Xanthomonas Wilt Epidemic Areas of Western Kenya. Asian J. Agric. Hortic. Res. 2022 , 9 , 1–12. [ Google Scholar ] [ CrossRef ]
• Esquivel, J.F.; Bell, A.A. Acquisition and Transmission of Fusarium oxysporum f. sp. vasinfectum VCG 0114 (Race 4) by Stink Bugs. Plant Dis. 2021 , 105 , 3082–3086. [ Google Scholar ] [ PubMed ]
• Song, J.; Bian, J.; Xue, N.; Xu, Y.; Wu, J. Inter-species mRNA transfer among green peach aphids, dodder parasites, and cucumber host plants. Plant Divers. 2022 , 44 , 1–10. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Piwowarczyk, R.; Mielczarek, Ł.; Panek-Wójcicka, M.; Ruraż, K. First report of Melanagromyza cuscutae (Diptera: Agromyzidae) from Poland. Fla. Entomol. 2020 , 103 , 124–126. [ Google Scholar ] [ CrossRef ]
• Bayram, Y.; Cikman, E. Efficiency of Pytomyza orobanchia Kaltenbach (Diptera: Agromyzidae) on Orobanche crenata Forsk. (Orobanchaceae) in Lentil Fields at Diyarbakır and Mardin Provinces, Turkey. Egypt. J. Biol. Pest Control 2016 , 26 , 365–371. [ Google Scholar ]
• Aistova, E.; Bezborodov, V. Weevils belonging to the Genus Smicronyx Schönherr, 1843 (Coleoptera, Curculionidae) affecting dodders ( Cuscuta Linnaeus, 1753) in the Russian Far East. Russ. J. Biol. Invasions 2017 , 8 , 184–188. [ Google Scholar ] [ CrossRef ]
• Zagorchev, L.; Albanova, I.; Lozanova, Y.; Odjakova, M.; Teofanova, D. Chitinase Profile of Arabidopsis, Subjected to the Combined Stress of Soil Salinity, Cuscuta campestris Parasitism and Herbivores. Proc. Bulg. Acad. Sci. 2022 , 75 , 835–844. [ Google Scholar ] [ CrossRef ]
• Cagáň, L.; Komáromyová, E.; Barta, M.; Tóth, P. Cuscuta lupuliformis Krocker (Cuscutaceae)—A new host for bean aphid, Aphis fabae Scopoli (Homoptera, Aphididae). Acta Fytotech. Zootech. 2001 , 4 , 84. [ Google Scholar ]
• Azami-Sardooei, Z.; Shahreyarinejad, S.; Rouzkhosh, M.; Fekrat, F. The first report on feeding of Oxycarenus hyalinipennis and Aphis fabae on dodder Cuscuta campestris in Iran. J. Crop Prot. 2018 , 7 , 121–124. [ Google Scholar ]
• Zhuang, H.; Li, J.; Song, J.; Hettenhausen, C.; Schuman, M.C.; Sun, G.; Zhang, C.; Li, J.; Song, D.; Wu, J. Aphid ( Myzus persicae ) feeding on the parasitic plant dodder ( Cuscuta australis ) activates defense responses in both the parasite and soybean host. New Phytol. 2018 , 218 , 1586–1596. [ Google Scholar ] [ CrossRef ]
• Piwowarczyk, R.; Guzikowski, S.; Depa, Ł.; Kaszyca, N. First report of Smynthurodes betae (Hemiptera: Aphididae) on Phelipanche ramosa (Orobanchaceae). Fla. Entomol. 2018 , 101 , 339–341. [ Google Scholar ] [ CrossRef ]
• Boukhris-Bouhachem, S.; Youssef, S.B.; Kharrat, M. First report of Geoica utricularia (Hemiptera: Aphididae) population on parasitic broomrape Orobanche foetida . Fla. Entomol. 2011 , 94 , 343–344. [ Google Scholar ] [ CrossRef ]
• Tóth, P.; Černý, M.; Cagáň, L. First records of Melanagromyza cuscutae Hering, 1958 (Diptera: Agromyzidae) from Slovakia and its new host plant. Entomol. Fenn. 2004 , 15 , 48–52. [ Google Scholar ] [ CrossRef ]
• Klein, O.; Kroschel, J. Biological control of Orobanche spp. with Phytomyza orobanchia , a review. Biocontrol 2002 , 47 , 245–277. [ Google Scholar ] [ CrossRef ]
• Al-Eryan, M.; Altahtawy, M.; El-Sherief, H.; Abu-Shall, A. Efficacy of Phytomyza orobanchia Kalt. in reduction of Orobanche crenata Forsk. seed yield under semi-field conditions. Egypt. J. Biol. Pest Control 2004 , 14 , 237–242. [ Google Scholar ]
• Zhekova, E.; Petkova, D.; Ivanova, I. Smicronyx smreczynskii F. Solari, 1952 (Insecta: Curculionidae): Possibilities for biological control of two Cuscuta species (Cuscutaceae) in district of Ruse. Acta Zool. Bulg. 2014 , 66 , 431–432. [ Google Scholar ]
• Otoidobiga, L.C.; Vincent, C.; Stewart, R.K. Relationship between Smicronyx spp. population and galling of Striga hermonthica (Del.) Benth. Int. J. Trop. Insect Sci. 1998 , 18 , 197–203. [ Google Scholar ] [ CrossRef ]
• Rubiales, D.; Fernández-Aparicio, M.; Wegmann, K.; Joel, D. Revisiting strategies for reducing the seedbank of Orobanche and Phelipanche spp. Weed Res. 2009 , 49 , 23–33. [ Google Scholar ] [ CrossRef ]
• Prider, J. The reproductive biology of the introduced root holoparasite Orobanche ramosa subsp. mutelii (Orobanchaceae) in South Australia. Aust. J. Bot. 2015 , 63 , 426–434. [ Google Scholar ]
• Goldwasser, Y.; Miryamchik, H.; Rubin, B.; Eizenberg, H. Field dodder ( Cuscuta campestris )—A new model describing temperature-dependent seed germination. Weed Sci. 2016 , 64 , 53–60. [ Google Scholar ] [ CrossRef ]
• Chalam, V.C.; Deepika, D.; Abhishek, G.; Maurya, A. Major seed-borne diseases of agricultural crops: International trade of agricultural products and role of quarantine. In Seed-Borne Diseases of Agricultural Crops: Detection, Diagnosis & Management ; Springer: Singapore, 2020; pp. 25–61. [ Google Scholar ]
• Bennett, C. Latent virus of dodder and its effect on sugar beet and other plants. Phytopathology 1944 , 34 , 77–91. [ Google Scholar ]
• Huet, S.; Pouvreau, J.-B.; Delage, E.; Delgrange, S.; Marais, C.; Bahut, M.; Delavault, P.; Simier, P.; Poulin, L. Populations of the parasitic plant Phelipanche ramosa influence their seed microbiota. Front. Plant Sci. 2020 , 11 , 1075. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Petrosyan, K.; Thijs, S.; Piwowarczyk, R.; Ruraż, K.; Kaca, W.; Vangronsveld, J. Diversity and potential plant growth promoting capacity of seed endophytic bacteria of the holoparasite Cistanche phelypaea (Orobanchaceae). Sci. Rep. 2023 , 13 , 11835. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Nadler-Hassar, T.; Shaner, D.L.; Nissen, S.; Westra, P.; Rubin, B. Are herbicide-resistant crops the answer to controlling Cuscuta ? Pest Manag. Sci. Former. Pestic. Sci. 2009 , 65 , 811–816. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bewick, T.; Porter, J.; Ostrowski, R. Smolder™: A bioherbicide for suppression of dodder ( Cuscuta spp.). In Proceedings of the Annual Meeting-Southern Weed Science Society, Tulsa, OK, USA, 24–26 January 2000. [ Google Scholar ]
• Hadizadeh, F.; Mehrvarz, S.S.; Mirpour, M.S. Effect of Bacillus spp. on seed germination of selected species of the genus Cuscuta (Convolvulaceae). Mod. Phytomorphol. 2014 , 6 , 97. [ Google Scholar ]
• Barghouthi, S.; Salman, M. Bacterial inhibition of Orobanche aegyptiaca and Orobanche cernua radical elongation. Biocontrol Sci. Technol. 2010 , 20 , 423–435. [ Google Scholar ] [ CrossRef ]
• Zermane, N.; Souissi, T.; Kroschel, J.; Sikora, R. Biocontrol of broomrape ( Orobanche crenata Forsk. and Orobanche foetida Poir.) by Pseudomonas fluorescens isolate Bf7-9 from the faba bean rhizosphere. Biocontrol Sci. Technol. 2007 , 17 , 483–497. [ Google Scholar ] [ CrossRef ]
• Elzein, A.; Kroschel, J. Fusarium oxysporum Foxy 2 shows potential to control both Striga hermonthica and S. Asiat . Weed Res. 2004 , 44 , 433–438. [ Google Scholar ] [ CrossRef ]
• Ndambi, B.; Cadisch, G.; Elzein, A.; Heller, A. Colonization and control of Striga hermonthica by Fusarium oxysporum f. sp. strigae , a mycoherbicide component: An anatomical study. Biol. Control 2011 , 58 , 149–159. [ Google Scholar ]
• Oula, D.A.; Nyongesah, J.M.; Odhiambo, G.; Wagai, S. The effectiveness of local strains of Fusarium oxysporium f. Sp. Strigae to control Striga hermonthica on local maize in western Kenya. Food Sci. Nutr. 2020 , 8 , 4352–4360. [ Google Scholar ] [ CrossRef ]
• Baker, C.S.; Sands, D.C.; Nzioki, H.S. The Toothpick Project: Commercialization of a virulence-selected fungal bioherbicide for Striga hermonthica (witchweed) biocontrol in Kenya. Pest Manag. Sci. 2024 , 80 , 65–71. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Müller-Stöver, D.; Kohlschmid, E.; Sauerborn, J. A novel strain of Fusarium oxysporum from Germany and its potential for biocontrol of Orobanche ramosa . Weed Res. 2009 , 49 , 175–182. [ Google Scholar ] [ CrossRef ]
• Anteyi, W.O.; Klaiber, I.; Rasche, F. Diacetoxyscirpenol, a Fusarium exometabolite, prevents efficiently the incidence of the parasitic weed Striga hermonthica . BMC Plant Biol. 2022 , 22 , 84. [ Google Scholar ] [ CrossRef ]
• Sands, D.C.; Pilgeram, A.L. Methods for selecting hypervirulent biocontrol agents of weeds: Why and how. Pest Manag. Sci. 2009 , 65 , 581–587. [ Google Scholar ] [ CrossRef ]

Share and Cite

Savov, S.; Marinova, B.; Teofanova, D.; Savov, M.; Odjakova, M.; Zagorchev, L. Parasitic Plants—Potential Vectors of Phytopathogens. Pathogens 2024 , 13 , 484. https://doi.org/10.3390/pathogens13060484

Savov S, Marinova B, Teofanova D, Savov M, Odjakova M, Zagorchev L. Parasitic Plants—Potential Vectors of Phytopathogens. Pathogens . 2024; 13(6):484. https://doi.org/10.3390/pathogens13060484

Savov, Stefan, Bianka Marinova, Denitsa Teofanova, Martin Savov, Mariela Odjakova, and Lyuben Zagorchev. 2024. "Parasitic Plants—Potential Vectors of Phytopathogens" Pathogens 13, no. 6: 484. https://doi.org/10.3390/pathogens13060484

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

• Share full article

Advertisement

Supported by

Guest Essay

Oil and Gas Companies Are Trying to Rig the Marketplace

By Andrew Dessler

Dr. Dessler is a professor of atmospheric sciences and the director of the Texas Center for Climate Studies at Texas A&M University.

Many of us focused on the problem of climate change have been waiting for the day when renewable energy would become cheaper than fossil fuels.

Well, we’re there: Solar and wind power are less expensive than oil, gas and coal in many places and are saving our economy billions of dollars . These and other renewable energy sources produced 30 percent of the world’s electricity in 2023, which may also have been the year that greenhouse gas emissions in the power sector peaked. In the United States alone, the amount of solar and wind energy capacity waiting to be built and connected to the grid is 18 times the amount of natural gas power capacity in the queue.

So you might reasonably conclude that the market is pivoting, and the end for fossil fuels is near.

But it’s not. Instead, fossil fuel interests — including think tanks, trade associations and dark money groups — are often preventing the market from shifting to the lowest cost energy.

Similar to other industries from tobacco to banking to pharmaceuticals, oil and gas interests use tactics like lobbying and manufacturing “grass-roots” support to maximize profits. They also spread misinformation: It’s well documented that fossil fuel interests tried to convince the public that their products didn’t cause climate change, in the same way that Big Tobacco tried to convince the public that its products didn’t harm people’s health.

But as renewables have become a more formidable competitor, we are now seeing something different: a large-scale effort to deceive the public into thinking that the alternative products are harmful, unreliable and worse for consumers. And as renewables continue to drop in cost, it will become even more critical for policymakers and others to challenge these attempts to slow the adoption of cheaper and healthier forms of energy.

One technique the industry and its allies have used is to spread falsehoods — for example, that offshore wind turbines kill whales or that renewable energy is prohibitively expensive — to stop projects from getting built. What appear to be ordinary concerned citizens or groups making good-faith arguments about renewable energy are actually a well-funded effort to disseminate a lie. Researchers at Brown University have revealed a complex web of fossil fuel interests, climate-denial think tanks and community groups that are behind opposition to wind farms off New Jersey, Massachusetts and Rhode Island.

We are having trouble retrieving the article content.

Please enable JavaScript in your browser settings.

Thank you for your patience while we verify access. If you are in Reader mode please exit and  log into  your Times account, or  subscribe  for all of The Times.

Thank you for your patience while we verify access.

Already a subscriber?  Log in .

Want all of The Times?  Subscribe .